Starting /dee2/code/volunteer_pipeline.sh SRR12671383 current disk space = 3052920295424 free memory = 1452304548 SRR12671383 SRAfilesize e5cad1be8952e351d4e66870c5baba6a SRR12671383.sra SRR12671383.sra file validated SRR12671383 is paired end SRR12671383 is conventional basespace SRR12671383 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671383_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.653 37.0 37.0 37.0 37.0 37.0 2 36.33225 37.0 37.0 37.0 37.0 37.0 3 36.5885 37.0 37.0 37.0 37.0 37.0 4 36.6845 37.0 37.0 37.0 37.0 37.0 5 36.6195 37.0 37.0 37.0 37.0 37.0 6 36.663 37.0 37.0 37.0 37.0 37.0 7 36.558 37.0 37.0 37.0 37.0 37.0 8 36.5965 37.0 37.0 37.0 37.0 37.0 9 36.66 37.0 37.0 37.0 37.0 37.0 10-14 36.669500000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.626 37.0 37.0 37.0 37.0 37.0 20-24 36.5989 37.0 37.0 37.0 37.0 37.0 25-29 36.540000000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.5393 37.0 37.0 37.0 37.0 37.0 35-39 36.5171 37.0 37.0 37.0 37.0 37.0 40-44 36.5103 37.0 37.0 37.0 37.0 37.0 45-49 36.44789999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.4893 37.0 37.0 37.0 37.0 37.0 55-59 36.4086 37.0 37.0 37.0 37.0 37.0 60-64 36.388099999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.3385 37.0 37.0 37.0 37.0 37.0 70-74 36.3489 37.0 37.0 37.0 37.0 37.0 75-79 36.2881 37.0 37.0 37.0 37.0 37.0 80-84 36.25169999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.2045 37.0 37.0 37.0 37.0 37.0 90-94 36.2044 37.0 37.0 37.0 37.0 37.0 95-99 36.176500000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.1662 37.0 37.0 37.0 37.0 37.0 105-109 36.1802 37.0 37.0 37.0 37.0 37.0 110-114 36.119099999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.095099999999995 37.0 37.0 37.0 37.0 37.0 120-124 36.0405 37.0 37.0 37.0 37.0 37.0 125-129 36.05409999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.9903 37.0 37.0 37.0 37.0 37.0 135-139 35.984500000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.871 37.0 37.0 37.0 37.0 37.0 145-149 35.856399999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.83775 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 2.0 23 3.0 24 4.0 25 1.0 26 1.0 27 8.0 28 7.0 29 13.0 30 22.0 31 46.0 32 38.0 33 72.0 34 107.0 35 277.0 36 2963.0 37 434.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.225 10.05 5.475 37.25 2 18.094998743402865 12.942950490072883 39.28122643880372 29.680824327720533 3 17.224999999999998 18.125 28.325 36.325 4 22.625 26.575 25.0 25.8 5 24.55 32.65 23.3 19.5 6 18.85 34.699999999999996 23.825 22.625 7 14.774999999999999 25.650000000000002 44.775 14.799999999999999 8 15.875 24.6 34.975 24.55 9 16.325 21.725 37.9 24.05 10-14 19.425 29.854999999999997 27.79 22.93 15-19 20.39 27.915 27.794999999999998 23.9 20-24 19.835 27.839999999999996 28.49 23.835 25-29 19.865 28.09 28.345 23.7 30-34 20.24 28.09 27.500000000000004 24.169999999999998 35-39 20.61 27.85 28.165000000000003 23.375 40-44 19.805 28.93 27.634999999999998 23.630000000000003 45-49 20.285 28.139999999999997 27.93 23.645 50-54 20.285 28.915000000000003 27.295 23.505000000000003 55-59 20.044999999999998 28.549999999999997 28.08 23.325000000000003 60-64 19.74 29.025000000000002 27.279999999999998 23.955000000000002 65-69 20.125 28.4 27.85 23.625 70-74 20.195 28.505000000000003 28.244999999999997 23.055 75-79 19.744999999999997 28.95 27.445000000000004 23.86 80-84 20.155 28.29 28.000000000000004 23.555 85-89 20.419999999999998 28.58 26.810000000000002 24.19 90-94 20.195 27.555000000000003 27.860000000000003 24.39 95-99 20.875 28.21 27.97 22.945 100-104 20.54 28.555000000000003 27.1 23.805 105-109 20.235 28.18 27.565 24.02 110-114 20.86 27.98 28.155 23.005 115-119 21.279999999999998 28.165000000000003 27.305 23.25 120-124 20.365 28.315 27.35 23.97 125-129 21.105 27.555000000000003 27.29 24.05 130-134 20.424999999999997 28.27 27.435 23.87 135-139 20.979999999999997 28.095 27.02 23.905 140-144 21.275 27.089999999999996 27.87 23.765 145-149 20.895 27.735 28.499999999999996 22.869999999999997 150-151 20.575 27.712500000000002 27.075 24.637500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 3.0 21 4.0 22 2.5 23 2.0 24 7.0 25 8.0 26 4.0 27 6.5 28 9.0 29 16.0 30 24.0 31 31.5 32 37.0 33 41.5 34 55.0 35 68.5 36 78.0 37 99.0 38 120.5 39 149.5 40 184.0 41 210.0 42 231.5 43 252.5 44 268.0 45 244.0 46 232.5 47 279.0 48 267.0 49 209.0 50 177.5 51 140.5 52 111.0 53 98.0 54 91.5 55 60.0 56 37.5 57 36.5 58 22.5 59 18.0 60 17.5 61 9.0 62 8.0 63 7.5 64 5.0 65 4.0 66 2.0 67 0.0 68 0.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.525 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.625 #Duplication Level Percentage of deduplicated Percentage of total 1 86.48175182481752 74.05000000000001 2 11.007299270072993 18.85 3 1.9562043795620438 5.025 4 0.4671532846715329 1.6 5 0.029197080291970805 0.125 6 0.029197080291970805 0.15 7 0.0 0.0 8 0.029197080291970805 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 8 0.2 No Hit GCTTGATGTAACGGGAGTCTCAAGACTTCCAATGAAGGGATCGCCATTGA 6 0.15 No Hit ATCCCAACCAATTTCTCTCAAGCTTACCCCTTTTTTTACTCGATTAAATG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.5875 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.6124999999999998 0.0 0.0 0.0 0.0 110-111 1.8 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.2625 0.0 0.0 0.0 0.0 116-117 2.375 0.0 0.0 0.0 0.0 118-119 2.7 0.0 0.0 0.0 0.0 120-121 2.9625 0.0 0.0 0.0 0.0 122-123 3.2625 0.0 0.0 0.0 0.0 124-125 3.5625 0.0 0.0 0.0 0.0 126-127 3.95 0.0 0.0 0.0 0.0 128-129 4.1 0.0 0.0 0.0 0.0 130-131 4.25 0.0 0.0 0.0 0.0 132-133 4.55 0.0 0.0 0.0 0.0 134-135 4.875 0.0 0.0 0.0 0.0 136-137 5.1125 0.0 0.0 0.0 0.0 138-139 5.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671383 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671383_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2315 37.0 37.0 37.0 37.0 37.0 2 36.067 37.0 37.0 37.0 37.0 37.0 3 36.206 37.0 37.0 37.0 37.0 37.0 4 36.191 37.0 37.0 37.0 37.0 37.0 5 36.3295 37.0 37.0 37.0 37.0 37.0 6 36.163 37.0 37.0 37.0 37.0 37.0 7 36.1925 37.0 37.0 37.0 37.0 37.0 8 36.2785 37.0 37.0 37.0 37.0 37.0 9 36.242 37.0 37.0 37.0 37.0 37.0 10-14 36.256099999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.2681 37.0 37.0 37.0 37.0 37.0 20-24 36.2069 37.0 37.0 37.0 37.0 37.0 25-29 36.1653 37.0 37.0 37.0 37.0 37.0 30-34 36.1767 37.0 37.0 37.0 37.0 37.0 35-39 36.1271 37.0 37.0 37.0 37.0 37.0 40-44 36.080799999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.0608 37.0 37.0 37.0 37.0 37.0 50-54 36.0669 37.0 37.0 37.0 37.0 37.0 55-59 36.021699999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.0031 37.0 37.0 37.0 37.0 37.0 65-69 35.991699999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.941 37.0 37.0 37.0 37.0 37.0 75-79 35.90650000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.8519 37.0 37.0 37.0 37.0 37.0 85-89 35.9461 37.0 37.0 37.0 37.0 37.0 90-94 35.9477 37.0 37.0 37.0 37.0 37.0 95-99 35.826499999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.7867 37.0 37.0 37.0 37.0 37.0 105-109 35.6978 37.0 37.0 37.0 37.0 37.0 110-114 35.6697 37.0 37.0 37.0 37.0 37.0 115-119 35.6794 37.0 37.0 37.0 37.0 37.0 120-124 35.739999999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.6253 37.0 37.0 37.0 37.0 37.0 130-134 35.603300000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.5277 37.0 37.0 37.0 37.0 37.0 140-144 35.527499999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.4543 37.0 37.0 37.0 37.0 37.0 150-151 35.10975 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 0.0 15 2.0 16 2.0 17 1.0 18 0.0 19 2.0 20 2.0 21 2.0 22 6.0 23 2.0 24 4.0 25 10.0 26 11.0 27 16.0 28 17.0 29 20.0 30 28.0 31 45.0 32 57.0 33 80.0 34 184.0 35 512.0 36 2725.0 37 267.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.625 22.95 8.4 25.025 2 24.825 25.55 33.074999999999996 16.55 3 20.125 26.825 33.900000000000006 19.15 4 23.9 34.825 22.35 18.925 5 24.15 38.475 20.375 17.0 6 18.85 40.699999999999996 22.225 18.224999999999998 7 20.25 22.1 38.275 19.375 8 18.975 24.7 30.8 25.525 9 22.075 24.224999999999998 29.65 24.05 10-14 23.244999999999997 29.455 26.465 20.835 15-19 23.294999999999998 27.639999999999997 27.685 21.38 20-24 22.695 28.48 27.615000000000002 21.21 25-29 22.855 28.52 27.565 21.060000000000002 30-34 22.915 28.410000000000004 27.87 20.805 35-39 22.845 27.61 28.165000000000003 21.38 40-44 22.555 28.835 27.525 21.085 45-49 22.225 29.154999999999998 27.935 20.685000000000002 50-54 22.55 28.255000000000003 27.675 21.52 55-59 22.99 27.939999999999998 27.275 21.795 60-64 23.02 28.04 27.715 21.224999999999998 65-69 22.830000000000002 27.57 28.37 21.23 70-74 23.455000000000002 27.41 27.200000000000003 21.935 75-79 22.900000000000002 27.915 28.01 21.175 80-84 22.759999999999998 28.32 27.495000000000005 21.425 85-89 23.315 28.71 26.5 21.475 90-94 23.549999999999997 27.63 27.644999999999996 21.175 95-99 22.895 28.544999999999998 27.255000000000003 21.305 100-104 23.41 28.32 27.595 20.674999999999997 105-109 23.855 28.02 27.49 20.635 110-114 23.75 28.415000000000003 27.065 20.77 115-119 23.845 28.105000000000004 27.944999999999997 20.105 120-124 23.935000000000002 28.244999999999997 27.900000000000002 19.919999999999998 125-129 23.93 28.26 27.1 20.71 130-134 24.68 28.48 26.695 20.145 135-139 23.549999999999997 27.3 28.73 20.419999999999998 140-144 24.3 27.57 27.415 20.715 145-149 25.252525252525253 27.802780278027804 27.262726272627262 19.681968196819682 150-151 24.587500000000002 27.9375 27.375 20.1 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.5 10 1.5 11 1.0 12 0.5 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 2.0 23 2.5 24 1.5 25 4.0 26 6.0 27 5.0 28 6.0 29 11.0 30 16.5 31 27.0 32 35.0 33 44.5 34 55.0 35 60.0 36 71.0 37 100.5 38 141.0 39 151.5 40 177.0 41 218.5 42 248.5 43 281.0 44 285.5 45 292.0 46 292.0 47 267.0 48 234.0 49 181.0 50 143.5 51 123.5 52 91.0 53 76.0 54 72.5 55 67.0 56 50.0 57 25.0 58 23.5 59 23.5 60 20.0 61 12.0 62 6.0 63 9.0 64 5.5 65 2.0 66 3.5 67 4.5 68 3.0 69 2.0 70 1.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 1.0 81 1.0 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.65 #Duplication Level Percentage of deduplicated Percentage of total 1 86.60245183887916 74.175 2 10.770577933450088 18.45 3 2.2183304144775247 5.7 4 0.2626970227670753 0.8999999999999999 5 0.05837711617046118 0.25 6 0.05837711617046118 0.3 7 0.0 0.0 8 0.0 0.0 9 0.02918855808523059 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit GTCAGTATTAAATTGTCACACACACCATTCAGTTGTTTTTGCCACTCATC 6 0.15 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 6 0.15 No Hit GCAGGATAAGGGCATGTCGTTTTTGAGACCTTGGCTGTTTGGTTACCGAG 5 0.125 No Hit TATGCTTGTGATTGTAGCAGTGAGACTCTTGAGAGGGCTAAAGAGATTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.5875 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.775 0.0 0.0 0.0 0.0 112-113 2.025 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.65 0.0 0.0 0.0 0.0 120-121 2.9125 0.0 0.0 0.0 0.0 122-123 3.2125 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.9000000000000004 0.0 0.0 0.0 0.0 128-129 4.05 0.0 0.0 0.0 0.0 130-131 4.2 0.0 0.0 0.0 0.0 132-133 4.5 0.0 0.0 0.0 0.0 134-135 4.824999999999999 0.0 0.0 0.0 0.0 136-137 5.0625 0.0 0.0 0.0 0.0 138-139 5.449999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATGG 10 0.006830828 145.0 1 TCAACCT 10 0.006830828 145.0 3 >>END_MODULE Read 1703533 spots for SRR12671383.sra Written 1703533 spots for SRR12671383.sra Read 1703533 spots for SRR12671383.sra Written 1703533 spots for SRR12671383.sra Read 1703533 spots for SRR12671383.sra Written 1703533 spots for SRR12671383.sra Read 1703533 spots for SRR12671383.sra Written 1703533 spots for SRR12671383.sra Read 1703533 spots for SRR12671383.sra Written 1703533 spots for SRR12671383.sra Read 1703533 spots for SRR12671383.sra Written 1703533 spots for SRR12671383.sra Read 1703533 spots for SRR12671383.sra Written 1703533 spots for SRR12671383.sra Read 1703533 spots for SRR12671383.sra Written 1703533 spots for SRR12671383.sra Read 1703533 spots for SRR12671383.sra Written 1703533 spots for SRR12671383.sra Read 1703533 spots for SRR12671383.sra Written 1703533 spots for SRR12671383.sra Read 1703533 spots for SRR12671383.sra Written 1703533 spots for SRR12671383.sra Read 1703533 spots for SRR12671383.sra Written 1703533 spots for SRR12671383.sra Read 1703533 spots for SRR12671383.sra Written 1703533 spots for SRR12671383.sra Read 1703533 spots for SRR12671383.sra Written 1703533 spots for SRR12671383.sra Read 1703533 spots for SRR12671383.sra Written 1703533 spots for SRR12671383.sra Read 1703533 spots for SRR12671383.sra Written 1703533 spots for SRR12671383.sra Read 1703533 spots for SRR12671383.sra Written 1703533 spots for SRR12671383.sra Read 1703549 spots for SRR12671383.sra Written 1703549 spots for SRR12671383.sra Read 1703533 spots for SRR12671383.sra Written 1703533 spots for SRR12671383.sra Read 1703533 spots for SRR12671383.sra Written 1703533 spots for SRR12671383.sra SRR ids: ['SRR12671383.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_159l5swf SRR12671383.sra spots: 34070676 blocks: [[1, 1703533], [1703534, 3407066], [3407067, 5110599], [5110600, 6814132], [6814133, 8517665], [8517666, 10221198], [10221199, 11924731], [11924732, 13628264], [13628265, 15331797], [15331798, 17035330], [17035331, 18738863], [18738864, 20442396], [20442397, 22145929], [22145930, 23849462], [23849463, 25552995], [25552996, 27256528], [27256529, 28960061], [28960062, 30663594], [30663595, 32367127], [32367128, 34070676]] SRR12671383 file size 11557005 SRR12671383 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671383 SRR12671383_1.fastq SRR12671383_2.fastq Input file: SRR12671383_1.fastq Paired file: SRR12671383_2.fastq trimmed: SRR12671383-trimmed-pair1.fastq, SRR12671383-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:07:43 2025 >> started Tue Feb 11 21:08:20 2025 >> done (37.777s) 34070676 read pairs processed; of these: 392 ( 0.00%) short read pairs filtered out after trimming by size control 5866 ( 0.02%) empty read pairs filtered out after trimming by size control 34064418 (99.98%) read pairs available; of these: 2526352 ( 7.42%) trimmed read pairs available after processing 31538066 (92.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 29 0.00% 19 35 0.00% 20 29 0.00% 21 29 0.00% 22 26 0.00% 23 43 0.00% 24 47 0.00% 25 30 0.00% 26 69 0.00% 27 58 0.00% 28 73 0.00% 29 55 0.00% 30 67 0.00% 31 69 0.00% 32 59 0.00% 33 63 0.00% 34 65 0.00% 35 68 0.00% 36 61 0.00% 37 73 0.00% 38 79 0.00% 39 93 0.00% 40 65 0.00% 41 83 0.00% 42 78 0.00% 43 90 0.00% 44 105 0.00% 45 109 0.00% 46 112 0.00% 47 112 0.00% 48 105 0.00% 49 150 0.00% 50 167 0.00% 51 191 0.00% 52 218 0.00% 53 180 0.00% 54 196 0.00% 55 248 0.00% 56 295 0.00% 57 343 0.00% 58 340 0.00% 59 384 0.00% 60 478 0.00% 61 550 0.00% 62 606 0.00% 63 635 0.00% 64 753 0.00% 65 784 0.00% 66 938 0.00% 67 1017 0.00% 68 1181 0.00% 69 1312 0.00% 70 1408 0.00% 71 1649 0.00% 72 2045 0.01% 73 2210 0.01% 74 2550 0.01% 75 2743 0.01% 76 2941 0.01% 77 3280 0.01% 78 3538 0.01% 79 4002 0.01% 80 4452 0.01% 81 5075 0.01% 82 5585 0.02% 83 5986 0.02% 84 6702 0.02% 85 7335 0.02% 86 7977 0.02% 87 8398 0.02% 88 9167 0.03% 89 9669 0.03% 90 10406 0.03% 91 11209 0.03% 92 11752 0.03% 93 12922 0.04% 94 13828 0.04% 95 15162 0.04% 96 15413 0.05% 97 16180 0.05% 98 16908 0.05% 99 17489 0.05% 100 18617 0.05% 101 19610 0.06% 102 20442 0.06% 103 21670 0.06% 104 22548 0.07% 105 23334 0.07% 106 24538 0.07% 107 25607 0.08% 108 25859 0.08% 109 27189 0.08% 110 27452 0.08% 111 28692 0.08% 112 29825 0.09% 113 30253 0.09% 114 31670 0.09% 115 33336 0.10% 116 34305 0.10% 117 35648 0.10% 118 36688 0.11% 119 36950 0.11% 120 38254 0.11% 121 39459 0.12% 122 40294 0.12% 123 41378 0.12% 124 43315 0.13% 125 43845 0.13% 126 45748 0.13% 127 46732 0.14% 128 47468 0.14% 129 48449 0.14% 130 49796 0.15% 131 49760 0.15% 132 51243 0.15% 133 52700 0.15% 134 53870 0.16% 135 55095 0.16% 136 56418 0.17% 137 57591 0.17% 138 58939 0.17% 139 60863 0.18% 140 61104 0.18% 141 62384 0.18% 142 63404 0.19% 143 64271 0.19% 144 65612 0.19% 145 67711 0.20% 146 68724 0.20% 147 69371 0.20% 148 72040 0.21% 149 71701 0.21% 150 73554 0.22% 151 31538066 92.58% 34064418 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=22 prefix-density=0.52 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=18.32 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.7 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=27 prefix-density=0.63 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=34.32 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.1 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR12671383 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:09:04 Started mapping on | Feb 11 21:09:05 Finished on | Feb 11 21:12:45 Mapping speed, Million of reads per hour | 557.42 Number of input reads | 34064418 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 31155660 Uniquely mapped reads % | 91.46% Average mapped length | 296.54 Number of splices: Total | 31101246 Number of splices: Annotated (sjdb) | 30434490 Number of splices: GT/AG | 30479493 Number of splices: GC/AG | 501856 Number of splices: AT/AC | 19283 Number of splices: Non-canonical | 100614 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.03% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 798724 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 321741 % of reads mapped to too many loci | 0.94% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.03% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2110034 2110034 2110034 N_multimapping 798724 798724 798724 N_noFeature 1279489 30723762 1424950 N_ambiguous 498936 2171 211258 UnstrandedReadsAssigned:29377235 PositiveStrandReadsAssigned:429727 NegativeStrandReadsAssigned:29519452 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671383 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671383-trimmed-pair1.fastq SRR12671383-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,064,418 reads, 29,598,659 reads pseudoaligned [quant] estimated average fragment length: 277.038 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,253 rounds 52401 SRR12671383.ke.tsv 34699 SRR12671383.se.tsv 87100 total ==> SRR12671383.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1741.96 1246.53 22.7591 Potri.005G024800.1.v4.1 1035 758.962 510 21.3719 Potri.004G059700.1.v4.1 961 685.216 52 2.41362 Potri.007G009000.2.v4.1 1416 1139.96 0 0 Potri.003G141000.2.v4.1 2943 2666.96 1891.42 22.5561 Potri.016G087400.1.v4.1 270 80.2717 1488 589.568 Potri.015G069301.1.v4.1 564 306.743 0 0 Potri.010G195200.1.v4.1 1773 1496.96 345 7.32995 Potri.012G127500.1.v4.1 977 701.115 293 13.2914 ==> SRR12671383.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 997 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 401 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 48 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 32 SRR12671383 completed mapping pipeline successfully