Starting /dee2/code/volunteer_pipeline.sh SRR12671379 current disk space = 3052784848896 free memory = 1463145228 SRR12671379 SRAfilesize 66d9d70614ab860d2dee434a3cd95dbf SRR12671379.sra SRR12671379.sra file validated SRR12671379 is paired end SRR12671379 is conventional basespace SRR12671379 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671379_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.61 37.0 37.0 37.0 37.0 37.0 2 36.3675 37.0 37.0 37.0 37.0 37.0 3 36.6235 37.0 37.0 37.0 37.0 37.0 4 36.705 37.0 37.0 37.0 37.0 37.0 5 36.565 37.0 37.0 37.0 37.0 37.0 6 36.6165 37.0 37.0 37.0 37.0 37.0 7 36.583 37.0 37.0 37.0 37.0 37.0 8 36.628 37.0 37.0 37.0 37.0 37.0 9 36.6885 37.0 37.0 37.0 37.0 37.0 10-14 36.6318 37.0 37.0 37.0 37.0 37.0 15-19 36.624399999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.5815 37.0 37.0 37.0 37.0 37.0 25-29 36.5905 37.0 37.0 37.0 37.0 37.0 30-34 36.5141 37.0 37.0 37.0 37.0 37.0 35-39 36.533100000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.472899999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4979 37.0 37.0 37.0 37.0 37.0 50-54 36.4576 37.0 37.0 37.0 37.0 37.0 55-59 36.462300000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.38889999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.324 37.0 37.0 37.0 37.0 37.0 70-74 36.393 37.0 37.0 37.0 37.0 37.0 75-79 36.3865 37.0 37.0 37.0 37.0 37.0 80-84 36.3752 37.0 37.0 37.0 37.0 37.0 85-89 36.2875 37.0 37.0 37.0 37.0 37.0 90-94 36.2899 37.0 37.0 37.0 37.0 37.0 95-99 36.251400000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.267999999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.23180000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.1588 37.0 37.0 37.0 37.0 37.0 115-119 36.219899999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.1573 37.0 37.0 37.0 37.0 37.0 125-129 36.1497 37.0 37.0 37.0 37.0 37.0 130-134 36.1398 37.0 37.0 37.0 37.0 37.0 135-139 36.13719999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.9788 37.0 37.0 37.0 37.0 37.0 145-149 35.9723 37.0 37.0 37.0 37.0 37.0 150-151 35.87975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 2.0 23 1.0 24 1.0 25 0.0 26 3.0 27 6.0 28 10.0 29 7.0 30 21.0 31 37.0 32 41.0 33 54.0 34 99.0 35 279.0 36 2969.0 37 469.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.525 10.475 5.25 35.75 2 19.88977955911824 11.87374749498998 37.5250501002004 30.711422845691384 3 18.175 19.675 29.299999999999997 32.85 4 23.125 25.224999999999998 24.875 26.775 5 23.0 33.4 23.35 20.25 6 18.725 35.5 24.55 21.224999999999998 7 14.099999999999998 24.4 44.775 16.725 8 16.275000000000002 22.5 33.650000000000006 27.575 9 17.075000000000003 22.175 36.75 24.0 10-14 19.28 30.764999999999997 27.325 22.63 15-19 19.88 28.435 28.110000000000003 23.575 20-24 19.814999999999998 28.355000000000004 28.22 23.61 25-29 19.98 28.01 28.355000000000004 23.655 30-34 19.365 28.92 27.97 23.745 35-39 19.744999999999997 28.59 28.22 23.445 40-44 20.05 28.48 27.994999999999997 23.474999999999998 45-49 19.96 29.110000000000003 27.42 23.51 50-54 19.84 28.194999999999997 27.794999999999998 24.169999999999998 55-59 20.125 28.084999999999997 27.71 24.08 60-64 19.91 28.925 27.305 23.86 65-69 20.150000000000002 28.09 28.444999999999997 23.315 70-74 19.900000000000002 27.88 27.825 24.395 75-79 20.16 27.955000000000002 28.194999999999997 23.69 80-84 19.98 28.299999999999997 28.194999999999997 23.525 85-89 20.075000000000003 28.015 28.075 23.835 90-94 20.13 28.205000000000002 27.925 23.74 95-99 20.345 28.360000000000003 27.544999999999998 23.75 100-104 20.455000000000002 28.585 27.694999999999997 23.265 105-109 20.44 28.470000000000002 28.23 22.86 110-114 20.91 28.305000000000003 27.565 23.22 115-119 20.555 28.705000000000002 27.145000000000003 23.595 120-124 20.64 28.34 27.375 23.645 125-129 20.565 28.33 27.1 24.005000000000003 130-134 20.365 28.34 27.045 24.25 135-139 21.15 28.015 27.715 23.119999999999997 140-144 20.915 28.03 27.485 23.57 145-149 21.195 28.09 27.455000000000002 23.26 150-151 21.1875 28.3125 26.3 24.2 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.0 22 0.5 23 2.5 24 3.0 25 4.0 26 7.5 27 7.0 28 8.0 29 10.5 30 13.0 31 24.5 32 37.5 33 43.5 34 49.5 35 76.0 36 93.5 37 102.0 38 122.5 39 156.5 40 178.5 41 223.0 42 267.0 43 265.0 44 265.5 45 265.5 46 269.0 47 249.5 48 234.5 49 227.0 50 166.0 51 125.0 52 113.0 53 91.0 54 81.5 55 56.5 56 45.0 57 40.0 58 23.0 59 15.5 60 10.0 61 7.0 62 4.5 63 3.5 64 2.5 65 0.5 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.5 #Duplication Level Percentage of deduplicated Percentage of total 1 84.19161676646706 70.3 2 12.664670658682633 21.15 3 2.5149700598802394 6.3 4 0.4491017964071856 1.5 5 0.17964071856287425 0.75 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTTACTTTGTTGTTCCCCTCCTCACCTCTAACTCTAAGCATTGATACTT 5 0.125 No Hit CATGAGACTGCCATTTGGAACAAACTCATATACGAGCATTTGTTCACCTC 5 0.125 No Hit CATAAAACAAATCATGCATAAATCACACAAACAAATGATTCCTAGTCGAA 5 0.125 No Hit CGGACACTTCCTTCATGGATGGGCGGTTTACTCCTATGCTATTCAGGCAT 5 0.125 No Hit ATTTGCCTCATCAGGATCCTCATCAGCAATTTTACGGATCATATCAAGTG 5 0.125 No Hit GGTTCAAGTGGTGAGTTTGGGGAGATACTAACCGAGTCAACTGGATAAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.1375 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.725 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 1.9625 0.0 0.0 0.0 0.0 126-127 2.0875 0.0 0.0 0.0 0.0 128-129 2.2125 0.0 0.0 0.0 0.0 130-131 2.4125 0.0 0.0 0.0 0.0 132-133 2.575 0.0 0.0 0.0 0.0 134-135 2.6875 0.0 0.0 0.0 0.0 136-137 2.7625 0.0 0.0 0.0 0.0 138-139 3.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671379 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671379_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2315 37.0 37.0 37.0 37.0 37.0 2 35.982 37.0 37.0 37.0 37.0 37.0 3 35.995 37.0 37.0 37.0 37.0 37.0 4 36.0745 37.0 37.0 37.0 37.0 37.0 5 36.172 37.0 37.0 37.0 37.0 37.0 6 36.14 37.0 37.0 37.0 37.0 37.0 7 36.164 37.0 37.0 37.0 37.0 37.0 8 36.1505 37.0 37.0 37.0 37.0 37.0 9 36.228 37.0 37.0 37.0 37.0 37.0 10-14 36.21169999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.201899999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.1571 37.0 37.0 37.0 37.0 37.0 25-29 36.1583 37.0 37.0 37.0 37.0 37.0 30-34 36.089299999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.1186 37.0 37.0 37.0 37.0 37.0 40-44 36.1008 37.0 37.0 37.0 37.0 37.0 45-49 36.0635 37.0 37.0 37.0 37.0 37.0 50-54 36.0439 37.0 37.0 37.0 37.0 37.0 55-59 35.952099999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.9159 37.0 37.0 37.0 37.0 37.0 65-69 36.0212 37.0 37.0 37.0 37.0 37.0 70-74 35.937400000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.9336 37.0 37.0 37.0 37.0 37.0 80-84 35.849599999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.9036 37.0 37.0 37.0 37.0 37.0 90-94 35.8989 37.0 37.0 37.0 37.0 37.0 95-99 35.7267 37.0 37.0 37.0 37.0 37.0 100-104 35.7772 37.0 37.0 37.0 37.0 37.0 105-109 35.661 37.0 37.0 37.0 37.0 37.0 110-114 35.722300000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.7124 37.0 37.0 37.0 37.0 37.0 120-124 35.721799999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.7124 37.0 37.0 37.0 37.0 37.0 130-134 35.605599999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.404700000000005 37.0 37.0 37.0 32.2 37.0 140-144 35.5639 37.0 37.0 37.0 37.0 37.0 145-149 35.426 37.0 37.0 37.0 37.0 37.0 150-151 35.31675 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 2.0 15 3.0 16 1.0 17 2.0 18 0.0 19 0.0 20 1.0 21 4.0 22 6.0 23 2.0 24 3.0 25 9.0 26 10.0 27 21.0 28 16.0 29 20.0 30 19.0 31 32.0 32 58.0 33 85.0 34 205.0 35 604.0 36 2681.0 37 215.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.0 22.0 8.525 24.474999999999998 2 25.974999999999998 23.549999999999997 34.925 15.55 3 20.4 26.275 35.225 18.099999999999998 4 24.875 34.225 22.925 17.974999999999998 5 25.525 36.9 20.974999999999998 16.6 6 20.4 40.075 21.6 17.925 7 19.1 21.475 41.375 18.05 8 19.225 23.95 30.475 26.35 9 21.0 24.8 30.475 23.724999999999998 10-14 23.380000000000003 29.34 26.51 20.77 15-19 23.025000000000002 28.09 28.09 20.794999999999998 20-24 22.08 29.265 27.765 20.89 25-29 22.685 28.33 28.51 20.474999999999998 30-34 22.535 28.87 28.255000000000003 20.34 35-39 22.485 28.955 27.63 20.93 40-44 22.8 28.28 27.634999999999998 21.285 45-49 23.21 27.68 27.775 21.335 50-54 21.975 27.900000000000002 28.810000000000002 21.315 55-59 22.35 27.389999999999997 28.965000000000003 21.295 60-64 22.720000000000002 27.715 28.244999999999997 21.32 65-69 22.939999999999998 27.74 27.515 21.805 70-74 22.375 28.53 27.765 21.33 75-79 22.705000000000002 27.805000000000003 28.360000000000003 21.13 80-84 23.015 27.765 28.005000000000003 21.215 85-89 23.18 27.875 27.165 21.78 90-94 22.63 27.96 28.21 21.2 95-99 23.1 28.005000000000003 28.265 20.630000000000003 100-104 23.175 27.93 27.68 21.215 105-109 23.599999999999998 27.560000000000002 28.939999999999998 19.900000000000002 110-114 22.54 28.74 28.005000000000003 20.715 115-119 23.685000000000002 27.744999999999997 27.975 20.595 120-124 23.825 28.555000000000003 27.485 20.135 125-129 23.799999999999997 28.595 27.715 19.89 130-134 24.45 27.750000000000004 27.555000000000003 20.244999999999997 135-139 24.23 28.244999999999997 27.35 20.175 140-144 24.15 28.165000000000003 27.665 20.02 145-149 23.785 28.499999999999996 27.505000000000003 20.21 150-151 25.025 28.825 26.650000000000002 19.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 1.0 13 1.5 14 1.0 15 0.5 16 1.5 17 1.0 18 0.5 19 1.0 20 1.0 21 0.5 22 1.5 23 2.0 24 1.5 25 3.0 26 4.0 27 4.5 28 10.0 29 15.0 30 16.5 31 22.5 32 29.5 33 39.0 34 59.5 35 69.5 36 76.0 37 118.5 38 155.5 39 174.0 40 202.5 41 231.0 42 261.5 43 274.5 44 278.5 45 256.5 46 232.5 47 249.0 48 239.0 49 199.0 50 159.5 51 131.5 52 111.0 53 79.5 54 61.0 55 54.5 56 38.5 57 31.0 58 29.5 59 17.5 60 12.5 61 10.0 62 7.0 63 6.0 64 2.0 65 1.5 66 1.0 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.34313137372526 70.3 2 12.56748650269946 20.95 3 2.2795440911817635 5.7 4 0.5098980203959208 1.7000000000000002 5 0.20995800839832035 0.8750000000000001 6 0.05998800239952009 0.3 7 0.029994001199760045 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTAGCTTTCTCCAATTTCTTTTACACAGTCAAAAACCCTTTAGCAAAACC 7 0.17500000000000002 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit GATGGGACTAACCGAGTTAAGGTGGTCGAACACGGAGGTTGGCCGAGCTG 5 0.125 No Hit ATTGGTTCTGGGGGTTATGGAAACGTTTATAGAGGAGTTCTTCCTACTGG 5 0.125 No Hit ATCTATATGAGAGTTATTACAACACTAATAAAGCCAACCTGAAGCTGTAT 5 0.125 No Hit TGAAAATGACCGAGTCCAAGTCCAAGTCTAAGTCTAAGTCTAATAATTTA 5 0.125 No Hit ATGACCTTACTTCAACCGAAACCTTCATGTGTATTTTATCCTTCTAAACC 5 0.125 No Hit GAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCA 5 0.125 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.1375 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.725 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 1.9625 0.0 0.0 0.0 0.0 126-127 2.0875 0.0 0.0 0.0 0.0 128-129 2.2125 0.0 0.0 0.0 0.0 130-131 2.4125 0.0 0.0 0.0 0.0 132-133 2.575 0.0 0.0 0.0 0.0 134-135 2.6875 0.0 0.0 0.0 0.0 136-137 2.7625 0.0 0.0 0.0 0.0 138-139 3.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCACAG 10 0.006830828 145.0 6 GTAAAAA 10 0.006830828 145.0 1 >>END_MODULE Read 751847 spots for SRR12671379.sra Written 751847 spots for SRR12671379.sra Read 751847 spots for SRR12671379.sra Written 751847 spots for SRR12671379.sra Read 751847 spots for SRR12671379.sra Written 751847 spots for SRR12671379.sra Read 751847 spots for SRR12671379.sra Written 751847 spots for SRR12671379.sra Read 751847 spots for SRR12671379.sra Written 751847 spots for SRR12671379.sra Read 751847 spots for SRR12671379.sra Written 751847 spots for SRR12671379.sra Read 751847 spots for SRR12671379.sra Written 751847 spots for SRR12671379.sra Read 751847 spots for SRR12671379.sra Written 751847 spots for SRR12671379.sra Read 751847 spots for SRR12671379.sra Written 751847 spots for SRR12671379.sra Read 751847 spots for SRR12671379.sra Written 751847 spots for SRR12671379.sra Read 751864 spots for SRR12671379.sra Written 751864 spots for SRR12671379.sra Read 751847 spots for SRR12671379.sra Written 751847 spots for SRR12671379.sra Read 751847 spots for SRR12671379.sra Written 751847 spots for SRR12671379.sra Read 751847 spots for SRR12671379.sra Written 751847 spots for SRR12671379.sra Read 751847 spots for SRR12671379.sra Written 751847 spots for SRR12671379.sra Read 751847 spots for SRR12671379.sra Written 751847 spots for SRR12671379.sra Read 751847 spots for SRR12671379.sra Written 751847 spots for SRR12671379.sra Read 751847 spots for SRR12671379.sra Written 751847 spots for SRR12671379.sra Read 751847 spots for SRR12671379.sra Written 751847 spots for SRR12671379.sra Read 751847 spots for SRR12671379.sra Written 751847 spots for SRR12671379.sra SRR ids: ['SRR12671379.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pjq847zc SRR12671379.sra spots: 15036957 blocks: [[1, 751847], [751848, 1503694], [1503695, 2255541], [2255542, 3007388], [3007389, 3759235], [3759236, 4511082], [4511083, 5262929], [5262930, 6014776], [6014777, 6766623], [6766624, 7518470], [7518471, 8270317], [8270318, 9022164], [9022165, 9774011], [9774012, 10525858], [10525859, 11277705], [11277706, 12029552], [12029553, 12781399], [12781400, 13533246], [13533247, 14285093], [14285094, 15036957]] SRR12671379 file size 5088515 SRR12671379 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671379 SRR12671379_1.fastq SRR12671379_2.fastq Input file: SRR12671379_1.fastq Paired file: SRR12671379_2.fastq trimmed: SRR12671379-trimmed-pair1.fastq, SRR12671379-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:44:12 2025 >> started Tue Feb 11 20:44:29 2025 >> done (17.268s) 15036957 read pairs processed; of these: 86 ( 0.00%) short read pairs filtered out after trimming by size control 2267 ( 0.02%) empty read pairs filtered out after trimming by size control 15034604 (99.98%) read pairs available; of these: 672226 ( 4.47%) trimmed read pairs available after processing 14362378 (95.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 8 0.00% 20 7 0.00% 21 2 0.00% 22 15 0.00% 23 13 0.00% 24 7 0.00% 25 19 0.00% 26 18 0.00% 27 20 0.00% 28 22 0.00% 29 10 0.00% 30 23 0.00% 31 19 0.00% 32 17 0.00% 33 23 0.00% 34 28 0.00% 35 27 0.00% 36 18 0.00% 37 20 0.00% 38 25 0.00% 39 25 0.00% 40 21 0.00% 41 23 0.00% 42 22 0.00% 43 30 0.00% 44 24 0.00% 45 50 0.00% 46 32 0.00% 47 39 0.00% 48 54 0.00% 49 50 0.00% 50 55 0.00% 51 65 0.00% 52 77 0.00% 53 66 0.00% 54 63 0.00% 55 88 0.00% 56 105 0.00% 57 103 0.00% 58 126 0.00% 59 134 0.00% 60 147 0.00% 61 155 0.00% 62 170 0.00% 63 227 0.00% 64 235 0.00% 65 254 0.00% 66 284 0.00% 67 304 0.00% 68 348 0.00% 69 394 0.00% 70 506 0.00% 71 483 0.00% 72 545 0.00% 73 649 0.00% 74 718 0.00% 75 820 0.01% 76 840 0.01% 77 954 0.01% 78 1066 0.01% 79 1209 0.01% 80 1244 0.01% 81 1469 0.01% 82 1493 0.01% 83 1666 0.01% 84 1903 0.01% 85 2057 0.01% 86 2243 0.01% 87 2439 0.02% 88 2485 0.02% 89 2716 0.02% 90 2900 0.02% 91 3041 0.02% 92 3212 0.02% 93 3447 0.02% 94 3782 0.03% 95 4008 0.03% 96 4262 0.03% 97 4293 0.03% 98 4523 0.03% 99 4759 0.03% 100 5086 0.03% 101 5007 0.03% 102 5585 0.04% 103 5847 0.04% 104 5986 0.04% 105 6158 0.04% 106 6386 0.04% 107 6844 0.05% 108 6812 0.05% 109 7212 0.05% 110 7466 0.05% 111 7742 0.05% 112 7905 0.05% 113 8087 0.05% 114 8181 0.05% 115 8599 0.06% 116 9133 0.06% 117 9415 0.06% 118 9593 0.06% 119 9507 0.06% 120 10045 0.07% 121 10177 0.07% 122 10545 0.07% 123 10998 0.07% 124 11406 0.08% 125 11345 0.08% 126 12073 0.08% 127 12022 0.08% 128 12315 0.08% 129 13192 0.09% 130 12876 0.09% 131 13058 0.09% 132 13645 0.09% 133 13951 0.09% 134 14299 0.10% 135 14618 0.10% 136 15015 0.10% 137 15216 0.10% 138 15560 0.10% 139 16062 0.11% 140 16311 0.11% 141 16425 0.11% 142 16737 0.11% 143 17253 0.11% 144 17765 0.12% 145 17594 0.12% 146 18228 0.12% 147 18725 0.12% 148 19112 0.13% 149 19172 0.13% 150 20083 0.13% 151 14362378 95.53% 15034604 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=26 prefix-density=0.45 prefix-fanout=2.2 sequence=TTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTGTGGTGCTCACGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCATGTTGGCTTGTGCCGGGGTGCGGTTGACGGTGGCAACGGCTGCCGATGAGATCATAGAGGAGGAAGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=28.24 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=7.6 sequence=CCATCTTCTTCATCTATAGATTTCAATCACAACAG criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=31 prefix-density=0.43 prefix-fanout=2.2 sequence=TGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=75.06 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=9.4 sequence=AAAAGAAAAGAAAA SRR12671379 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:45:13 Started mapping on | Feb 11 20:45:14 Finished on | Feb 11 20:46:53 Mapping speed, Million of reads per hour | 546.71 Number of input reads | 15034604 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 13777748 Uniquely mapped reads % | 91.64% Average mapped length | 298.02 Number of splices: Total | 13910052 Number of splices: Annotated (sjdb) | 13619277 Number of splices: GT/AG | 13638312 Number of splices: GC/AG | 223338 Number of splices: AT/AC | 8211 Number of splices: Non-canonical | 40191 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 353655 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 89145 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.23% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 903201 903201 903201 N_multimapping 353655 353655 353655 N_noFeature 542558 13581249 605657 N_ambiguous 216020 937 82179 UnstrandedReadsAssigned:13019170 PositiveStrandReadsAssigned:195562 NegativeStrandReadsAssigned:13089912 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671379 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671379-trimmed-pair1.fastq SRR12671379-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,034,604 reads, 13,140,648 reads pseudoaligned [quant] estimated average fragment length: 308.934 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 925 rounds 52401 SRR12671379.ke.tsv 34699 SRR12671379.se.tsv 87100 total ==> SRR12671379.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1710.07 677 28.6443 Potri.005G024800.1.v4.1 1035 727.066 309 30.7501 Potri.004G059700.1.v4.1 961 653.388 5 0.553682 Potri.007G009000.2.v4.1 1416 1108.07 0 0 Potri.003G141000.2.v4.1 2943 2635.07 875.489 24.0393 Potri.016G087400.1.v4.1 270 71.0721 443 450.99 Potri.015G069301.1.v4.1 564 279.932 0 0 Potri.010G195200.1.v4.1 1773 1465.07 91 4.49414 Potri.012G127500.1.v4.1 977 669.258 78 8.43263 ==> SRR12671379.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 298 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 193 Potri.001G212900.v4.1 20 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12671379 completed mapping pipeline successfully