Starting /dee2/code/volunteer_pipeline.sh SRR12671384 current disk space = 3052569600000 free memory = 1573312980 SRR12671384 SRAfilesize ace44d434f9632fae554d8bb7ee61793 SRR12671384.sra SRR12671384.sra file validated SRR12671384 is paired end SRR12671384 is conventional basespace SRR12671384 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671384_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6155 37.0 37.0 37.0 37.0 37.0 2 36.45575 37.0 37.0 37.0 37.0 37.0 3 36.6335 37.0 37.0 37.0 37.0 37.0 4 36.674 37.0 37.0 37.0 37.0 37.0 5 36.613 37.0 37.0 37.0 37.0 37.0 6 36.5815 37.0 37.0 37.0 37.0 37.0 7 36.6 37.0 37.0 37.0 37.0 37.0 8 36.5735 37.0 37.0 37.0 37.0 37.0 9 36.6195 37.0 37.0 37.0 37.0 37.0 10-14 36.6496 37.0 37.0 37.0 37.0 37.0 15-19 36.6414 37.0 37.0 37.0 37.0 37.0 20-24 36.5913 37.0 37.0 37.0 37.0 37.0 25-29 36.5836 37.0 37.0 37.0 37.0 37.0 30-34 36.509100000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.506899999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.5031 37.0 37.0 37.0 37.0 37.0 45-49 36.5034 37.0 37.0 37.0 37.0 37.0 50-54 36.465700000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.472500000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.4279 37.0 37.0 37.0 37.0 37.0 65-69 36.4128 37.0 37.0 37.0 37.0 37.0 70-74 36.4097 37.0 37.0 37.0 37.0 37.0 75-79 36.40560000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.3515 37.0 37.0 37.0 37.0 37.0 85-89 36.3294 37.0 37.0 37.0 37.0 37.0 90-94 36.2765 37.0 37.0 37.0 37.0 37.0 95-99 36.2795 37.0 37.0 37.0 37.0 37.0 100-104 36.2627 37.0 37.0 37.0 37.0 37.0 105-109 36.29019999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.193400000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.1823 37.0 37.0 37.0 37.0 37.0 120-124 36.160199999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.1343 37.0 37.0 37.0 37.0 37.0 130-134 36.0906 37.0 37.0 37.0 37.0 37.0 135-139 36.1062 37.0 37.0 37.0 37.0 37.0 140-144 35.989 37.0 37.0 37.0 37.0 37.0 145-149 35.99699999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.922 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 0.0 23 1.0 24 1.0 25 2.0 26 3.0 27 5.0 28 8.0 29 19.0 30 15.0 31 34.0 32 32.0 33 58.0 34 108.0 35 260.0 36 3019.0 37 433.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.1 11.175 5.25 50.475 2 17.65589782118708 12.697220135236664 43.350864012021034 26.296018031555224 3 17.75 16.2 28.000000000000004 38.05 4 22.7 24.825 22.075 30.4 5 24.025 30.55 26.325 19.1 6 20.0 33.900000000000006 24.775 21.325 7 15.174999999999999 24.85 42.475 17.5 8 15.75 25.424999999999997 33.35 25.474999999999998 9 16.3 22.55 36.325 24.825 10-14 19.470000000000002 30.035 27.639999999999997 22.855 15-19 19.7 27.544999999999998 28.985 23.77 20-24 19.945 27.61 28.249999999999996 24.195 25-29 19.655 28.63 28.035 23.68 30-34 19.725 28.035 28.189999999999998 24.05 35-39 20.27 27.855 28.03 23.845 40-44 19.63 29.060000000000002 27.67 23.64 45-49 19.55 28.025 28.060000000000002 24.365000000000002 50-54 19.955000000000002 28.444999999999997 27.889999999999997 23.71 55-59 19.794999999999998 29.044999999999998 28.01 23.150000000000002 60-64 19.455 28.74 27.855 23.95 65-69 20.119999999999997 27.994999999999997 28.044999999999998 23.84 70-74 19.5 27.98 28.28 24.240000000000002 75-79 19.685 27.810000000000002 29.080000000000002 23.425 80-84 19.63 28.33 28.22 23.82 85-89 20.13 28.515 27.68 23.674999999999997 90-94 20.150000000000002 28.025 28.26 23.565 95-99 20.23 28.515 27.075 24.18 100-104 20.585 28.655 27.529999999999998 23.23 105-109 19.64 28.38 27.810000000000002 24.169999999999998 110-114 20.145 27.595 28.48 23.78 115-119 20.46 28.405 28.005000000000003 23.13 120-124 20.175 28.134999999999998 28.13 23.56 125-129 21.01 27.58 27.435 23.974999999999998 130-134 20.645 27.665 28.725 22.965 135-139 20.585 27.965 28.044999999999998 23.405 140-144 20.745 28.549999999999997 27.41 23.294999999999998 145-149 21.07 28.144999999999996 27.52 23.265 150-151 20.5875 27.8875 27.3375 24.1875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.0 19 1.0 20 0.5 21 1.0 22 1.0 23 1.0 24 4.0 25 5.0 26 4.5 27 6.5 28 7.5 29 12.0 30 17.5 31 22.0 32 34.0 33 50.0 34 57.5 35 65.5 36 82.5 37 110.5 38 139.0 39 168.5 40 202.0 41 213.0 42 228.5 43 248.5 44 273.0 45 285.5 46 272.5 47 268.5 48 229.5 49 193.0 50 169.5 51 121.5 52 103.0 53 89.0 54 72.5 55 65.5 56 45.5 57 30.0 58 27.5 59 23.0 60 14.0 61 9.5 62 4.5 63 1.5 64 3.5 65 6.0 66 3.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.475 #Duplication Level Percentage of deduplicated Percentage of total 1 84.99556081680971 71.8 2 12.192956496004735 20.599999999999998 3 2.3971589227582126 6.075 4 0.32554010062148564 1.0999999999999999 5 0.059189109203906486 0.25 6 0.0 0.0 7 0.029594554601953243 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCTGGCTGAGCAAGCACTCTTGAGAGAAGATCAAATAAGCTCTGAATC 7 0.17500000000000002 No Hit CTCAAAGTCAACATCTCATCCACTGCCGCTCCAAATGCAGGCAAAATCAC 5 0.125 No Hit CTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 0.95 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.1 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.2625 0.0 0.0 0.0 0.0 124-125 1.475 0.0 0.0 0.0 0.0 126-127 1.775 0.0 0.0 0.0 0.0 128-129 1.925 0.0 0.0 0.0 0.0 130-131 2.125 0.0 0.0 0.0 0.0 132-133 2.35 0.0 0.0 0.0 0.0 134-135 2.6500000000000004 0.0 0.0 0.0 0.0 136-137 2.925 0.0 0.0 0.0 0.0 138-139 3.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTACATT 10 0.006830828 145.0 6 GACATGT 10 0.006830828 145.0 145 >>END_MODULE SRR12671384 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671384_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.297 37.0 37.0 37.0 37.0 37.0 2 36.1075 37.0 37.0 37.0 37.0 37.0 3 36.126 37.0 37.0 37.0 37.0 37.0 4 36.2675 37.0 37.0 37.0 37.0 37.0 5 36.2375 37.0 37.0 37.0 37.0 37.0 6 36.2655 37.0 37.0 37.0 37.0 37.0 7 36.2565 37.0 37.0 37.0 37.0 37.0 8 36.253 37.0 37.0 37.0 37.0 37.0 9 36.2615 37.0 37.0 37.0 37.0 37.0 10-14 36.2548 37.0 37.0 37.0 37.0 37.0 15-19 36.292 37.0 37.0 37.0 37.0 37.0 20-24 36.2232 37.0 37.0 37.0 37.0 37.0 25-29 36.227999999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.1765 37.0 37.0 37.0 37.0 37.0 35-39 36.160000000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.1003 37.0 37.0 37.0 37.0 37.0 45-49 36.0821 37.0 37.0 37.0 37.0 37.0 50-54 36.087599999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.0139 37.0 37.0 37.0 37.0 37.0 60-64 36.0577 37.0 37.0 37.0 37.0 37.0 65-69 36.0127 37.0 37.0 37.0 37.0 37.0 70-74 36.0092 37.0 37.0 37.0 37.0 37.0 75-79 35.973499999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.934000000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.882400000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.864599999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.856 37.0 37.0 37.0 37.0 37.0 100-104 35.83069999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.752 37.0 37.0 37.0 37.0 37.0 110-114 35.6783 37.0 37.0 37.0 37.0 37.0 115-119 35.8116 37.0 37.0 37.0 37.0 37.0 120-124 35.7984 37.0 37.0 37.0 37.0 37.0 125-129 35.729200000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.5925 37.0 37.0 37.0 37.0 37.0 135-139 35.582499999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.648 37.0 37.0 37.0 37.0 37.0 145-149 35.5741 37.0 37.0 37.0 37.0 37.0 150-151 35.336 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 1.0 17 0.0 18 2.0 19 1.0 20 3.0 21 2.0 22 7.0 23 4.0 24 6.0 25 10.0 26 6.0 27 14.0 28 15.0 29 10.0 30 16.0 31 49.0 32 55.0 33 108.0 34 168.0 35 539.0 36 2744.0 37 238.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.425 22.525000000000002 10.575 32.475 2 24.95 26.5 34.35 14.2 3 20.1 27.6 31.45 20.849999999999998 4 22.35 36.025 22.375 19.25 5 24.474999999999998 37.925 21.7 15.9 6 18.05 40.525 23.125 18.3 7 20.325 21.85 39.825 18.0 8 18.575 25.35 31.4 24.675 9 22.1 23.425 30.2 24.275 10-14 21.85 30.28 26.810000000000002 21.060000000000002 15-19 22.165000000000003 28.835 27.855 21.145 20-24 22.31 28.9 28.01 20.78 25-29 22.39 28.910000000000004 27.584999999999997 21.115000000000002 30-34 22.29 28.645 27.91 21.154999999999998 35-39 22.62 28.28 27.88 21.22 40-44 22.56 27.82 28.904999999999998 20.715 45-49 22.205 27.889999999999997 28.83 21.075 50-54 22.575 28.155 28.035 21.235 55-59 22.375 28.735 27.68 21.21 60-64 22.994999999999997 28.165000000000003 28.349999999999998 20.49 65-69 23.05 28.24 27.815 20.895 70-74 22.67 28.435 27.834999999999997 21.060000000000002 75-79 22.535 27.965 27.98 21.52 80-84 22.61 28.46 27.474999999999998 21.455 85-89 22.994999999999997 27.185 28.525 21.295 90-94 23.455000000000002 27.615000000000002 27.839999999999996 21.09 95-99 22.994999999999997 28.544999999999998 27.815 20.645 100-104 22.895 28.325 27.76 21.02 105-109 23.385 28.13 27.43 21.055 110-114 23.98 27.97 28.000000000000004 20.05 115-119 23.674999999999997 28.79 27.095000000000002 20.44 120-124 23.51 28.665000000000003 27.145000000000003 20.68 125-129 23.77 28.92 27.05 20.26 130-134 23.87 27.765 27.860000000000003 20.505000000000003 135-139 24.505 27.089999999999996 27.755000000000003 20.65 140-144 24.154999999999998 27.284999999999997 27.675 20.885 145-149 23.895 27.43 27.925 20.75 150-151 24.587500000000002 27.55 26.85 21.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 1.0 17 1.5 18 1.5 19 0.5 20 1.5 21 1.5 22 0.5 23 1.0 24 1.5 25 4.0 26 9.0 27 9.0 28 8.5 29 14.0 30 21.5 31 28.5 32 37.5 33 53.5 34 62.0 35 75.0 36 92.0 37 116.0 38 147.5 39 174.0 40 198.0 41 231.0 42 272.5 43 268.0 44 263.5 45 262.5 46 247.5 47 235.5 48 213.0 49 192.5 50 164.0 51 132.5 52 105.0 53 71.0 54 55.5 55 57.5 56 44.0 57 28.0 58 21.5 59 20.0 60 17.5 61 12.5 62 6.0 63 3.0 64 1.5 65 1.5 66 1.0 67 1.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.175 #Duplication Level Percentage of deduplicated Percentage of total 1 85.32818532818533 71.825 2 11.612711612711612 19.55 3 2.5245025245025245 6.375 4 0.3861003861003861 1.3 5 0.029700029700029697 0.125 6 0.029700029700029697 0.15 7 0.029700029700029697 0.17500000000000002 8 0.0 0.0 9 0.029700029700029697 0.22499999999999998 >10 0.029700029700029697 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 11 0.27499999999999997 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 9 0.22499999999999998 No Hit GGTCTATTTTGGTCAAGACTCTCTCTCTCTGTATTGGGTTCCCTGAATGC 7 0.17500000000000002 No Hit CAAGACTCGTCTCCACTCCTCTCCTTGCATGCACTACGACTCTAGTGCAC 6 0.15 No Hit CGTAGAACCACTTTCTCCGTCCGCTGCGCTGGCGGTGATGACTCTACTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.9125000000000001 0.0 0.0 0.0 0.0 112-113 0.975 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.1749999999999998 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.5 0.0 0.0 0.0 0.0 126-127 1.8 0.0 0.0 0.0 0.0 128-129 1.95 0.0 0.0 0.0 0.0 130-131 2.1500000000000004 0.0 0.0 0.0 0.0 132-133 2.35 0.0 0.0 0.0 0.0 134-135 2.6500000000000004 0.0 0.0 0.0 0.0 136-137 2.925 0.0 0.0 0.0 0.0 138-139 3.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 856453 spots for SRR12671384.sra Written 856453 spots for SRR12671384.sra Read 856453 spots for SRR12671384.sra Written 856453 spots for SRR12671384.sra Read 856453 spots for SRR12671384.sra Written 856453 spots for SRR12671384.sra Read 856453 spots for SRR12671384.sra Written 856453 spots for SRR12671384.sra Read 856453 spots for SRR12671384.sra Written 856453 spots for SRR12671384.sra Read 856453 spots for SRR12671384.sra Written 856453 spots for SRR12671384.sra Read 856453 spots for SRR12671384.sra Written 856453 spots for SRR12671384.sra Read 856453 spots for SRR12671384.sra Written 856453 spots for SRR12671384.sra Read 856453 spots for SRR12671384.sra Written 856453 spots for SRR12671384.sra Read 856453 spots for SRR12671384.sra Written 856453 spots for SRR12671384.sra Read 856453 spots for SRR12671384.sra Written 856453 spots for SRR12671384.sra Read 856453 spots for SRR12671384.sra Written 856453 spots for SRR12671384.sra Read 856453 spots for SRR12671384.sra Written 856453 spots for SRR12671384.sra Read 856453 spots for SRR12671384.sra Written 856453 spots for SRR12671384.sra Read 856453 spots for SRR12671384.sra Written 856453 spots for SRR12671384.sra Read 856453 spots for SRR12671384.sra Written 856453 spots for SRR12671384.sra Read 856459 spots for SRR12671384.sra Written 856459 spots for SRR12671384.sra Read 856453 spots for SRR12671384.sra Written 856453 spots for SRR12671384.sra Read 856453 spots for SRR12671384.sra Written 856453 spots for SRR12671384.sra Read 856453 spots for SRR12671384.sra Written 856453 spots for SRR12671384.sra SRR ids: ['SRR12671384.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aq2jrqkg SRR12671384.sra spots: 17129066 blocks: [[1, 856453], [856454, 1712906], [1712907, 2569359], [2569360, 3425812], [3425813, 4282265], [4282266, 5138718], [5138719, 5995171], [5995172, 6851624], [6851625, 7708077], [7708078, 8564530], [8564531, 9420983], [9420984, 10277436], [10277437, 11133889], [11133890, 11990342], [11990343, 12846795], [12846796, 13703248], [13703249, 14559701], [14559702, 15416154], [15416155, 16272607], [16272608, 17129066]] SRR12671384 file size 5799505 SRR12671384 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671384 SRR12671384_1.fastq SRR12671384_2.fastq Input file: SRR12671384_1.fastq Paired file: SRR12671384_2.fastq trimmed: SRR12671384-trimmed-pair1.fastq, SRR12671384-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:00:10 2025 >> started Tue Feb 11 22:00:31 2025 >> done (20.760s) 17129066 read pairs processed; of these: 68 ( 0.00%) short read pairs filtered out after trimming by size control 1106 ( 0.01%) empty read pairs filtered out after trimming by size control 17127892 (99.99%) read pairs available; of these: 845897 ( 4.94%) trimmed read pairs available after processing 16281995 (95.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 9 0.00% 21 11 0.00% 22 7 0.00% 23 15 0.00% 24 13 0.00% 25 11 0.00% 26 16 0.00% 27 16 0.00% 28 15 0.00% 29 9 0.00% 30 12 0.00% 31 15 0.00% 32 12 0.00% 33 22 0.00% 34 20 0.00% 35 19 0.00% 36 25 0.00% 37 17 0.00% 38 25 0.00% 39 21 0.00% 40 26 0.00% 41 41 0.00% 42 22 0.00% 43 27 0.00% 44 31 0.00% 45 31 0.00% 46 25 0.00% 47 49 0.00% 48 50 0.00% 49 54 0.00% 50 71 0.00% 51 51 0.00% 52 84 0.00% 53 83 0.00% 54 68 0.00% 55 93 0.00% 56 106 0.00% 57 130 0.00% 58 121 0.00% 59 165 0.00% 60 187 0.00% 61 163 0.00% 62 228 0.00% 63 273 0.00% 64 274 0.00% 65 261 0.00% 66 276 0.00% 67 376 0.00% 68 402 0.00% 69 435 0.00% 70 520 0.00% 71 544 0.00% 72 683 0.00% 73 732 0.00% 74 872 0.01% 75 856 0.00% 76 1076 0.01% 77 1095 0.01% 78 1245 0.01% 79 1383 0.01% 80 1550 0.01% 81 1701 0.01% 82 1797 0.01% 83 2079 0.01% 84 2310 0.01% 85 2518 0.01% 86 2799 0.02% 87 2876 0.02% 88 3215 0.02% 89 3177 0.02% 90 3380 0.02% 91 3787 0.02% 92 4092 0.02% 93 4116 0.02% 94 4606 0.03% 95 4804 0.03% 96 5440 0.03% 97 5505 0.03% 98 5593 0.03% 99 6027 0.04% 100 6394 0.04% 101 6406 0.04% 102 6764 0.04% 103 7075 0.04% 104 7192 0.04% 105 7852 0.05% 106 8033 0.05% 107 8312 0.05% 108 8755 0.05% 109 9295 0.05% 110 9280 0.05% 111 9524 0.06% 112 10208 0.06% 113 10077 0.06% 114 10405 0.06% 115 10862 0.06% 116 11471 0.07% 117 11755 0.07% 118 12112 0.07% 119 12113 0.07% 120 12952 0.08% 121 13152 0.08% 122 13218 0.08% 123 13754 0.08% 124 14268 0.08% 125 14325 0.08% 126 14847 0.09% 127 15261 0.09% 128 15940 0.09% 129 15986 0.09% 130 16256 0.09% 131 16942 0.10% 132 16977 0.10% 133 17744 0.10% 134 17493 0.10% 135 18245 0.11% 136 18950 0.11% 137 19380 0.11% 138 19564 0.11% 139 20206 0.12% 140 20770 0.12% 141 21223 0.12% 142 21631 0.13% 143 21681 0.13% 144 22136 0.13% 145 22383 0.13% 146 23231 0.14% 147 23391 0.14% 148 25010 0.15% 149 24717 0.14% 150 25480 0.15% 151 16281995 95.06% 17127892 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=23 prefix-density=0.31 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=17.01 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=5.4 sequence=ACAGCCTTCAGCGACAGGCACCTTTACTTGCTGTGCCGCTTGGCC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=34 prefix-density=0.50 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=95.79 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.6 sequence=AAGGATGGTAGAGTAGCATCCTTAGCGTTGCTGGTTTACTTTCCTAACAATCCTCAAAACCATTCTTCTTAGACTCTCTATACATTCCAAATAACC SRR12671384 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:01:16 Started mapping on | Feb 11 22:01:16 Finished on | Feb 11 22:03:04 Mapping speed, Million of reads per hour | 570.93 Number of input reads | 17127892 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 16024281 Uniquely mapped reads % | 93.56% Average mapped length | 298.05 Number of splices: Total | 15812460 Number of splices: Annotated (sjdb) | 15442355 Number of splices: GT/AG | 15501239 Number of splices: GC/AG | 251592 Number of splices: AT/AC | 10198 Number of splices: Non-canonical | 49431 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.03% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431753 % of reads mapped to multiple loci | 2.52% Number of reads mapped to too many loci | 59069 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.46% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 671858 671858 671858 N_multimapping 431753 431753 431753 N_noFeature 667243 15773594 746081 N_ambiguous 284683 995 112235 UnstrandedReadsAssigned:15072355 PositiveStrandReadsAssigned:249692 NegativeStrandReadsAssigned:15165965 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671384 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671384-trimmed-pair1.fastq SRR12671384-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,127,892 reads, 15,133,163 reads pseudoaligned [quant] estimated average fragment length: 303.671 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52401 SRR12671384.ke.tsv 34699 SRR12671384.se.tsv 87100 total ==> SRR12671384.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1715.33 785 27.4347 Potri.005G024800.1.v4.1 1035 732.329 331 27.0956 Potri.004G059700.1.v4.1 961 658.534 0 0 Potri.007G009000.2.v4.1 1416 1113.33 0 0 Potri.003G141000.2.v4.1 2943 2640.33 922.034 20.9347 Potri.016G087400.1.v4.1 270 72.3263 810 671.377 Potri.015G069301.1.v4.1 564 284.253 0 0 Potri.010G195200.1.v4.1 1773 1470.33 119.993 4.89238 Potri.012G127500.1.v4.1 977 674.436 123 10.9331 ==> SRR12671384.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 94 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 193 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12671384 completed mapping pipeline successfully