Starting /dee2/code/volunteer_pipeline.sh SRR12671385 current disk space = 3052976783360 free memory = 1405541640 SRR12671385 SRAfilesize be03f023849be1d56ccc210b3a45c8a3 SRR12671385.sra SRR12671385.sra file validated SRR12671385 is paired end SRR12671385 is conventional basespace SRR12671385 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671385_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.626 37.0 37.0 37.0 37.0 37.0 2 36.441 37.0 37.0 37.0 37.0 37.0 3 36.5795 37.0 37.0 37.0 37.0 37.0 4 36.683 37.0 37.0 37.0 37.0 37.0 5 36.6775 37.0 37.0 37.0 37.0 37.0 6 36.6505 37.0 37.0 37.0 37.0 37.0 7 36.636 37.0 37.0 37.0 37.0 37.0 8 36.5375 37.0 37.0 37.0 37.0 37.0 9 36.645 37.0 37.0 37.0 37.0 37.0 10-14 36.6214 37.0 37.0 37.0 37.0 37.0 15-19 36.625099999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.6109 37.0 37.0 37.0 37.0 37.0 25-29 36.5887 37.0 37.0 37.0 37.0 37.0 30-34 36.537699999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.4913 37.0 37.0 37.0 37.0 37.0 40-44 36.456199999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.455 37.0 37.0 37.0 37.0 37.0 50-54 36.450900000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.41760000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.4247 37.0 37.0 37.0 37.0 37.0 65-69 36.430600000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.3592 37.0 37.0 37.0 37.0 37.0 75-79 36.331500000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.3312 37.0 37.0 37.0 37.0 37.0 85-89 36.2807 37.0 37.0 37.0 37.0 37.0 90-94 36.2893 37.0 37.0 37.0 37.0 37.0 95-99 36.24579999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.2123 37.0 37.0 37.0 37.0 37.0 105-109 36.2643 37.0 37.0 37.0 37.0 37.0 110-114 36.206 37.0 37.0 37.0 37.0 37.0 115-119 36.1488 37.0 37.0 37.0 37.0 37.0 120-124 36.0817 37.0 37.0 37.0 37.0 37.0 125-129 36.1242 37.0 37.0 37.0 37.0 37.0 130-134 36.0279 37.0 37.0 37.0 37.0 37.0 135-139 35.96660000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.8583 37.0 37.0 37.0 37.0 37.0 145-149 35.8468 37.0 37.0 37.0 37.0 37.0 150-151 35.77975 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 2.0 23 2.0 24 2.0 25 1.0 26 3.0 27 9.0 28 9.0 29 8.0 30 23.0 31 27.0 32 38.0 33 74.0 34 122.0 35 265.0 36 2959.0 37 454.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.949999999999996 9.825000000000001 9.075 46.150000000000006 2 19.3734335839599 14.035087719298245 37.54385964912281 29.04761904761905 3 19.6 16.325 26.5 37.574999999999996 4 24.525 26.275 22.6 26.6 5 21.825 32.574999999999996 25.4 20.200000000000003 6 19.525000000000002 33.575 25.474999999999998 21.425 7 14.825 24.875 42.8 17.5 8 16.55 23.1 33.95 26.400000000000002 9 17.025000000000002 24.15 34.9 23.925 10-14 19.715 30.095 27.43 22.759999999999998 15-19 19.695 28.475 28.395 23.435 20-24 19.61 28.060000000000002 27.975 24.355 25-29 19.689999999999998 28.12 28.29 23.9 30-34 19.85 27.55 28.515 24.085 35-39 19.07 28.199999999999996 28.095 24.635 40-44 19.515 28.665000000000003 28.305000000000003 23.515 45-49 19.869999999999997 28.95 27.51 23.669999999999998 50-54 20.04 29.134999999999998 27.04 23.785 55-59 19.615 28.965000000000003 28.01 23.41 60-64 20.169999999999998 28.955 27.195000000000004 23.68 65-69 20.150000000000002 28.675 27.51 23.665 70-74 20.275000000000002 28.634999999999998 27.58 23.51 75-79 20.175 28.435 27.725 23.665 80-84 19.985 28.62 27.935 23.46 85-89 19.395 28.73 27.93 23.945 90-94 20.66 28.439999999999998 27.605 23.294999999999998 95-99 20.185 28.845 26.669999999999998 24.3 100-104 20.525 28.01 27.589999999999996 23.875 105-109 19.88 29.020000000000003 27.544999999999998 23.555 110-114 20.275000000000002 28.645 26.790000000000003 24.29 115-119 20.53 28.975 26.77 23.724999999999998 120-124 20.435 27.82 27.735 24.01 125-129 20.630000000000003 28.754999999999995 27.185 23.43 130-134 20.445 28.93 27.005000000000003 23.62 135-139 20.830000000000002 28.73 27.245 23.195 140-144 20.349999999999998 28.439999999999998 27.235 23.974999999999998 145-149 20.28 28.505000000000003 26.945000000000004 24.27 150-151 20.5 28.249999999999996 26.3 24.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 0.5 20 0.5 21 1.0 22 2.5 23 3.0 24 2.5 25 7.0 26 7.0 27 7.0 28 11.0 29 16.5 30 21.5 31 31.0 32 41.5 33 46.5 34 51.5 35 68.5 36 93.0 37 121.0 38 141.0 39 158.0 40 189.5 41 204.0 42 227.0 43 256.0 44 262.0 45 269.0 46 246.5 47 216.0 48 218.0 49 212.0 50 174.5 51 147.5 52 126.5 53 91.5 54 69.5 55 50.0 56 44.5 57 41.5 58 31.0 59 26.0 60 20.0 61 10.5 62 5.5 63 4.0 64 4.0 65 3.5 66 1.5 67 3.5 68 2.5 69 1.0 70 2.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.95 #Duplication Level Percentage of deduplicated Percentage of total 1 86.82373472949389 74.625 2 10.500290866783013 18.05 3 2.297847585805701 5.925 4 0.31995346131471786 1.0999999999999999 5 0.029086678301337987 0.125 6 0.0 0.0 7 0.029086678301337987 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGGGAACCCGGCATTGTTCTTGAAGACAATCTTTTCACCAGCGGGTACA 7 0.17500000000000002 No Hit GCTCCATTCGGTGCTCAAGACCTCGAAGGTAGTGCCCCAAAAGCATACAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15000000000000002 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.1125 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.6375 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.4625 0.0 0.0 0.0 0.0 116-117 2.6 0.0 0.0 0.0 0.0 118-119 2.825 0.0 0.0 0.0 0.0 120-121 3.175 0.0 0.0 0.0 0.0 122-123 3.375 0.0 0.0 0.0 0.0 124-125 3.6500000000000004 0.0 0.0 0.0 0.0 126-127 3.9124999999999996 0.0 0.0 0.0 0.0 128-129 4.35 0.0 0.0 0.0 0.0 130-131 4.575 0.0 0.0 0.0 0.0 132-133 5.1375 0.0 0.0 0.0 0.0 134-135 5.5625 0.0 0.0 0.0 0.0 136-137 6.0125 0.0 0.0 0.0 0.0 138-139 6.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTAC 10 0.006830828 145.0 6 TTTTACA 10 0.006830828 145.0 7 TGTATGC 10 0.006830828 145.0 5 TTTACAG 10 0.006830828 145.0 8 TCCCTTA 10 0.006830828 145.0 145 >>END_MODULE SRR12671385 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671385_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3755 37.0 37.0 37.0 37.0 37.0 2 36.22 37.0 37.0 37.0 37.0 37.0 3 36.288 37.0 37.0 37.0 37.0 37.0 4 36.2625 37.0 37.0 37.0 37.0 37.0 5 36.428 37.0 37.0 37.0 37.0 37.0 6 36.3345 37.0 37.0 37.0 37.0 37.0 7 36.252 37.0 37.0 37.0 37.0 37.0 8 36.4415 37.0 37.0 37.0 37.0 37.0 9 36.2385 37.0 37.0 37.0 37.0 37.0 10-14 36.3784 37.0 37.0 37.0 37.0 37.0 15-19 36.397200000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.34439999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.2709 37.0 37.0 37.0 37.0 37.0 30-34 36.2712 37.0 37.0 37.0 37.0 37.0 35-39 36.2798 37.0 37.0 37.0 37.0 37.0 40-44 36.2063 37.0 37.0 37.0 37.0 37.0 45-49 36.205400000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.2008 37.0 37.0 37.0 37.0 37.0 55-59 36.1843 37.0 37.0 37.0 37.0 37.0 60-64 36.1192 37.0 37.0 37.0 37.0 37.0 65-69 36.1432 37.0 37.0 37.0 37.0 37.0 70-74 36.134800000000006 37.0 37.0 37.0 37.0 37.0 75-79 36.0366 37.0 37.0 37.0 37.0 37.0 80-84 36.0089 37.0 37.0 37.0 37.0 37.0 85-89 36.0843 37.0 37.0 37.0 37.0 37.0 90-94 36.04209999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.9873 37.0 37.0 37.0 37.0 37.0 100-104 35.999100000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.9127 37.0 37.0 37.0 37.0 37.0 110-114 35.891400000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.928700000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.8532 37.0 37.0 37.0 37.0 37.0 125-129 35.8464 37.0 37.0 37.0 37.0 37.0 130-134 35.6959 37.0 37.0 37.0 37.0 37.0 135-139 35.6064 37.0 37.0 37.0 37.0 37.0 140-144 35.6885 37.0 37.0 37.0 37.0 37.0 145-149 35.587999999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.292500000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 1.0 20 2.0 21 3.0 22 4.0 23 2.0 24 7.0 25 7.0 26 4.0 27 11.0 28 14.0 29 20.0 30 14.0 31 33.0 32 53.0 33 78.0 34 172.0 35 491.0 36 2767.0 37 314.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.1 18.8 13.975000000000001 30.125 2 25.650000000000002 26.0 32.875 15.475 3 21.25 27.625 32.05 19.075 4 23.599999999999998 33.425 23.0 19.975 5 25.7 38.625 21.15 14.524999999999999 6 19.625 39.800000000000004 22.650000000000002 17.925 7 20.0 19.025 39.775 21.2 8 19.25 25.55 31.125000000000004 24.075 9 21.55 23.825 31.275 23.35 10-14 23.41 28.794999999999998 26.5 21.295 15-19 23.11 27.450000000000003 28.59 20.849999999999998 20-24 23.21 28.78 27.57 20.44 25-29 23.07 27.834999999999997 28.12 20.974999999999998 30-34 22.145 28.494999999999997 28.595 20.765 35-39 22.8 27.700000000000003 28.715000000000003 20.785 40-44 22.2 27.97 28.515 21.315 45-49 21.985 28.415000000000003 28.410000000000004 21.19 50-54 22.735 28.305000000000003 27.950000000000003 21.01 55-59 23.419999999999998 27.744999999999997 28.610000000000003 20.225 60-64 22.895 28.475 28.37 20.26 65-69 23.150000000000002 27.985 28.060000000000002 20.805 70-74 23.03 27.985 28.305000000000003 20.68 75-79 23.07 27.384999999999998 28.585 20.96 80-84 23.125 28.294999999999998 27.47 21.11 85-89 23.845 27.644999999999996 27.93 20.580000000000002 90-94 23.015 28.455000000000002 28.165000000000003 20.365 95-99 23.965 27.97 27.915 20.150000000000002 100-104 24.42 27.185 28.105000000000004 20.29 105-109 24.099999999999998 27.644999999999996 27.915 20.34 110-114 24.205 28.599999999999998 27.015 20.18 115-119 23.78 28.22 27.250000000000004 20.75 120-124 23.805 28.485 27.265 20.445 125-129 24.654999999999998 28.035 26.884999999999998 20.424999999999997 130-134 25.025 27.894999999999996 27.38 19.7 135-139 24.685000000000002 27.98 27.700000000000003 19.634999999999998 140-144 24.125 28.655 27.544999999999998 19.675 145-149 24.987498749874987 27.502750275027505 27.432743274327432 20.07700770077008 150-151 25.162499999999998 26.85 28.6375 19.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 1.5 23 4.0 24 5.5 25 4.5 26 6.0 27 6.5 28 11.0 29 14.0 30 20.0 31 27.5 32 36.5 33 46.0 34 54.0 35 83.0 36 110.5 37 120.0 38 141.0 39 173.5 40 187.0 41 203.0 42 234.0 43 261.0 44 270.5 45 260.0 46 267.5 47 257.5 48 212.0 49 188.0 50 162.0 51 127.0 52 113.5 53 88.5 54 65.5 55 53.0 56 41.5 57 38.5 58 28.5 59 19.0 60 14.5 61 9.5 62 7.5 63 5.5 64 1.0 65 1.5 66 2.0 67 2.5 68 2.0 69 1.5 70 2.5 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.15 #Duplication Level Percentage of deduplicated Percentage of total 1 87.02843876958792 74.97500000000001 2 10.388856645385955 17.9 3 2.176436448055717 5.625 4 0.3482298316889147 1.2 5 0.02901915264074289 0.125 6 0.0 0.0 7 0.02901915264074289 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACAAACAAGACCAGCAAAAACCAGGACAAAAAAGTTCAAGAATGGCCAC 7 0.17500000000000002 No Hit CGTTAAGAGGAAAAGTGCTGCTCTTCAAATGCAACAATTTGTTGGTGAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15000000000000002 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.1125 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.6375 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.4625 0.0 0.0 0.0 0.0 116-117 2.6 0.0 0.0 0.0 0.0 118-119 2.825 0.0 0.0 0.0 0.0 120-121 3.2 0.0 0.0 0.0 0.0 122-123 3.4000000000000004 0.0 0.0 0.0 0.0 124-125 3.675 0.0 0.0 0.0 0.0 126-127 3.975 0.0 0.0 0.0 0.0 128-129 4.375 0.0 0.0 0.0 0.0 130-131 4.6 0.0 0.0 0.0 0.0 132-133 5.1625 0.0 0.0 0.0 0.0 134-135 5.637499999999999 0.0 0.0 0.0 0.0 136-137 6.0875 0.0 0.0 0.0 0.0 138-139 6.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCAGA 10 0.006830828 145.0 5 GAGTTCA 10 0.006830828 145.0 3 CAGAGAG 10 0.006830828 145.0 8 TCAGAGA 10 0.006830828 145.0 7 AGAGAGC 10 0.006830828 145.0 9 TTCAGAG 10 0.006830828 145.0 6 AGTTCAG 10 0.006830828 145.0 4 GGAGTTC 10 0.006830828 145.0 2 >>END_MODULE Read 1066101 spots for SRR12671385.sra Written 1066101 spots for SRR12671385.sra Read 1066101 spots for SRR12671385.sra Written 1066101 spots for SRR12671385.sra Read 1066101 spots for SRR12671385.sra Written 1066101 spots for SRR12671385.sra Read 1066101 spots for SRR12671385.sra Written 1066101 spots for SRR12671385.sra Read 1066101 spots for SRR12671385.sra Written 1066101 spots for SRR12671385.sra Read 1066101 spots for SRR12671385.sra Written 1066101 spots for SRR12671385.sra Read 1066106 spots for SRR12671385.sra Written 1066106 spots for SRR12671385.sra Read 1066101 spots for SRR12671385.sra Written 1066101 spots for SRR12671385.sra Read 1066101 spots for SRR12671385.sra Written 1066101 spots for SRR12671385.sra Read 1066101 spots for SRR12671385.sra Written 1066101 spots for SRR12671385.sra Read 1066101 spots for SRR12671385.sra Written 1066101 spots for SRR12671385.sra Read 1066101 spots for SRR12671385.sra Written 1066101 spots for SRR12671385.sra Read 1066101 spots for SRR12671385.sra Written 1066101 spots for SRR12671385.sra Read 1066101 spots for SRR12671385.sra Written 1066101 spots for SRR12671385.sra Read 1066101 spots for SRR12671385.sra Written 1066101 spots for SRR12671385.sra Read 1066101 spots for SRR12671385.sra Written 1066101 spots for SRR12671385.sra Read 1066101 spots for SRR12671385.sra Written 1066101 spots for SRR12671385.sra Read 1066101 spots for SRR12671385.sra Written 1066101 spots for SRR12671385.sra Read 1066101 spots for SRR12671385.sra Written 1066101 spots for SRR12671385.sra Read 1066101 spots for SRR12671385.sra Written 1066101 spots for SRR12671385.sra SRR ids: ['SRR12671385.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8igedb9e SRR12671385.sra spots: 21322025 blocks: [[1, 1066101], [1066102, 2132202], [2132203, 3198303], [3198304, 4264404], [4264405, 5330505], [5330506, 6396606], [6396607, 7462707], [7462708, 8528808], [8528809, 9594909], [9594910, 10661010], [10661011, 11727111], [11727112, 12793212], [12793213, 13859313], [13859314, 14925414], [14925415, 15991515], [15991516, 17057616], [17057617, 18123717], [18123718, 19189818], [19189819, 20255919], [20255920, 21322025]] SRR12671385 file size 7224456 SRR12671385 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671385 SRR12671385_1.fastq SRR12671385_2.fastq Input file: SRR12671385_1.fastq Paired file: SRR12671385_2.fastq trimmed: SRR12671385-trimmed-pair1.fastq, SRR12671385-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 20:56:44 2025 >> started Tue Feb 11 20:57:08 2025 >> done (24.667s) 21322025 read pairs processed; of these: 51 ( 0.00%) short read pairs filtered out after trimming by size control 3043 ( 0.01%) empty read pairs filtered out after trimming by size control 21318931 (99.99%) read pairs available; of these: 2028758 ( 9.52%) trimmed read pairs available after processing 19290173 (90.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 7 0.00% 21 5 0.00% 22 7 0.00% 23 5 0.00% 24 13 0.00% 25 10 0.00% 26 17 0.00% 27 11 0.00% 28 9 0.00% 29 13 0.00% 30 13 0.00% 31 13 0.00% 32 21 0.00% 33 25 0.00% 34 24 0.00% 35 32 0.00% 36 22 0.00% 37 17 0.00% 38 21 0.00% 39 24 0.00% 40 33 0.00% 41 35 0.00% 42 46 0.00% 43 32 0.00% 44 55 0.00% 45 31 0.00% 46 38 0.00% 47 47 0.00% 48 56 0.00% 49 63 0.00% 50 85 0.00% 51 90 0.00% 52 127 0.00% 53 99 0.00% 54 128 0.00% 55 141 0.00% 56 181 0.00% 57 188 0.00% 58 189 0.00% 59 241 0.00% 60 300 0.00% 61 309 0.00% 62 347 0.00% 63 393 0.00% 64 444 0.00% 65 489 0.00% 66 578 0.00% 67 684 0.00% 68 782 0.00% 69 890 0.00% 70 1057 0.00% 71 1172 0.01% 72 1331 0.01% 73 1476 0.01% 74 1718 0.01% 75 1911 0.01% 76 2198 0.01% 77 2365 0.01% 78 2604 0.01% 79 2772 0.01% 80 3111 0.01% 81 3429 0.02% 82 3931 0.02% 83 4278 0.02% 84 4688 0.02% 85 5298 0.02% 86 5621 0.03% 87 6045 0.03% 88 6539 0.03% 89 7056 0.03% 90 7342 0.03% 91 8002 0.04% 92 8433 0.04% 93 9111 0.04% 94 9834 0.05% 95 10760 0.05% 96 11271 0.05% 97 12117 0.06% 98 12454 0.06% 99 12994 0.06% 100 13872 0.07% 101 14145 0.07% 102 14957 0.07% 103 15680 0.07% 104 16608 0.08% 105 17433 0.08% 106 18268 0.09% 107 19059 0.09% 108 19878 0.09% 109 20712 0.10% 110 21143 0.10% 111 22313 0.10% 112 23200 0.11% 113 23855 0.11% 114 24516 0.11% 115 26149 0.12% 116 27266 0.13% 117 28294 0.13% 118 29291 0.14% 119 29952 0.14% 120 30680 0.14% 121 31544 0.15% 122 32198 0.15% 123 33403 0.16% 124 34930 0.16% 125 35245 0.17% 126 36812 0.17% 127 38072 0.18% 128 38933 0.18% 129 39555 0.19% 130 40881 0.19% 131 41579 0.20% 132 42686 0.20% 133 44326 0.21% 134 43860 0.21% 135 45688 0.21% 136 46762 0.22% 137 47520 0.22% 138 48864 0.23% 139 50665 0.24% 140 51738 0.24% 141 52547 0.25% 142 53202 0.25% 143 53565 0.25% 144 55269 0.26% 145 55597 0.26% 146 57085 0.27% 147 58111 0.27% 148 60057 0.28% 149 60307 0.28% 150 62130 0.29% 151 19290173 90.48% 21318931 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=23 prefix-density=0.33 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=92.23 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.5 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=28 prefix-density=0.80 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=70.35 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=15.4 sequence=AAGAAAACAGATTATCAAGCTTACTAGAATTATGGAAGGAATGAGTGTGGAGAACATGCACAAGATAGTGGTGGCAGTGGATGAGAGTGAGGAGAGCATGCATGCTCTTTCATGGTGTCTCAGCAACCTTATTTCTCACAACTCCACCGCCACGTTAGTCCTCCTCTAT SRR12671385 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 20:57:53 Started mapping on | Feb 11 20:57:53 Finished on | Feb 11 21:00:15 Mapping speed, Million of reads per hour | 540.48 Number of input reads | 21318931 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 19893305 Uniquely mapped reads % | 93.31% Average mapped length | 296.06 Number of splices: Total | 19414942 Number of splices: Annotated (sjdb) | 18944285 Number of splices: GT/AG | 19038241 Number of splices: GC/AG | 297094 Number of splices: AT/AC | 12333 Number of splices: Non-canonical | 67274 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.03% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 541236 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 167606 % of reads mapped to too many loci | 0.79% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.18% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 884390 884390 884390 N_multimapping 541236 541236 541236 N_noFeature 882556 19595956 991221 N_ambiguous 321555 1320 132176 UnstrandedReadsAssigned:18689194 PositiveStrandReadsAssigned:296029 NegativeStrandReadsAssigned:18769908 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671385 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671385-trimmed-pair1.fastq SRR12671385-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,318,931 reads, 18,763,555 reads pseudoaligned [quant] estimated average fragment length: 265.817 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 988 rounds 52401 SRR12671385.ke.tsv 34699 SRR12671385.se.tsv 87100 total ==> SRR12671385.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.18 954 26.782 Potri.005G024800.1.v4.1 1035 770.183 359 22.9416 Potri.004G059700.1.v4.1 961 696.48 0 0 Potri.007G009000.2.v4.1 1416 1151.18 0 0 Potri.003G141000.2.v4.1 2943 2678.18 1132.27 20.8082 Potri.016G087400.1.v4.1 270 84.1302 1054 616.611 Potri.015G069301.1.v4.1 564 316.247 0 0 Potri.010G195200.1.v4.1 1773 1508.18 256 8.35427 Potri.012G127500.1.v4.1 977 712.315 68 4.6985 ==> SRR12671385.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 190 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 269 Potri.001G212900.v4.1 14 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12671385 completed mapping pipeline successfully