Starting /dee2/code/volunteer_pipeline.sh SRR12671381 current disk space = 3052904943616 free memory = 1463115956 SRR12671381 SRAfilesize 40ddbd158345434045cc6a3b5df81e0a SRR12671381.sra SRR12671381.sra file validated SRR12671381 is paired end SRR12671381 is conventional basespace SRR12671381 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671381_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5015 37.0 37.0 37.0 37.0 37.0 2 36.42275 37.0 37.0 37.0 37.0 37.0 3 36.6235 37.0 37.0 37.0 37.0 37.0 4 36.6195 37.0 37.0 37.0 37.0 37.0 5 36.555 37.0 37.0 37.0 37.0 37.0 6 36.642 37.0 37.0 37.0 37.0 37.0 7 36.599 37.0 37.0 37.0 37.0 37.0 8 36.6325 37.0 37.0 37.0 37.0 37.0 9 36.6385 37.0 37.0 37.0 37.0 37.0 10-14 36.6191 37.0 37.0 37.0 37.0 37.0 15-19 36.59589999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.6032 37.0 37.0 37.0 37.0 37.0 25-29 36.5532 37.0 37.0 37.0 37.0 37.0 30-34 36.505700000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.4994 37.0 37.0 37.0 37.0 37.0 40-44 36.4815 37.0 37.0 37.0 37.0 37.0 45-49 36.438900000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.4079 37.0 37.0 37.0 37.0 37.0 55-59 36.4303 37.0 37.0 37.0 37.0 37.0 60-64 36.3779 37.0 37.0 37.0 37.0 37.0 65-69 36.3817 37.0 37.0 37.0 37.0 37.0 70-74 36.35730000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.3587 37.0 37.0 37.0 37.0 37.0 80-84 36.276300000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.2918 37.0 37.0 37.0 37.0 37.0 90-94 36.2302 37.0 37.0 37.0 37.0 37.0 95-99 36.2242 37.0 37.0 37.0 37.0 37.0 100-104 36.1964 37.0 37.0 37.0 37.0 37.0 105-109 36.2418 37.0 37.0 37.0 37.0 37.0 110-114 36.1188 37.0 37.0 37.0 37.0 37.0 115-119 36.1527 37.0 37.0 37.0 37.0 37.0 120-124 36.126999999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.1354 37.0 37.0 37.0 37.0 37.0 130-134 36.037600000000005 37.0 37.0 37.0 37.0 37.0 135-139 36.0755 37.0 37.0 37.0 37.0 37.0 140-144 35.9573 37.0 37.0 37.0 37.0 37.0 145-149 35.9657 37.0 37.0 37.0 37.0 37.0 150-151 35.958749999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 0.0 20 2.0 21 0.0 22 1.0 23 1.0 24 3.0 25 3.0 26 5.0 27 5.0 28 11.0 29 14.0 30 21.0 31 26.0 32 44.0 33 57.0 34 110.0 35 273.0 36 2958.0 37 464.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.975 11.774999999999999 5.825 37.425000000000004 2 18.707738542449288 11.620335587277737 40.72126220886552 28.95066366140746 3 17.474999999999998 18.25 28.249999999999996 36.025 4 23.775 26.674999999999997 23.0 26.55 5 22.775000000000002 33.324999999999996 25.124999999999996 18.775 6 19.225 35.0 24.625 21.15 7 16.375 25.85 41.65 16.125 8 14.549999999999999 23.974999999999998 35.575 25.900000000000002 9 16.275000000000002 21.55 36.15 26.025 10-14 19.314999999999998 29.675 28.349999999999998 22.66 15-19 19.715 28.439999999999998 27.900000000000002 23.945 20-24 19.93 28.22 27.76 24.09 25-29 19.765 28.754999999999995 27.544999999999998 23.935000000000002 30-34 19.794999999999998 27.71 28.07 24.425 35-39 20.04 28.365000000000002 27.83 23.765 40-44 20.225 28.53 27.935 23.31 45-49 20.07 28.000000000000004 27.875 24.055 50-54 20.465 27.63 28.205000000000002 23.7 55-59 19.715 27.794999999999998 28.255000000000003 24.235 60-64 19.715 28.625 27.325 24.335 65-69 19.875 28.17 28.444999999999997 23.51 70-74 19.85 27.925 27.735 24.490000000000002 75-79 19.455 27.93 28.21 24.404999999999998 80-84 20.03 28.29 28.095 23.585 85-89 20.06 29.115000000000002 27.115000000000002 23.71 90-94 20.285 28.175 28.035 23.505000000000003 95-99 20.265 29.23 26.87 23.635 100-104 20.28 28.43 27.334999999999997 23.955000000000002 105-109 20.349999999999998 29.085 27.3 23.265 110-114 21.135 27.425 28.084999999999997 23.355 115-119 20.880000000000003 27.200000000000003 28.105000000000004 23.815 120-124 19.794999999999998 28.345 27.944999999999997 23.915 125-129 20.68 28.050000000000004 27.3 23.97 130-134 20.05 28.305000000000003 27.965 23.68 135-139 20.115 28.105000000000004 27.725 24.055 140-144 20.305 27.755000000000003 27.860000000000003 24.08 145-149 20.26 28.64 27.445000000000004 23.655 150-151 21.462500000000002 28.075 26.950000000000003 23.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 1.0 22 2.0 23 3.0 24 2.0 25 3.0 26 4.5 27 8.0 28 12.5 29 14.0 30 17.5 31 28.0 32 40.5 33 46.0 34 48.5 35 60.0 36 78.5 37 103.5 38 124.0 39 150.5 40 198.0 41 221.0 42 233.5 43 260.0 44 274.0 45 256.5 46 248.5 47 263.0 48 232.0 49 189.5 50 181.0 51 157.0 52 129.5 53 103.5 54 76.0 55 60.5 56 46.0 57 33.0 58 21.0 59 19.5 60 15.5 61 8.5 62 6.0 63 4.0 64 4.5 65 3.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.05 #Duplication Level Percentage of deduplicated Percentage of total 1 86.03762492651381 73.175 2 11.199294532627865 19.05 3 2.204585537918871 5.625 4 0.3821281599059377 1.3 5 0.08818342151675485 0.375 6 0.058788947677836566 0.3 7 0.029394473838918283 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCAAACCCACTCACCTGAGGAGCCAACTCGGTCCCTTCTCTCTCTACT 7 0.17500000000000002 No Hit GCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAA 6 0.15 No Hit GTCAAATTTTCGCTTTGTGGTAGACTTTCCTCGAGGAAGATTCTCATGTA 6 0.15 No Hit CACAGATACATATATCATGAGGAGGTTGTCACCATCACGTTCCAAGTACG 5 0.125 No Hit ATCCGAGACAGTATCTGTTTCTGCAGACACAATTGTTGATCTAACCAATT 5 0.125 No Hit CAGAGATCTTACCAGCCAAGGATTTCAAACAGTTGCAGACCCCTTGGCGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.7375 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 0.9874999999999999 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.225 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.5499999999999998 0.0 0.0 0.0 0.0 126-127 1.6625 0.0 0.0 0.0 0.0 128-129 1.8875000000000002 0.0 0.0 0.0 0.0 130-131 2.1875 0.0 0.0 0.0 0.0 132-133 2.4375 0.0 0.0 0.0 0.0 134-135 2.6875 0.0 0.0 0.0 0.0 136-137 2.825 0.0 0.0 0.0 0.0 138-139 3.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671381 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671381_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3165 37.0 37.0 37.0 37.0 37.0 2 35.8535 37.0 37.0 37.0 37.0 37.0 3 36.0265 37.0 37.0 37.0 37.0 37.0 4 36.08 37.0 37.0 37.0 37.0 37.0 5 36.178 37.0 37.0 37.0 37.0 37.0 6 36.237 37.0 37.0 37.0 37.0 37.0 7 36.084 37.0 37.0 37.0 37.0 37.0 8 36.194 37.0 37.0 37.0 37.0 37.0 9 36.217 37.0 37.0 37.0 37.0 37.0 10-14 36.29260000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.2042 37.0 37.0 37.0 37.0 37.0 20-24 36.1365 37.0 37.0 37.0 37.0 37.0 25-29 36.1278 37.0 37.0 37.0 37.0 37.0 30-34 36.0658 37.0 37.0 37.0 37.0 37.0 35-39 36.0838 37.0 37.0 37.0 37.0 37.0 40-44 36.0493 37.0 37.0 37.0 37.0 37.0 45-49 36.067099999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.0116 37.0 37.0 37.0 37.0 37.0 55-59 35.9966 37.0 37.0 37.0 37.0 37.0 60-64 35.9255 37.0 37.0 37.0 37.0 37.0 65-69 35.927499999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.8261 37.0 37.0 37.0 37.0 37.0 75-79 35.8283 37.0 37.0 37.0 37.0 37.0 80-84 35.7985 37.0 37.0 37.0 37.0 37.0 85-89 35.8702 37.0 37.0 37.0 37.0 37.0 90-94 35.823899999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.800399999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.790499999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.718599999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.6294 37.0 37.0 37.0 37.0 37.0 115-119 35.6893 37.0 37.0 37.0 37.0 37.0 120-124 35.727500000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.6604 37.0 37.0 37.0 37.0 37.0 130-134 35.6007 37.0 37.0 37.0 37.0 37.0 135-139 35.4728 37.0 37.0 37.0 37.0 37.0 140-144 35.598200000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.473 37.0 37.0 37.0 37.0 37.0 150-151 35.189750000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 2.0 16 0.0 17 1.0 18 2.0 19 4.0 20 3.0 21 1.0 22 3.0 23 6.0 24 8.0 25 14.0 26 8.0 27 8.0 28 15.0 29 20.0 30 28.0 31 37.0 32 54.0 33 88.0 34 202.0 35 585.0 36 2652.0 37 256.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.05 22.225 8.55 25.174999999999997 2 24.425 25.275 34.599999999999994 15.7 3 20.575 28.299999999999997 32.9 18.224999999999998 4 23.9 34.050000000000004 22.95 19.1 5 25.1 37.275000000000006 21.75 15.875 6 19.225 40.6 21.925 18.25 7 19.5 22.35 38.875 19.275000000000002 8 18.65 24.3 31.825 25.224999999999998 9 23.0 24.675 29.675 22.650000000000002 10-14 23.04 28.865000000000002 26.674999999999997 21.42 15-19 23.189999999999998 27.55 27.765 21.495 20-24 22.695 28.544999999999998 27.76 21.0 25-29 22.515 28.53 27.93 21.025 30-34 22.31 28.18 28.585 20.925 35-39 22.57 28.365000000000002 27.85 21.215 40-44 21.805 28.16 28.439999999999998 21.595 45-49 22.84 28.249999999999996 28.265 20.645 50-54 22.475 27.985 27.985 21.555 55-59 23.535 28.025 27.715 20.724999999999998 60-64 23.255 28.435 27.41 20.9 65-69 23.165 28.095 27.725 21.015 70-74 23.5 27.925 27.83 20.745 75-79 23.200000000000003 28.4 27.685 20.715 80-84 23.1 28.01 27.325 21.565 85-89 23.14 27.93 27.284999999999997 21.645 90-94 23.53 28.435 27.435 20.599999999999998 95-99 22.725 28.12 28.015 21.14 100-104 23.785 28.125 27.505000000000003 20.585 105-109 24.085 28.804999999999996 27.029999999999998 20.080000000000002 110-114 22.99 28.77 27.450000000000003 20.79 115-119 24.455 27.685 27.22 20.64 120-124 23.995 28.144999999999996 28.050000000000004 19.81 125-129 24.01 28.185 27.250000000000004 20.555 130-134 24.245 28.189999999999998 27.395000000000003 20.169999999999998 135-139 24.19 27.66 27.38 20.77 140-144 23.94 27.575 27.900000000000002 20.585 145-149 24.42988597719544 27.860572114422883 27.365473094618924 20.344068813762753 150-151 25.7625 27.950000000000003 27.425 18.862499999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 2.0 21 2.5 22 1.5 23 4.5 24 6.0 25 7.5 26 8.0 27 5.0 28 6.5 29 9.0 30 15.0 31 20.5 32 28.0 33 42.5 34 56.0 35 69.5 36 89.5 37 120.5 38 133.5 39 151.5 40 185.5 41 212.0 42 233.0 43 261.5 44 306.5 45 298.0 46 255.5 47 243.0 48 228.5 49 199.5 50 167.5 51 135.0 52 103.0 53 74.0 54 70.0 55 61.5 56 41.5 57 39.5 58 31.5 59 20.5 60 15.0 61 10.5 62 6.5 63 2.0 64 2.0 65 2.0 66 1.0 67 1.5 68 0.5 69 0.0 70 0.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 1.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.475 #Duplication Level Percentage of deduplicated Percentage of total 1 86.57502193623866 74.0 2 10.704884469143023 18.3 3 2.07663059374086 5.325 4 0.49722140976893825 1.7000000000000002 5 0.11699327288680901 0.5 6 0.0 0.0 7 0.029248318221702253 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTAGATTGATAACTCGATCAACTCAACTCAGTTCCTCCCAACCTCAACT 7 0.17500000000000002 No Hit GGAAGGAAGGCTCTGCTCACACTTCCTATGACTCTCTCCATTATTCCTTT 5 0.125 No Hit ATGACGAGTACCAACCAGTGGTGGCCCCTACACAATAGAGATATTAAAAG 5 0.125 No Hit GTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATAT 5 0.125 No Hit ATTGCATCCGGCCTCCATTGGTATTTAAAGTACTGGTGTGGGGCTCATGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.45 0.0 0.0 0.0 0.0 106-107 0.5249999999999999 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.7625 0.0 0.0 0.0 0.0 112-113 0.9125000000000001 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.0125 0.0 0.0 0.0 0.0 118-119 1.1875 0.0 0.0 0.0 0.0 120-121 1.275 0.0 0.0 0.0 0.0 122-123 1.425 0.0 0.0 0.0 0.0 124-125 1.6 0.0 0.0 0.0 0.0 126-127 1.7125 0.0 0.0 0.0 0.0 128-129 1.9375 0.0 0.0 0.0 0.0 130-131 2.2249999999999996 0.0 0.0 0.0 0.0 132-133 2.4625 0.0 0.0 0.0 0.0 134-135 2.7125 0.0 0.0 0.0 0.0 136-137 2.8375 0.0 0.0 0.0 0.0 138-139 3.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAACGA 10 0.006830828 145.0 7 GCTCCAC 10 0.006830828 145.0 145 >>END_MODULE Read 844751 spots for SRR12671381.sra Written 844751 spots for SRR12671381.sra Read 844751 spots for SRR12671381.sra Written 844751 spots for SRR12671381.sra Read 844751 spots for SRR12671381.sra Written 844751 spots for SRR12671381.sra Read 844751 spots for SRR12671381.sra Written 844751 spots for SRR12671381.sra Read 844751 spots for SRR12671381.sra Written 844751 spots for SRR12671381.sra Read 844751 spots for SRR12671381.sra Written 844751 spots for SRR12671381.sra Read 844751 spots for SRR12671381.sra Written 844751 spots for SRR12671381.sra Read 844751 spots for SRR12671381.sra Written 844751 spots for SRR12671381.sra Read 844751 spots for SRR12671381.sra Written 844751 spots for SRR12671381.sra Read 844751 spots for SRR12671381.sra Written 844751 spots for SRR12671381.sra Read 844751 spots for SRR12671381.sra Written 844751 spots for SRR12671381.sra Read 844751 spots for SRR12671381.sra Written 844751 spots for SRR12671381.sra Read 844751 spots for SRR12671381.sra Written 844751 spots for SRR12671381.sra Read 844751 spots for SRR12671381.sra Written 844751 spots for SRR12671381.sra Read 844751 spots for SRR12671381.sra Written 844751 spots for SRR12671381.sra Read 844751 spots for SRR12671381.sra Written 844751 spots for SRR12671381.sra Read 844751 spots for SRR12671381.sra Written 844751 spots for SRR12671381.sra Read 844751 spots for SRR12671381.sra Written 844751 spots for SRR12671381.sra Read 844751 spots for SRR12671381.sra Written 844751 spots for SRR12671381.sra Read 844757 spots for SRR12671381.sra Written 844757 spots for SRR12671381.sra SRR ids: ['SRR12671381.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9z7l2cyo SRR12671381.sra spots: 16895026 blocks: [[1, 844751], [844752, 1689502], [1689503, 2534253], [2534254, 3379004], [3379005, 4223755], [4223756, 5068506], [5068507, 5913257], [5913258, 6758008], [6758009, 7602759], [7602760, 8447510], [8447511, 9292261], [9292262, 10137012], [10137013, 10981763], [10981764, 11826514], [11826515, 12671265], [12671266, 13516016], [13516017, 14360767], [14360768, 15205518], [15205519, 16050269], [16050270, 16895026]] SRR12671381 file size 5719968 SRR12671381 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671381 SRR12671381_1.fastq SRR12671381_2.fastq Input file: SRR12671381_1.fastq Paired file: SRR12671381_2.fastq trimmed: SRR12671381-trimmed-pair1.fastq, SRR12671381-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:02:33 2025 >> started Tue Feb 11 21:03:03 2025 >> done (29.944s) 16895026 read pairs processed; of these: 108 ( 0.00%) short read pairs filtered out after trimming by size control 1382 ( 0.01%) empty read pairs filtered out after trimming by size control 16893536 (99.99%) read pairs available; of these: 760431 ( 4.50%) trimmed read pairs available after processing 16133105 (95.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 10 0.00% 20 7 0.00% 21 12 0.00% 22 12 0.00% 23 16 0.00% 24 10 0.00% 25 8 0.00% 26 14 0.00% 27 16 0.00% 28 13 0.00% 29 10 0.00% 30 24 0.00% 31 16 0.00% 32 25 0.00% 33 21 0.00% 34 14 0.00% 35 17 0.00% 36 24 0.00% 37 18 0.00% 38 11 0.00% 39 15 0.00% 40 24 0.00% 41 16 0.00% 42 26 0.00% 43 28 0.00% 44 29 0.00% 45 27 0.00% 46 21 0.00% 47 29 0.00% 48 35 0.00% 49 41 0.00% 50 34 0.00% 51 59 0.00% 52 49 0.00% 53 52 0.00% 54 43 0.00% 55 48 0.00% 56 78 0.00% 57 79 0.00% 58 90 0.00% 59 92 0.00% 60 128 0.00% 61 153 0.00% 62 152 0.00% 63 155 0.00% 64 206 0.00% 65 225 0.00% 66 231 0.00% 67 263 0.00% 68 303 0.00% 69 341 0.00% 70 379 0.00% 71 442 0.00% 72 512 0.00% 73 542 0.00% 74 632 0.00% 75 709 0.00% 76 810 0.00% 77 837 0.00% 78 990 0.01% 79 1056 0.01% 80 1102 0.01% 81 1245 0.01% 82 1341 0.01% 83 1516 0.01% 84 1629 0.01% 85 1850 0.01% 86 2059 0.01% 87 2245 0.01% 88 2423 0.01% 89 2480 0.01% 90 2677 0.02% 91 2804 0.02% 92 3166 0.02% 93 3418 0.02% 94 3670 0.02% 95 3940 0.02% 96 4088 0.02% 97 4325 0.03% 98 4606 0.03% 99 4669 0.03% 100 5100 0.03% 101 5173 0.03% 102 5638 0.03% 103 5911 0.03% 104 5953 0.04% 105 6348 0.04% 106 6723 0.04% 107 7147 0.04% 108 7160 0.04% 109 7517 0.04% 110 7607 0.05% 111 8167 0.05% 112 8508 0.05% 113 8544 0.05% 114 8810 0.05% 115 9547 0.06% 116 9904 0.06% 117 10212 0.06% 118 10113 0.06% 119 10785 0.06% 120 10933 0.06% 121 11437 0.07% 122 11767 0.07% 123 12018 0.07% 124 12566 0.07% 125 12914 0.08% 126 13511 0.08% 127 13956 0.08% 128 14050 0.08% 129 14406 0.09% 130 15256 0.09% 131 15505 0.09% 132 15832 0.09% 133 16161 0.10% 134 16416 0.10% 135 17406 0.10% 136 17613 0.10% 137 18093 0.11% 138 18469 0.11% 139 19227 0.11% 140 19655 0.12% 141 19800 0.12% 142 20345 0.12% 143 20865 0.12% 144 21274 0.13% 145 22106 0.13% 146 22614 0.13% 147 23141 0.14% 148 23898 0.14% 149 24074 0.14% 150 24720 0.15% 151 16133105 95.50% 16893536 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=35 prefix-density=0.57 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCATGTTGGCTTGTGCCGGGGTGCGGTTGACGGTGGCAACGGCTGCCGATGAGATCATAGAGGAGGAAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=88.89 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=3.6 sequence=ATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=33 prefix-density=0.70 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTT criterion=fanout-score sequence-density=0.14 sequence-density-rank=25 fanout-score=36.91 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=12.6 sequence=AAAGAAAAGAAAA SRR12671381 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:03:53 Started mapping on | Feb 11 21:03:53 Finished on | Feb 11 21:08:18 Mapping speed, Million of reads per hour | 229.50 Number of input reads | 16893536 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 15670610 Uniquely mapped reads % | 92.76% Average mapped length | 298.28 Number of splices: Total | 15884493 Number of splices: Annotated (sjdb) | 15565178 Number of splices: GT/AG | 15566802 Number of splices: GC/AG | 265968 Number of splices: AT/AC | 8774 Number of splices: Non-canonical | 42949 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 397132 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 56693 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.43% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 825794 825794 825794 N_multimapping 397132 397132 397132 N_noFeature 579305 15454276 652477 N_ambiguous 241917 875 98373 UnstrandedReadsAssigned:14849388 PositiveStrandReadsAssigned:215459 NegativeStrandReadsAssigned:14919760 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671381 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671381-trimmed-pair1.fastq SRR12671381-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,893,536 reads, 14,943,047 reads pseudoaligned [quant] estimated average fragment length: 300.925 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,052 rounds 52401 SRR12671381.ke.tsv 34699 SRR12671381.se.tsv 87100 total ==> SRR12671381.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1718.07 585 21.4187 Potri.005G024800.1.v4.1 1035 735.075 173 14.8045 Potri.004G059700.1.v4.1 961 661.313 27 2.56824 Potri.007G009000.2.v4.1 1416 1116.07 0 0 Potri.003G141000.2.v4.1 2943 2643.07 774.447 18.4315 Potri.016G087400.1.v4.1 270 70.6223 645 574.509 Potri.015G069301.1.v4.1 564 285.252 0 0 Potri.010G195200.1.v4.1 1773 1473.07 21 0.896754 Potri.012G127500.1.v4.1 977 677.192 89 8.26717 ==> SRR12671381.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 485 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 169 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 6 SRR12671381 completed mapping pipeline successfully