Starting /dee2/code/volunteer_pipeline.sh SRR12671380 current disk space = 3052963942400 free memory = 1441639992 SRR12671380 SRAfilesize 950e89dca860c4b5b2019bf1e8c650fb SRR12671380.sra SRR12671380.sra file validated SRR12671380 is paired end SRR12671380 is conventional basespace SRR12671380 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671380_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5775 37.0 37.0 37.0 37.0 37.0 2 36.39475 37.0 37.0 37.0 37.0 37.0 3 36.5125 37.0 37.0 37.0 37.0 37.0 4 36.5845 37.0 37.0 37.0 37.0 37.0 5 36.657 37.0 37.0 37.0 37.0 37.0 6 36.6335 37.0 37.0 37.0 37.0 37.0 7 36.5135 37.0 37.0 37.0 37.0 37.0 8 36.5705 37.0 37.0 37.0 37.0 37.0 9 36.5235 37.0 37.0 37.0 37.0 37.0 10-14 36.625899999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.5941 37.0 37.0 37.0 37.0 37.0 20-24 36.5866 37.0 37.0 37.0 37.0 37.0 25-29 36.559900000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.536199999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.5058 37.0 37.0 37.0 37.0 37.0 40-44 36.5231 37.0 37.0 37.0 37.0 37.0 45-49 36.4495 37.0 37.0 37.0 37.0 37.0 50-54 36.46510000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.4156 37.0 37.0 37.0 37.0 37.0 60-64 36.4231 37.0 37.0 37.0 37.0 37.0 65-69 36.41 37.0 37.0 37.0 37.0 37.0 70-74 36.3817 37.0 37.0 37.0 37.0 37.0 75-79 36.332100000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.3602 37.0 37.0 37.0 37.0 37.0 85-89 36.308499999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.2901 37.0 37.0 37.0 37.0 37.0 95-99 36.2625 37.0 37.0 37.0 37.0 37.0 100-104 36.3084 37.0 37.0 37.0 37.0 37.0 105-109 36.2749 37.0 37.0 37.0 37.0 37.0 110-114 36.2301 37.0 37.0 37.0 37.0 37.0 115-119 36.222899999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.1367 37.0 37.0 37.0 37.0 37.0 125-129 36.166700000000006 37.0 37.0 37.0 37.0 37.0 130-134 36.0996 37.0 37.0 37.0 37.0 37.0 135-139 36.0767 37.0 37.0 37.0 37.0 37.0 140-144 35.9704 37.0 37.0 37.0 37.0 37.0 145-149 35.9489 37.0 37.0 37.0 37.0 37.0 150-151 35.84975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 2.0 24 2.0 25 3.0 26 4.0 27 5.0 28 11.0 29 14.0 30 23.0 31 39.0 32 35.0 33 58.0 34 100.0 35 262.0 36 2940.0 37 500.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.74999999999999 12.075 4.55 31.624999999999996 2 21.193880110358666 13.092550790067719 35.49034361675445 30.22322548281916 3 19.3 19.3 28.425 32.975 4 21.45 26.3 24.775 27.474999999999998 5 23.150000000000002 34.699999999999996 22.525000000000002 19.625 6 19.025 34.875 22.85 23.25 7 15.45 26.224999999999998 40.675 17.65 8 17.2 25.424999999999997 33.175 24.2 9 17.325 23.025000000000002 36.05 23.599999999999998 10-14 20.04 30.39 26.634999999999998 22.935 15-19 19.775000000000002 28.384999999999998 28.095 23.745 20-24 20.06 28.355000000000004 27.800000000000004 23.785 25-29 20.244999999999997 28.395 27.52 23.84 30-34 20.13 28.994999999999997 27.36 23.515 35-39 19.259999999999998 29.099999999999998 28.035 23.605 40-44 20.205000000000002 29.15 27.355 23.29 45-49 20.745 28.505000000000003 27.975 22.775000000000002 50-54 20.22 28.63 27.439999999999998 23.71 55-59 19.88 28.465 27.91 23.745 60-64 20.380000000000003 28.249999999999996 27.24 24.13 65-69 20.685000000000002 28.605000000000004 27.084999999999997 23.625 70-74 20.07 29.39 27.045 23.494999999999997 75-79 19.7 28.67 28.044999999999998 23.585 80-84 20.01 28.860000000000003 27.185 23.945 85-89 20.28 28.685 27.185 23.849999999999998 90-94 21.01 28.12 27.065 23.805 95-99 20.375 28.095 28.08 23.45 100-104 20.830000000000002 28.53 27.275 23.365 105-109 20.44 28.405 27.155 24.0 110-114 20.015 28.860000000000003 27.465 23.66 115-119 20.955 28.389999999999997 26.86 23.794999999999998 120-124 20.435 28.305000000000003 27.279999999999998 23.98 125-129 20.95 28.625 26.875 23.549999999999997 130-134 20.94 28.665000000000003 26.705000000000002 23.69 135-139 20.919999999999998 28.655 26.96 23.465 140-144 21.375 28.310000000000002 26.685 23.630000000000003 145-149 21.08 28.199999999999996 27.57 23.150000000000002 150-151 21.4125 27.825 25.9875 24.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 1.0 24 2.0 25 4.5 26 6.5 27 5.0 28 12.0 29 18.5 30 17.5 31 31.5 32 41.0 33 44.0 34 53.5 35 61.0 36 71.0 37 101.5 38 138.5 39 159.0 40 180.5 41 229.5 42 248.5 43 233.0 44 237.0 45 239.5 46 249.0 47 254.5 48 241.0 49 229.0 50 200.0 51 159.0 52 121.0 53 88.0 54 84.0 55 66.0 56 46.5 57 42.0 58 28.0 59 20.0 60 12.5 61 6.0 62 2.5 63 2.0 64 2.0 65 0.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.125 #Duplication Level Percentage of deduplicated Percentage of total 1 86.02055800293685 73.225 2 11.248164464023496 19.15 3 2.0851688693098382 5.325 4 0.5580029368575624 1.9 5 0.05873715124816446 0.25 6 0.02936857562408223 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTGAAGCTTTGATCGCCATTAGTGGTGAGCGTATCAACGTATTGAATGGA 6 0.15 No Hit GTGCTCTGGATATACCAGTGGCGTTGACGGAGTGAATGAAGACCAAGCTT 5 0.125 No Hit ATGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.2375 0.0 0.0 0.0 0.0 112-113 1.4249999999999998 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0125 0.0 118-119 2.2125000000000004 0.0 0.0 0.025 0.0 120-121 2.5625 0.0 0.0 0.025 0.0 122-123 2.7625 0.0 0.0 0.025 0.0 124-125 2.9875 0.0 0.0 0.025 0.0 126-127 3.1875 0.0 0.0 0.025 0.0 128-129 3.4875 0.0 0.0 0.025 0.0 130-131 3.7625 0.0 0.0 0.025 0.0 132-133 4.1125 0.0 0.0 0.025 0.0 134-135 4.375 0.0 0.0 0.025 0.0 136-137 4.6125 0.0 0.0 0.025 0.0 138-139 4.9375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACAAA 10 0.006830828 145.0 5 >>END_MODULE SRR12671380 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671380_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.286 37.0 37.0 37.0 37.0 37.0 2 36.135 37.0 37.0 37.0 37.0 37.0 3 36.258 37.0 37.0 37.0 37.0 37.0 4 36.2835 37.0 37.0 37.0 37.0 37.0 5 36.2755 37.0 37.0 37.0 37.0 37.0 6 36.2205 37.0 37.0 37.0 37.0 37.0 7 36.17 37.0 37.0 37.0 37.0 37.0 8 36.2815 37.0 37.0 37.0 37.0 37.0 9 36.187 37.0 37.0 37.0 37.0 37.0 10-14 36.2679 37.0 37.0 37.0 37.0 37.0 15-19 36.2354 37.0 37.0 37.0 37.0 37.0 20-24 36.1703 37.0 37.0 37.0 37.0 37.0 25-29 36.117999999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.0761 37.0 37.0 37.0 37.0 37.0 35-39 36.0777 37.0 37.0 37.0 37.0 37.0 40-44 36.0526 37.0 37.0 37.0 37.0 37.0 45-49 36.080600000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.040499999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.030899999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.92470000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.9995 37.0 37.0 37.0 37.0 37.0 70-74 35.896 37.0 37.0 37.0 37.0 37.0 75-79 35.9415 37.0 37.0 37.0 37.0 37.0 80-84 35.8802 37.0 37.0 37.0 37.0 37.0 85-89 35.8848 37.0 37.0 37.0 37.0 37.0 90-94 35.867399999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.7564 37.0 37.0 37.0 37.0 37.0 100-104 35.7811 37.0 37.0 37.0 37.0 37.0 105-109 35.7631 37.0 37.0 37.0 37.0 37.0 110-114 35.6888 37.0 37.0 37.0 37.0 37.0 115-119 35.7094 37.0 37.0 37.0 37.0 37.0 120-124 35.681400000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.6977 37.0 37.0 37.0 37.0 37.0 130-134 35.5865 37.0 37.0 37.0 37.0 37.0 135-139 35.5477 37.0 37.0 37.0 37.0 37.0 140-144 35.5873 37.0 37.0 37.0 37.0 37.0 145-149 35.4879 37.0 37.0 37.0 37.0 37.0 150-151 35.3035 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 9.0 14 7.0 15 6.0 16 3.0 17 3.0 18 2.0 19 5.0 20 3.0 21 4.0 22 3.0 23 5.0 24 3.0 25 5.0 26 5.0 27 14.0 28 11.0 29 13.0 30 31.0 31 33.0 32 37.0 33 85.0 34 152.0 35 466.0 36 2761.0 37 333.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.075 25.2 7.7 19.025 2 27.175 25.3 31.525 16.0 3 21.025 27.250000000000004 34.575 17.150000000000002 4 25.525 33.6 22.775000000000002 18.099999999999998 5 26.025 38.6 19.2 16.175 6 21.575 38.574999999999996 20.575 19.275000000000002 7 20.599999999999998 23.125 37.325 18.95 8 20.674999999999997 25.55 27.650000000000002 26.125 9 20.625 24.775 30.375000000000004 24.224999999999998 10-14 23.865 29.04 26.290000000000003 20.805 15-19 23.494999999999997 28.15 27.650000000000002 20.705000000000002 20-24 23.415 28.12 27.639999999999997 20.825 25-29 23.580000000000002 28.155 28.134999999999998 20.13 30-34 22.64 27.794999999999998 28.185 21.38 35-39 23.315 27.805000000000003 27.54 21.34 40-44 22.765 28.035 27.79 21.41 45-49 23.115 26.919999999999998 28.794999999999998 21.17 50-54 22.48 27.91 28.515 21.095 55-59 23.23 27.845 28.110000000000003 20.815 60-64 23.330000000000002 27.625 27.725 21.32 65-69 23.369999999999997 26.995 28.225 21.41 70-74 22.68 27.42 27.834999999999997 22.065 75-79 23.21 27.66 28.34 20.79 80-84 23.34 27.96 27.534999999999997 21.165 85-89 23.135 28.349999999999998 27.544999999999998 20.97 90-94 23.715 27.615000000000002 27.36 21.310000000000002 95-99 23.935000000000002 27.865000000000002 27.400000000000002 20.8 100-104 23.13 27.805000000000003 28.194999999999997 20.87 105-109 23.41 27.755000000000003 28.325 20.51 110-114 23.474999999999998 28.189999999999998 27.500000000000004 20.835 115-119 24.415 27.985 27.310000000000002 20.29 120-124 23.79 28.035 27.36 20.815 125-129 24.705 28.175 27.055 20.064999999999998 130-134 23.93 27.865000000000002 27.805000000000003 20.4 135-139 25.155 27.529999999999998 27.625 19.689999999999998 140-144 25.064999999999998 27.73 27.22 19.985 145-149 24.825 27.889999999999997 27.255000000000003 20.03 150-151 25.974999999999998 28.5625 26.75 18.712500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.0 17 1.0 18 2.5 19 3.0 20 2.5 21 2.0 22 1.5 23 2.0 24 3.5 25 4.5 26 5.5 27 6.5 28 9.0 29 13.0 30 16.5 31 22.5 32 24.5 33 29.0 34 51.5 35 66.0 36 83.5 37 100.5 38 117.5 39 147.0 40 187.0 41 218.5 42 245.0 43 268.0 44 279.5 45 290.5 46 260.0 47 233.5 48 225.0 49 205.5 50 165.5 51 136.5 52 122.0 53 100.0 54 81.0 55 64.5 56 53.5 57 38.0 58 24.5 59 14.5 60 12.5 61 13.0 62 7.5 63 3.5 64 3.0 65 1.5 66 2.0 67 2.5 68 1.0 69 1.5 70 2.0 71 1.0 72 1.0 73 1.0 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.5 80 1.5 81 1.0 82 0.5 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.5 98 0.5 99 0.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.0 #Duplication Level Percentage of deduplicated Percentage of total 1 86.41176470588235 73.45 2 10.764705882352942 18.3 3 2.1176470588235294 5.4 4 0.4705882352941176 1.6 5 0.1176470588235294 0.5 6 0.08823529411764706 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02941176470588235 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 12 0.3 No Hit GGCAAAACAAGAGGAGGAAACAAGAGGATATTTCGAGGGAATAGCTCCTA 6 0.15 No Hit ATTGAATCTCTCAAGAAACTCCTCAGTGATAAGGAAGAGCTGAAAACTGT 6 0.15 No Hit GGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATG 6 0.15 No Hit AAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACTACCATC 5 0.125 No Hit GATATGTAAGGAGCATGAGGTGGAGGCCATAGATGCTGATCCAGTAAAAT 5 0.125 No Hit GGATGGTAGAGTAGCATCCTTAGCGTTGCTGGTTTACTTTCCTAACAATC 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.6124999999999998 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.2625 0.0 0.0 0.0 0.0 120-121 2.6375 0.0 0.0 0.0 0.0 122-123 2.8375 0.0 0.0 0.0 0.0 124-125 3.0625 0.0 0.0 0.0 0.0 126-127 3.2625 0.0 0.0 0.0 0.0 128-129 3.575 0.0 0.0 0.0 0.0 130-131 3.8625 0.0 0.0 0.0 0.0 132-133 4.2125 0.0 0.0 0.0 0.0 134-135 4.487500000000001 0.0 0.0 0.0 0.0 136-137 4.7375 0.0 0.0 0.0 0.0 138-139 5.074999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAATTT 10 0.006830828 145.0 3 GATTCTG 10 0.006830828 145.0 4 TTGAAAG 10 0.006830828 145.0 3 >>END_MODULE Read 860185 spots for SRR12671380.sra Written 860185 spots for SRR12671380.sra Read 860185 spots for SRR12671380.sra Written 860185 spots for SRR12671380.sra Read 860185 spots for SRR12671380.sra Written 860185 spots for SRR12671380.sra Read 860185 spots for SRR12671380.sra Written 860185 spots for SRR12671380.sra Read 860185 spots for SRR12671380.sra Written 860185 spots for SRR12671380.sra Read 860185 spots for SRR12671380.sra Written 860185 spots for SRR12671380.sra Read 860185 spots for SRR12671380.sra Written 860185 spots for SRR12671380.sra Read 860185 spots for SRR12671380.sra Written 860185 spots for SRR12671380.sra Read 860185 spots for SRR12671380.sra Written 860185 spots for SRR12671380.sra Read 860185 spots for SRR12671380.sra Written 860185 spots for SRR12671380.sra Read 860185 spots for SRR12671380.sra Written 860185 spots for SRR12671380.sra Read 860185 spots for SRR12671380.sra Written 860185 spots for SRR12671380.sra Read 860185 spots for SRR12671380.sra Written 860185 spots for SRR12671380.sra Read 860185 spots for SRR12671380.sra Written 860185 spots for SRR12671380.sra Read 860185 spots for SRR12671380.sra Written 860185 spots for SRR12671380.sra Read 860185 spots for SRR12671380.sra Written 860185 spots for SRR12671380.sra Read 860185 spots for SRR12671380.sra Written 860185 spots for SRR12671380.sra Read 860199 spots for SRR12671380.sra Written 860199 spots for SRR12671380.sra Read 860185 spots for SRR12671380.sra Written 860185 spots for SRR12671380.sra Read 860185 spots for SRR12671380.sra Written 860185 spots for SRR12671380.sra SRR ids: ['SRR12671380.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r55xzahc SRR12671380.sra spots: 17203714 blocks: [[1, 860185], [860186, 1720370], [1720371, 2580555], [2580556, 3440740], [3440741, 4300925], [4300926, 5161110], [5161111, 6021295], [6021296, 6881480], [6881481, 7741665], [7741666, 8601850], [8601851, 9462035], [9462036, 10322220], [10322221, 11182405], [11182406, 12042590], [12042591, 12902775], [12902776, 13762960], [13762961, 14623145], [14623146, 15483330], [15483331, 16343515], [16343516, 17203714]] SRR12671380 file size 5824874 SRR12671380 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671380 SRR12671380_1.fastq SRR12671380_2.fastq Input file: SRR12671380_1.fastq Paired file: SRR12671380_2.fastq trimmed: SRR12671380-trimmed-pair1.fastq, SRR12671380-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:04:16 2025 >> started Tue Feb 11 21:04:44 2025 >> done (27.720s) 17203714 read pairs processed; of these: 69 ( 0.00%) short read pairs filtered out after trimming by size control 5036 ( 0.03%) empty read pairs filtered out after trimming by size control 17198609 (99.97%) read pairs available; of these: 1304696 ( 7.59%) trimmed read pairs available after processing 15893913 (92.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 4 0.00% 20 9 0.00% 21 4 0.00% 22 10 0.00% 23 7 0.00% 24 5 0.00% 25 17 0.00% 26 18 0.00% 27 16 0.00% 28 19 0.00% 29 17 0.00% 30 15 0.00% 31 7 0.00% 32 26 0.00% 33 12 0.00% 34 19 0.00% 35 20 0.00% 36 22 0.00% 37 15 0.00% 38 24 0.00% 39 21 0.00% 40 22 0.00% 41 20 0.00% 42 29 0.00% 43 30 0.00% 44 27 0.00% 45 25 0.00% 46 32 0.00% 47 43 0.00% 48 47 0.00% 49 40 0.00% 50 74 0.00% 51 76 0.00% 52 86 0.00% 53 85 0.00% 54 81 0.00% 55 106 0.00% 56 112 0.00% 57 134 0.00% 58 167 0.00% 59 167 0.00% 60 211 0.00% 61 217 0.00% 62 252 0.00% 63 299 0.00% 64 334 0.00% 65 411 0.00% 66 374 0.00% 67 474 0.00% 68 568 0.00% 69 596 0.00% 70 713 0.00% 71 823 0.00% 72 958 0.01% 73 1060 0.01% 74 1181 0.01% 75 1366 0.01% 76 1387 0.01% 77 1553 0.01% 78 1694 0.01% 79 1867 0.01% 80 2179 0.01% 81 2382 0.01% 82 2622 0.02% 83 2867 0.02% 84 3255 0.02% 85 3446 0.02% 86 3708 0.02% 87 3937 0.02% 88 4322 0.03% 89 4355 0.03% 90 4932 0.03% 91 5206 0.03% 92 5544 0.03% 93 6094 0.04% 94 6403 0.04% 95 7018 0.04% 96 7209 0.04% 97 7487 0.04% 98 7736 0.04% 99 8142 0.05% 100 8783 0.05% 101 8851 0.05% 102 9718 0.06% 103 10132 0.06% 104 10490 0.06% 105 11208 0.07% 106 11304 0.07% 107 11951 0.07% 108 12545 0.07% 109 12627 0.07% 110 13281 0.08% 111 13716 0.08% 112 13966 0.08% 113 14633 0.09% 114 15381 0.09% 115 16047 0.09% 116 16843 0.10% 117 17534 0.10% 118 18026 0.10% 119 18142 0.11% 120 18714 0.11% 121 19498 0.11% 122 20356 0.12% 123 20749 0.12% 124 21802 0.13% 125 22444 0.13% 126 23610 0.14% 127 23930 0.14% 128 24552 0.14% 129 25625 0.15% 130 26159 0.15% 131 26233 0.15% 132 27297 0.16% 133 28122 0.16% 134 28360 0.16% 135 29479 0.17% 136 29924 0.17% 137 30941 0.18% 138 31377 0.18% 139 32969 0.19% 140 33299 0.19% 141 34304 0.20% 142 34972 0.20% 143 35485 0.21% 144 36406 0.21% 145 37094 0.22% 146 37984 0.22% 147 38777 0.23% 148 40347 0.23% 149 40191 0.23% 150 41611 0.24% 151 15893913 92.41% 17198609 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=35 prefix-density=0.58 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=35 fanout-score=125.19 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=13.4 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATT criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=33 prefix-density=0.67 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=31.47 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=1.8 sequence=CAAGAGAATCAGACACCTTCGTTCCTCGTGTTGCTTGCATATTTGGACACTCTATACTCCAAGCTGTTTTAACAAAAGAAAAAAGAAGGCAGTCAAATGGCCACTACTGCTTCTCCAATGGCCAGCCAGCTCAAAAGCAGCCTTGCCTCATCTCTAGGAAGGAGGCTTGTCATCCCCAGAGGCATTTCTGGAGCTCCATTTAGAGTTTCGCCCAACAAGAGAAGCTTCACTGTCAAAGCCGTTCAAGCAGACAAGCCAACTTACCAAGTGGTTCAACCAATCAATGGCGATCCCTTCATTGGAAGTCTTGAGACTCCCGTTACATCAAGCCCGCTGATTGCATGGTACCTGTCCAACCTCCCCGCCTACAGGACAGCAGTCAGTCCACTTCTCCGCGGAATCGAGGTGGGGCTGGCCCATGGCTTCC SRR12671380 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:05:35 Started mapping on | Feb 11 21:05:36 Finished on | Feb 11 21:07:35 Mapping speed, Million of reads per hour | 520.29 Number of input reads | 17198609 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 15723576 Uniquely mapped reads % | 91.42% Average mapped length | 296.73 Number of splices: Total | 16038280 Number of splices: Annotated (sjdb) | 15700951 Number of splices: GT/AG | 15717732 Number of splices: GC/AG | 262397 Number of splices: AT/AC | 9243 Number of splices: Non-canonical | 48908 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 383356 % of reads mapped to multiple loci | 2.23% Number of reads mapped to too many loci | 48256 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.90% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1091677 1091677 1091677 N_multimapping 383356 383356 383356 N_noFeature 575085 15439057 679892 N_ambiguous 281356 1285 100837 UnstrandedReadsAssigned:14867135 PositiveStrandReadsAssigned:283234 NegativeStrandReadsAssigned:14942847 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671380 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671380-trimmed-pair1.fastq SRR12671380-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,198,609 reads, 14,927,145 reads pseudoaligned [quant] estimated average fragment length: 272.395 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52401 SRR12671380.ke.tsv 34699 SRR12671380.se.tsv 87100 total ==> SRR12671380.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.6 475 15.383 Potri.005G024800.1.v4.1 1035 763.605 190 14.0743 Potri.004G059700.1.v4.1 961 689.85 0 0 Potri.007G009000.2.v4.1 1416 1144.6 0 0 Potri.003G141000.2.v4.1 2943 2671.6 770.921 16.3222 Potri.016G087400.1.v4.1 270 79.5775 552.615 392.801 Potri.015G069301.1.v4.1 564 308.865 0 0 Potri.010G195200.1.v4.1 1773 1501.6 76 2.86285 Potri.012G127500.1.v4.1 977 705.699 84 6.73288 ==> SRR12671380.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 144 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 228 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12671380 completed mapping pipeline successfully