Starting /dee2/code/volunteer_pipeline.sh SRR12671382 current disk space = 3052977221632 free memory = 1477922572 SRR12671382 SRAfilesize 3c974b2ea7e42e165c8f19fec6971207 SRR12671382.sra SRR12671382.sra file validated SRR12671382 is paired end SRR12671382 is conventional basespace SRR12671382 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671382_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.603 37.0 37.0 37.0 37.0 37.0 2 36.4125 37.0 37.0 37.0 37.0 37.0 3 36.6235 37.0 37.0 37.0 37.0 37.0 4 36.6615 37.0 37.0 37.0 37.0 37.0 5 36.6325 37.0 37.0 37.0 37.0 37.0 6 36.593 37.0 37.0 37.0 37.0 37.0 7 36.5245 37.0 37.0 37.0 37.0 37.0 8 36.536 37.0 37.0 37.0 37.0 37.0 9 36.649 37.0 37.0 37.0 37.0 37.0 10-14 36.6432 37.0 37.0 37.0 37.0 37.0 15-19 36.6046 37.0 37.0 37.0 37.0 37.0 20-24 36.6235 37.0 37.0 37.0 37.0 37.0 25-29 36.5643 37.0 37.0 37.0 37.0 37.0 30-34 36.573100000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.5395 37.0 37.0 37.0 37.0 37.0 40-44 36.5125 37.0 37.0 37.0 37.0 37.0 45-49 36.4464 37.0 37.0 37.0 37.0 37.0 50-54 36.4518 37.0 37.0 37.0 37.0 37.0 55-59 36.3921 37.0 37.0 37.0 37.0 37.0 60-64 36.3994 37.0 37.0 37.0 37.0 37.0 65-69 36.365300000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.3678 37.0 37.0 37.0 37.0 37.0 75-79 36.3681 37.0 37.0 37.0 37.0 37.0 80-84 36.3778 37.0 37.0 37.0 37.0 37.0 85-89 36.285399999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.3447 37.0 37.0 37.0 37.0 37.0 95-99 36.26 37.0 37.0 37.0 37.0 37.0 100-104 36.295 37.0 37.0 37.0 37.0 37.0 105-109 36.2787 37.0 37.0 37.0 37.0 37.0 110-114 36.1597 37.0 37.0 37.0 37.0 37.0 115-119 36.20100000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.225300000000004 37.0 37.0 37.0 37.0 37.0 125-129 36.1596 37.0 37.0 37.0 37.0 37.0 130-134 36.1379 37.0 37.0 37.0 37.0 37.0 135-139 36.1352 37.0 37.0 37.0 37.0 37.0 140-144 36.0407 37.0 37.0 37.0 37.0 37.0 145-149 35.9677 37.0 37.0 37.0 37.0 37.0 150-151 35.930499999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 1.0 24 1.0 25 1.0 26 6.0 27 4.0 28 6.0 29 14.0 30 20.0 31 28.0 32 41.0 33 59.0 34 103.0 35 270.0 36 3001.0 37 442.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.375 10.35 5.3 34.975 2 20.165330661322646 12.5 37.17434869739479 30.160320641282567 3 19.3 17.775 26.674999999999997 36.25 4 24.275 25.174999999999997 22.15 28.4 5 22.400000000000002 32.4 24.05 21.15 6 19.0 33.6 25.35 22.05 7 14.000000000000002 25.650000000000002 44.025 16.325 8 17.525 26.025 32.725 23.724999999999998 9 16.375 24.075 35.725 23.825 10-14 19.93 30.84 27.034999999999997 22.195 15-19 19.685 28.27 28.005000000000003 24.04 20-24 19.63 28.715000000000003 27.73 23.925 25-29 19.615 28.65 28.494999999999997 23.24 30-34 20.05 28.42 28.249999999999996 23.28 35-39 19.855 28.375 27.900000000000002 23.87 40-44 20.27 28.935 27.305 23.49 45-49 20.23 28.549999999999997 27.500000000000004 23.72 50-54 19.905 28.71 27.650000000000002 23.735 55-59 20.119999999999997 28.725 27.82 23.335 60-64 20.365 28.435 28.065 23.135 65-69 20.14 28.384999999999998 27.315 24.16 70-74 21.154999999999998 27.889999999999997 27.794999999999998 23.16 75-79 20.485 28.705000000000002 27.71 23.1 80-84 20.61 28.199999999999996 27.715 23.474999999999998 85-89 20.919999999999998 28.375 27.505000000000003 23.200000000000003 90-94 21.18 28.275 27.435 23.11 95-99 21.029999999999998 28.24 27.605 23.125 100-104 20.815 28.444999999999997 26.87 23.87 105-109 20.655 28.044999999999998 27.35 23.95 110-114 20.315 28.16 27.805000000000003 23.72 115-119 20.560000000000002 27.68 27.725 24.035 120-124 21.029999999999998 27.555000000000003 27.67 23.745 125-129 20.880000000000003 27.88 26.855 24.385 130-134 21.175 27.72 27.725 23.380000000000003 135-139 21.38 28.1 27.200000000000003 23.32 140-144 21.43 27.93 26.955000000000002 23.685000000000002 145-149 20.915 28.15 26.840000000000003 24.095 150-151 20.0375 28.299999999999997 28.000000000000004 23.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.5 23 4.0 24 5.0 25 5.0 26 5.0 27 7.5 28 10.5 29 19.5 30 24.0 31 20.0 32 27.0 33 36.5 34 48.0 35 73.0 36 95.0 37 106.0 38 122.0 39 155.5 40 199.5 41 225.5 42 245.5 43 243.0 44 250.0 45 262.0 46 246.0 47 244.0 48 240.5 49 214.5 50 178.0 51 147.5 52 123.0 53 100.0 54 71.5 55 58.5 56 47.5 57 38.5 58 26.0 59 15.0 60 16.5 61 10.5 62 6.0 63 4.0 64 1.5 65 3.0 66 5.5 67 2.5 68 0.5 69 1.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.775 #Duplication Level Percentage of deduplicated Percentage of total 1 84.51208594449419 70.8 2 12.533572068039392 21.0 3 2.118770516263802 5.325 4 0.8057296329453895 2.7 5 0.0 0.0 6 0.0 0.0 7 0.029841838257236648 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGCCACGTTGCTAACACATATGATCTAAATCAAATCACAACTGAAATTTC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.5 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 1.9625000000000001 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.3375 0.0 0.0 0.0 0.0 126-127 2.5625 0.0 0.0 0.0 0.0 128-129 2.6875 0.0 0.0 0.0 0.0 130-131 2.925 0.0 0.0 0.0 0.0 132-133 3.1500000000000004 0.0 0.0 0.0 0.0 134-135 3.35 0.0 0.0 0.0 0.0 136-137 3.55 0.0 0.0 0.0 0.0 138-139 3.9749999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGCTG 10 0.006830828 145.0 3 AATACTG 10 0.006830828 145.0 5 CAGCTGC 10 0.006830828 145.0 4 >>END_MODULE SRR12671382 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671382_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.293 37.0 37.0 37.0 37.0 37.0 2 36.042 37.0 37.0 37.0 37.0 37.0 3 36.1455 37.0 37.0 37.0 37.0 37.0 4 36.3025 37.0 37.0 37.0 37.0 37.0 5 36.302 37.0 37.0 37.0 37.0 37.0 6 36.1945 37.0 37.0 37.0 37.0 37.0 7 36.214 37.0 37.0 37.0 37.0 37.0 8 36.254 37.0 37.0 37.0 37.0 37.0 9 36.3075 37.0 37.0 37.0 37.0 37.0 10-14 36.204699999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.2275 37.0 37.0 37.0 37.0 37.0 20-24 36.1534 37.0 37.0 37.0 37.0 37.0 25-29 36.0619 37.0 37.0 37.0 37.0 37.0 30-34 36.0476 37.0 37.0 37.0 37.0 37.0 35-39 36.042500000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.041700000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.0488 37.0 37.0 37.0 37.0 37.0 50-54 36.0036 37.0 37.0 37.0 37.0 37.0 55-59 35.9399 37.0 37.0 37.0 37.0 37.0 60-64 35.9573 37.0 37.0 37.0 37.0 37.0 65-69 35.935900000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.9036 37.0 37.0 37.0 37.0 37.0 75-79 35.782000000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.77290000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.8584 37.0 37.0 37.0 37.0 37.0 90-94 35.842999999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.785700000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.8229 37.0 37.0 37.0 37.0 37.0 105-109 35.682100000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.6509 37.0 37.0 37.0 37.0 37.0 115-119 35.7096 37.0 37.0 37.0 37.0 37.0 120-124 35.6475 37.0 37.0 37.0 37.0 37.0 125-129 35.63420000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.579 37.0 37.0 37.0 37.0 37.0 135-139 35.4425 37.0 37.0 37.0 37.0 37.0 140-144 35.490300000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.4589 37.0 37.0 37.0 37.0 37.0 150-151 35.1825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 9.0 15 0.0 16 2.0 17 3.0 18 0.0 19 1.0 20 0.0 21 4.0 22 5.0 23 7.0 24 6.0 25 11.0 26 9.0 27 16.0 28 11.0 29 17.0 30 22.0 31 34.0 32 61.0 33 85.0 34 192.0 35 534.0 36 2704.0 37 263.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.975 22.45 8.35 24.224999999999998 2 26.650000000000002 28.000000000000004 28.349999999999998 17.0 3 21.5 27.125 33.0 18.375 4 24.525 34.375 22.15 18.95 5 26.05 37.85 20.525 15.575 6 20.75 39.025 22.2 18.025 7 19.225 22.55 37.55 20.674999999999997 8 18.6 26.25 29.975 25.174999999999997 9 22.425 24.025 29.2 24.349999999999998 10-14 23.505000000000003 29.439999999999998 25.645 21.41 15-19 23.16 27.74 27.72 21.38 20-24 23.0 28.555000000000003 27.560000000000002 20.885 25-29 23.615 27.900000000000002 27.725 20.76 30-34 22.725 27.950000000000003 27.655 21.67 35-39 23.23 27.73 28.000000000000004 21.04 40-44 23.04 28.585 27.224999999999998 21.15 45-49 22.89 28.000000000000004 27.51 21.6 50-54 23.32 28.365000000000002 27.474999999999998 20.84 55-59 22.78 28.555000000000003 27.215 21.45 60-64 23.205000000000002 28.194999999999997 27.33 21.27 65-69 23.005 27.994999999999997 27.83 21.17 70-74 22.85 28.349999999999998 27.0 21.8 75-79 22.495 28.665000000000003 27.04 21.8 80-84 23.585 28.645 26.634999999999998 21.135 85-89 23.669999999999998 28.24 27.250000000000004 20.84 90-94 23.189999999999998 28.095 27.339999999999996 21.375 95-99 23.175 27.62 28.17 21.035 100-104 23.215 27.855 27.339999999999996 21.59 105-109 23.645 27.655 27.994999999999997 20.705000000000002 110-114 23.205000000000002 28.99 26.790000000000003 21.015 115-119 23.86 28.345 27.22 20.575 120-124 24.565 27.68 27.13 20.625 125-129 23.605 28.34 27.43 20.625 130-134 23.835 27.395000000000003 27.68 21.09 135-139 24.05 27.315 27.805000000000003 20.830000000000002 140-144 24.925 27.76 27.18 20.135 145-149 24.474999999999998 27.685 27.915 19.925 150-151 24.575 28.5625 26.6125 20.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 1.5 11 1.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.5 20 2.0 21 2.0 22 2.0 23 2.5 24 2.0 25 1.0 26 3.0 27 13.0 28 17.0 29 13.5 30 17.5 31 22.0 32 27.0 33 34.0 34 40.5 35 61.5 36 73.0 37 98.0 38 134.0 39 154.0 40 170.5 41 202.5 42 253.5 43 282.0 44 266.5 45 255.0 46 283.5 47 273.0 48 226.5 49 189.0 50 165.0 51 148.0 52 126.0 53 97.5 54 74.0 55 59.0 56 42.0 57 37.0 58 31.5 59 18.0 60 13.5 61 12.5 62 8.5 63 8.0 64 6.5 65 2.5 66 1.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 1.0 96 1.5 97 1.0 98 0.5 99 1.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.025 #Duplication Level Percentage of deduplicated Percentage of total 1 85.00446295745314 71.42500000000001 2 11.99047902409997 20.150000000000002 3 2.231478726569473 5.625 4 0.6248140434394526 2.1 5 0.08925914906277893 0.375 6 0.02975304968759298 0.15 7 0.02975304968759298 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCTGCCTTCTGGTCCGCGTGAGATCTTAAAGATTTGGAGCTGAAAAGC 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit CTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATCA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit GGAAGTGCGAGAAGGAAGAGAAATCGGAGAAATTGAAAGTGAAGAAGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.05 0.0 0.0 0.0 0.0 108-109 1.1375 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.3624999999999998 0.0 0.0 0.0 0.0 114-115 1.525 0.0 0.0 0.0 0.0 116-117 1.6124999999999998 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 1.9625000000000001 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.3375 0.0 0.0 0.0 0.0 126-127 2.5625 0.0 0.0 0.0 0.0 128-129 2.7249999999999996 0.0 0.0 0.0 0.0 130-131 3.0 0.0 0.0 0.0 0.0 132-133 3.25 0.0 0.0 0.0 0.0 134-135 3.45 0.0 0.0 0.0 0.0 136-137 3.65 0.0 0.0 0.0 0.0 138-139 4.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAACTG 10 0.006830828 145.0 3 >>END_MODULE Read 824008 spots for SRR12671382.sra Written 824008 spots for SRR12671382.sra Read 824008 spots for SRR12671382.sra Written 824008 spots for SRR12671382.sra Read 824008 spots for SRR12671382.sra Written 824008 spots for SRR12671382.sra Read 824008 spots for SRR12671382.sra Written 824008 spots for SRR12671382.sra Read 824008 spots for SRR12671382.sra Written 824008 spots for SRR12671382.sra Read 824008 spots for SRR12671382.sra Written 824008 spots for SRR12671382.sra Read 824008 spots for SRR12671382.sra Written 824008 spots for SRR12671382.sra Read 824008 spots for SRR12671382.sra Written 824008 spots for SRR12671382.sra Read 824008 spots for SRR12671382.sra Written 824008 spots for SRR12671382.sra Read 824008 spots for SRR12671382.sra Written 824008 spots for SRR12671382.sra Read 824008 spots for SRR12671382.sra Written 824008 spots for SRR12671382.sra Read 824008 spots for SRR12671382.sra Written 824008 spots for SRR12671382.sra Read 824008 spots for SRR12671382.sra Written 824008 spots for SRR12671382.sra Read 824008 spots for SRR12671382.sra Written 824008 spots for SRR12671382.sra Read 824008 spots for SRR12671382.sra Written 824008 spots for SRR12671382.sra Read 824008 spots for SRR12671382.sra Written 824008 spots for SRR12671382.sra Read 824008 spots for SRR12671382.sra Written 824008 spots for SRR12671382.sra Read 824008 spots for SRR12671382.sra Written 824008 spots for SRR12671382.sra Read 824011 spots for SRR12671382.sra Written 824011 spots for SRR12671382.sra Read 824008 spots for SRR12671382.sra Written 824008 spots for SRR12671382.sra SRR ids: ['SRR12671382.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6_6ajlb8 SRR12671382.sra spots: 16480163 blocks: [[1, 824008], [824009, 1648016], [1648017, 2472024], [2472025, 3296032], [3296033, 4120040], [4120041, 4944048], [4944049, 5768056], [5768057, 6592064], [6592065, 7416072], [7416073, 8240080], [8240081, 9064088], [9064089, 9888096], [9888097, 10712104], [10712105, 11536112], [11536113, 12360120], [12360121, 13184128], [13184129, 14008136], [14008137, 14832144], [14832145, 15656152], [15656153, 16480163]] SRR12671382 file size 5578980 SRR12671382 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671382 SRR12671382_1.fastq SRR12671382_2.fastq Input file: SRR12671382_1.fastq Paired file: SRR12671382_2.fastq trimmed: SRR12671382-trimmed-pair1.fastq, SRR12671382-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:01:11 2025 >> started Tue Feb 11 21:01:29 2025 >> done (18.312s) 16480163 read pairs processed; of these: 77 ( 0.00%) short read pairs filtered out after trimming by size control 4496 ( 0.03%) empty read pairs filtered out after trimming by size control 16475590 (99.97%) read pairs available; of these: 908100 ( 5.51%) trimmed read pairs available after processing 15567490 (94.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 8 0.00% 20 11 0.00% 21 7 0.00% 22 8 0.00% 23 15 0.00% 24 15 0.00% 25 15 0.00% 26 23 0.00% 27 17 0.00% 28 31 0.00% 29 11 0.00% 30 14 0.00% 31 12 0.00% 32 21 0.00% 33 23 0.00% 34 12 0.00% 35 17 0.00% 36 19 0.00% 37 25 0.00% 38 18 0.00% 39 26 0.00% 40 17 0.00% 41 30 0.00% 42 46 0.00% 43 39 0.00% 44 46 0.00% 45 32 0.00% 46 44 0.00% 47 45 0.00% 48 52 0.00% 49 57 0.00% 50 71 0.00% 51 83 0.00% 52 97 0.00% 53 71 0.00% 54 91 0.00% 55 117 0.00% 56 107 0.00% 57 140 0.00% 58 144 0.00% 59 189 0.00% 60 195 0.00% 61 258 0.00% 62 287 0.00% 63 295 0.00% 64 306 0.00% 65 352 0.00% 66 390 0.00% 67 459 0.00% 68 513 0.00% 69 553 0.00% 70 617 0.00% 71 713 0.00% 72 882 0.01% 73 965 0.01% 74 1045 0.01% 75 1200 0.01% 76 1285 0.01% 77 1419 0.01% 78 1495 0.01% 79 1726 0.01% 80 1825 0.01% 81 2002 0.01% 82 2287 0.01% 83 2454 0.01% 84 2711 0.02% 85 3009 0.02% 86 3216 0.02% 87 3380 0.02% 88 3622 0.02% 89 3809 0.02% 90 4155 0.03% 91 4375 0.03% 92 4527 0.03% 93 4935 0.03% 94 5498 0.03% 95 5677 0.03% 96 6022 0.04% 97 6386 0.04% 98 6357 0.04% 99 6791 0.04% 100 7196 0.04% 101 7144 0.04% 102 7794 0.05% 103 8098 0.05% 104 7972 0.05% 105 8432 0.05% 106 9124 0.06% 107 9368 0.06% 108 9807 0.06% 109 9916 0.06% 110 10133 0.06% 111 10503 0.06% 112 10910 0.07% 113 10959 0.07% 114 11677 0.07% 115 11622 0.07% 116 12013 0.07% 117 12544 0.08% 118 12988 0.08% 119 13322 0.08% 120 13594 0.08% 121 13900 0.08% 122 14279 0.09% 123 14504 0.09% 124 15163 0.09% 125 15408 0.09% 126 15852 0.10% 127 16631 0.10% 128 16706 0.10% 129 17071 0.10% 130 17600 0.11% 131 17610 0.11% 132 17887 0.11% 133 18326 0.11% 134 18421 0.11% 135 19448 0.12% 136 19429 0.12% 137 20006 0.12% 138 20411 0.12% 139 21394 0.13% 140 21693 0.13% 141 22081 0.13% 142 22676 0.14% 143 22640 0.14% 144 23239 0.14% 145 24017 0.15% 146 24114 0.15% 147 24713 0.15% 148 25563 0.16% 149 25497 0.15% 150 26836 0.16% 151 15567490 94.49% 16475590 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=17 prefix-density=0.60 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.19 sequence-density-rank=18 fanout-score=6.74 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=3.7 sequence=TTGCAGCCATTCTC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=20 prefix-density=0.67 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=28 fanout-score=12.06 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=3.5 sequence=AACAGAAAAAAGAAAGATGGCCTCGGCATCATTTCTCAAGTCATCACCAGTTCTAGACAAGTCTGAGTTTGTTAAGGGTCAGACCCTCCGCTTGCCTTCTGCCTCCATTGTCCGGTGCCGCTCCACCGCCCCTTCTGCTCTTACCGTTCGTGCTGGTTCCTATGCTGAGGAGCTTGTCAAAACCGCGAAAACAATTGCATCTCCTGGCCGAGGTATTTTGGCCATGGATGAGTCTAACGCTACCTGTGGAAAACGTCTCGC SRR12671382 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:02:14 Started mapping on | Feb 11 21:02:15 Finished on | Feb 11 21:04:16 Mapping speed, Million of reads per hour | 490.18 Number of input reads | 16475590 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 15152949 Uniquely mapped reads % | 91.97% Average mapped length | 297.53 Number of splices: Total | 15433730 Number of splices: Annotated (sjdb) | 15126758 Number of splices: GT/AG | 15121009 Number of splices: GC/AG | 256541 Number of splices: AT/AC | 9116 Number of splices: Non-canonical | 47064 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 363835 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 33591 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.50% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 958806 958806 958806 N_multimapping 363835 363835 363835 N_noFeature 520256 14905489 590788 N_ambiguous 281557 993 104137 UnstrandedReadsAssigned:14351136 PositiveStrandReadsAssigned:246467 NegativeStrandReadsAssigned:14458024 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671382 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671382-trimmed-pair1.fastq SRR12671382-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,475,590 reads, 14,429,917 reads pseudoaligned [quant] estimated average fragment length: 293.359 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,075 rounds 52401 SRR12671382.ke.tsv 34699 SRR12671382.se.tsv 87100 total ==> SRR12671382.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1725.64 903 31.632 Potri.005G024800.1.v4.1 1035 742.641 311 25.3146 Potri.004G059700.1.v4.1 961 668.883 0 0 Potri.007G009000.2.v4.1 1416 1123.64 0 0 Potri.003G141000.2.v4.1 2943 2650.64 942 21.4827 Potri.016G087400.1.v4.1 270 73.6904 717 588.163 Potri.015G069301.1.v4.1 564 290.195 0 0 Potri.010G195200.1.v4.1 1773 1480.64 135 5.51155 Potri.012G127500.1.v4.1 977 684.766 160 14.1243 ==> SRR12671382.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 112 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 224 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671382 completed mapping pipeline successfully