Starting /dee2/code/volunteer_pipeline.sh SRR12671387 current disk space = 3052610752512 free memory = 1510735736 SRR12671387 SRAfilesize 37f252e9d12ccecf4e98a548e54c69d7 SRR12671387.sra SRR12671387.sra file validated SRR12671387 is paired end SRR12671387 is conventional basespace SRR12671387 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671387_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5285 37.0 37.0 37.0 37.0 37.0 2 36.376 37.0 37.0 37.0 37.0 37.0 3 36.554 37.0 37.0 37.0 37.0 37.0 4 36.6445 37.0 37.0 37.0 37.0 37.0 5 36.601 37.0 37.0 37.0 37.0 37.0 6 36.6105 37.0 37.0 37.0 37.0 37.0 7 36.568 37.0 37.0 37.0 37.0 37.0 8 36.6235 37.0 37.0 37.0 37.0 37.0 9 36.5775 37.0 37.0 37.0 37.0 37.0 10-14 36.6296 37.0 37.0 37.0 37.0 37.0 15-19 36.548199999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.5663 37.0 37.0 37.0 37.0 37.0 25-29 36.5369 37.0 37.0 37.0 37.0 37.0 30-34 36.4971 37.0 37.0 37.0 37.0 37.0 35-39 36.4763 37.0 37.0 37.0 37.0 37.0 40-44 36.4573 37.0 37.0 37.0 37.0 37.0 45-49 36.4311 37.0 37.0 37.0 37.0 37.0 50-54 36.4388 37.0 37.0 37.0 37.0 37.0 55-59 36.4114 37.0 37.0 37.0 37.0 37.0 60-64 36.3571 37.0 37.0 37.0 37.0 37.0 65-69 36.3747 37.0 37.0 37.0 37.0 37.0 70-74 36.3455 37.0 37.0 37.0 37.0 37.0 75-79 36.3144 37.0 37.0 37.0 37.0 37.0 80-84 36.3207 37.0 37.0 37.0 37.0 37.0 85-89 36.2548 37.0 37.0 37.0 37.0 37.0 90-94 36.31230000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.1828 37.0 37.0 37.0 37.0 37.0 100-104 36.249900000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.216 37.0 37.0 37.0 37.0 37.0 110-114 36.14829999999999 37.0 37.0 37.0 37.0 37.0 115-119 36.14659999999999 37.0 37.0 37.0 37.0 37.0 120-124 36.0969 37.0 37.0 37.0 37.0 37.0 125-129 36.0565 37.0 37.0 37.0 37.0 37.0 130-134 36.0269 37.0 37.0 37.0 37.0 37.0 135-139 35.9831 37.0 37.0 37.0 37.0 37.0 140-144 35.910399999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.8601 37.0 37.0 37.0 37.0 37.0 150-151 35.747 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 4.0 24 0.0 25 5.0 26 3.0 27 6.0 28 6.0 29 16.0 30 24.0 31 35.0 32 49.0 33 65.0 34 116.0 35 265.0 36 2943.0 37 460.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.0 10.85 6.2 39.95 2 20.80200501253133 11.278195488721805 37.042606516290725 30.87719298245614 3 18.275 16.825000000000003 26.200000000000003 38.7 4 23.125 23.65 22.900000000000002 30.325000000000003 5 23.674999999999997 31.025000000000002 23.974999999999998 21.325 6 18.65 33.800000000000004 25.2 22.35 7 14.649999999999999 26.224999999999998 42.475 16.650000000000002 8 16.25 25.5 34.425 23.825 9 18.3 23.849999999999998 34.300000000000004 23.549999999999997 10-14 19.085 30.195 28.04 22.68 15-19 19.21 28.349999999999998 28.18 24.26 20-24 19.96 28.89 27.87 23.28 25-29 19.345000000000002 29.044999999999998 28.285 23.325000000000003 30-34 19.755 28.305000000000003 28.155 23.785 35-39 19.35 28.634999999999998 28.365000000000002 23.65 40-44 20.315 29.160000000000004 27.425 23.1 45-49 19.73 28.895 28.22 23.155 50-54 19.715 28.18 28.775000000000002 23.330000000000002 55-59 20.4 28.955 27.015 23.630000000000003 60-64 20.325 28.32 27.96 23.395 65-69 20.41 28.67 27.76 23.16 70-74 19.84 28.904999999999998 27.455000000000002 23.799999999999997 75-79 20.805 27.975 27.445000000000004 23.775 80-84 19.98 28.615000000000002 27.150000000000002 24.255 85-89 20.064999999999998 28.845 28.04 23.05 90-94 20.53 28.32 26.779999999999998 24.37 95-99 20.31 28.21 28.299999999999997 23.18 100-104 19.950000000000003 28.565 27.834999999999997 23.65 105-109 20.119999999999997 28.325 27.82 23.735 110-114 20.78 28.575 27.05 23.595 115-119 20.74 27.625 27.435 24.2 120-124 20.244999999999997 28.000000000000004 26.979999999999997 24.775 125-129 20.985 27.245 28.005000000000003 23.765 130-134 20.955 27.985 27.515 23.544999999999998 135-139 20.735 28.43 27.134999999999998 23.7 140-144 20.565 27.845 27.54 24.05 145-149 21.13 27.755000000000003 27.115000000000002 24.0 150-151 20.575 28.125 26.937499999999996 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.5 3 1.0 4 0.5 5 0.0 6 1.0 7 1.5 8 1.0 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 2.5 20 0.5 21 0.0 22 0.5 23 1.5 24 4.0 25 8.0 26 10.5 27 12.5 28 15.0 29 16.0 30 21.5 31 38.0 32 43.0 33 44.5 34 58.0 35 75.5 36 96.5 37 116.5 38 137.0 39 148.5 40 167.0 41 203.0 42 220.5 43 226.0 44 253.5 45 260.5 46 259.0 47 249.0 48 222.5 49 211.0 50 186.5 51 136.0 52 100.0 53 96.5 54 84.0 55 62.0 56 51.0 57 44.5 58 30.0 59 19.5 60 14.0 61 11.0 62 9.0 63 6.0 64 4.5 65 1.5 66 0.5 67 2.5 68 2.5 69 2.5 70 2.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.175 #Duplication Level Percentage of deduplicated Percentage of total 1 84.76388476388476 71.35000000000001 2 12.384912384912385 20.849999999999998 3 2.197802197802198 5.55 4 0.594000594000594 2.0 5 0.05940005940005939 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATAGCTCCGAGCCTCAACGGAATCAAGACCAAGCACAATAATACTAAAAT 5 0.125 No Hit CCAAGAGAATCCCTGACTGTGGTAAAAAGCCGTGAATTTATGATCTCAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.5499999999999998 0.0 0.0 0.0 0.0 114-115 1.7375 0.0 0.0 0.0 0.0 116-117 1.8250000000000002 0.0 0.0 0.0 0.0 118-119 1.95 0.0 0.0 0.0 0.0 120-121 2.175 0.0 0.0 0.0 0.0 122-123 2.425 0.0 0.0 0.0 0.0 124-125 2.5999999999999996 0.0 0.0 0.0 0.0 126-127 2.7375 0.0 0.0 0.0 0.0 128-129 2.95 0.0 0.0 0.0 0.0 130-131 3.125 0.0 0.0 0.0 0.0 132-133 3.4 0.0 0.0 0.0 0.0 134-135 3.5875 0.0 0.0 0.0 0.0 136-137 3.8875 0.0 0.0 0.0 0.0 138-139 4.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAGAAA 10 0.006830828 145.0 6 CATAAAA 10 0.006830828 145.0 5 >>END_MODULE SRR12671387 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671387_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.253 37.0 37.0 37.0 37.0 37.0 2 35.8915 37.0 37.0 37.0 37.0 37.0 3 36.073 37.0 37.0 37.0 37.0 37.0 4 36.1435 37.0 37.0 37.0 37.0 37.0 5 36.159 37.0 37.0 37.0 37.0 37.0 6 36.206 37.0 37.0 37.0 37.0 37.0 7 36.1675 37.0 37.0 37.0 37.0 37.0 8 36.1375 37.0 37.0 37.0 37.0 37.0 9 36.179 37.0 37.0 37.0 37.0 37.0 10-14 36.2174 37.0 37.0 37.0 37.0 37.0 15-19 36.225500000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.1691 37.0 37.0 37.0 37.0 37.0 25-29 36.1798 37.0 37.0 37.0 37.0 37.0 30-34 36.171800000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.112 37.0 37.0 37.0 37.0 37.0 40-44 36.0911 37.0 37.0 37.0 37.0 37.0 45-49 36.0865 37.0 37.0 37.0 37.0 37.0 50-54 36.0615 37.0 37.0 37.0 37.0 37.0 55-59 35.989999999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.0034 37.0 37.0 37.0 37.0 37.0 65-69 35.9859 37.0 37.0 37.0 37.0 37.0 70-74 35.9358 37.0 37.0 37.0 37.0 37.0 75-79 35.9172 37.0 37.0 37.0 37.0 37.0 80-84 35.827999999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.890100000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.8771 37.0 37.0 37.0 37.0 37.0 95-99 35.804399999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.7623 37.0 37.0 37.0 37.0 37.0 105-109 35.72859999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.6991 37.0 37.0 37.0 37.0 37.0 115-119 35.7444 37.0 37.0 37.0 37.0 37.0 120-124 35.7255 37.0 37.0 37.0 37.0 37.0 125-129 35.6308 37.0 37.0 37.0 37.0 37.0 130-134 35.5731 37.0 37.0 37.0 37.0 37.0 135-139 35.5403 37.0 37.0 37.0 37.0 37.0 140-144 35.5316 37.0 37.0 37.0 37.0 37.0 145-149 35.44970000000001 37.0 37.0 37.0 34.6 37.0 150-151 35.1905 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 4.0 21 1.0 22 9.0 23 2.0 24 5.0 25 7.0 26 9.0 27 16.0 28 9.0 29 22.0 30 16.0 31 34.0 32 49.0 33 102.0 34 213.0 35 607.0 36 2681.0 37 207.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.85 24.325 9.975000000000001 25.85 2 28.000000000000004 25.525 31.05 15.425 3 20.5 26.325 33.675 19.5 4 23.525 33.5 23.724999999999998 19.25 5 26.8 36.5 21.575 15.125 6 19.125 41.275 21.475 18.125 7 20.225 22.325 39.15 18.3 8 20.7 25.8 29.325000000000003 24.175 9 23.25 22.95 30.75 23.05 10-14 23.235 29.13 26.805 20.830000000000002 15-19 23.115 28.64 27.205000000000002 21.04 20-24 22.775000000000002 28.21 27.655 21.36 25-29 23.375 27.705000000000002 28.32 20.599999999999998 30-34 23.150000000000002 28.294999999999998 28.199999999999996 20.355 35-39 23.07 27.67 27.515 21.745 40-44 22.905 28.025 28.134999999999998 20.935000000000002 45-49 22.625 27.66 28.26 21.455 50-54 23.13 28.375 27.85 20.645 55-59 23.5 27.900000000000002 27.185 21.415 60-64 23.7 28.275 27.045 20.979999999999997 65-69 23.935000000000002 27.544999999999998 27.584999999999997 20.935000000000002 70-74 23.665 27.900000000000002 27.794999999999998 20.64 75-79 23.45 27.49 28.22 20.84 80-84 23.94 27.779999999999998 27.255000000000003 21.025 85-89 23.494999999999997 28.01 27.735 20.76 90-94 24.005000000000003 28.765 26.745 20.485 95-99 23.990000000000002 28.389999999999997 27.115000000000002 20.505000000000003 100-104 24.25 27.634999999999998 27.084999999999997 21.029999999999998 105-109 23.655 27.42 28.110000000000003 20.815 110-114 23.705000000000002 28.349999999999998 27.35 20.595 115-119 23.494999999999997 28.515 27.51 20.48 120-124 24.32 27.87 27.625 20.185 125-129 24.6 27.925 27.345000000000002 20.13 130-134 24.060000000000002 27.905 27.694999999999997 20.34 135-139 24.240000000000002 27.169999999999998 28.144999999999996 20.445 140-144 24.785 28.01 27.375 19.830000000000002 145-149 24.852485248524854 28.822882288228826 26.102610261026104 20.22202220222022 150-151 23.962500000000002 28.975 26.8125 20.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 1.0 10 1.5 11 1.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.5 23 2.5 24 2.5 25 3.5 26 5.0 27 8.5 28 14.0 29 15.5 30 18.0 31 26.0 32 41.0 33 41.5 34 46.0 35 68.5 36 85.0 37 112.5 38 139.5 39 169.5 40 190.5 41 204.5 42 213.5 43 232.5 44 271.5 45 258.0 46 235.5 47 252.5 48 242.0 49 204.0 50 168.0 51 129.0 52 104.5 53 92.0 54 81.5 55 70.5 56 56.0 57 42.5 58 33.5 59 28.5 60 24.5 61 20.5 62 13.0 63 6.0 64 3.5 65 1.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.65 #Duplication Level Percentage of deduplicated Percentage of total 1 85.17424689899586 72.1 2 12.226816302421737 20.7 3 2.008269344359126 5.1 4 0.5020673360897815 1.7000000000000002 5 0.05906674542232723 0.25 6 0.029533372711163616 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit TGATGAGAGAGCATGTGCATATATTGCTGGTCCTGCACCAAATCGTTGGG 5 0.125 No Hit GCAACCTCGTAGACAGAGATTAGATTGACATGGCAGACTCTACAGTCCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.38749999999999996 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7875 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.7125 0.0 0.0 0.0 0.0 116-117 1.7999999999999998 0.0 0.0 0.0 0.0 118-119 1.925 0.0 0.0 0.0 0.0 120-121 2.1500000000000004 0.0 0.0 0.0 0.0 122-123 2.45 0.0 0.0 0.0 0.0 124-125 2.625 0.0 0.0 0.0 0.0 126-127 2.7625 0.0 0.0 0.0 0.0 128-129 2.975 0.0 0.0 0.0 0.0 130-131 3.1500000000000004 0.0 0.0 0.0 0.0 132-133 3.425 0.0 0.0 0.0 0.0 134-135 3.5625 0.0 0.0 0.0 0.0 136-137 3.8625 0.0 0.0 0.0 0.0 138-139 4.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 860704 spots for SRR12671387.sra Written 860704 spots for SRR12671387.sra Read 860704 spots for SRR12671387.sra Written 860704 spots for SRR12671387.sra Read 860704 spots for SRR12671387.sra Written 860704 spots for SRR12671387.sra Read 860704 spots for SRR12671387.sra Written 860704 spots for SRR12671387.sra Read 860704 spots for SRR12671387.sra Written 860704 spots for SRR12671387.sra Read 860704 spots for SRR12671387.sra Written 860704 spots for SRR12671387.sra Read 860704 spots for SRR12671387.sra Written 860704 spots for SRR12671387.sra Read 860704 spots for SRR12671387.sra Written 860704 spots for SRR12671387.sra Read 860704 spots for SRR12671387.sra Written 860704 spots for SRR12671387.sra Read 860704 spots for SRR12671387.sra Written 860704 spots for SRR12671387.sra Read 860704 spots for SRR12671387.sra Written 860704 spots for SRR12671387.sra Read 860704 spots for SRR12671387.sra Written 860704 spots for SRR12671387.sra Read 860704 spots for SRR12671387.sra Written 860704 spots for SRR12671387.sra Read 860704 spots for SRR12671387.sra Written 860704 spots for SRR12671387.sra Read 860704 spots for SRR12671387.sra Written 860704 spots for SRR12671387.sra Read 860704 spots for SRR12671387.sra Written 860704 spots for SRR12671387.sra Read 860704 spots for SRR12671387.sra Written 860704 spots for SRR12671387.sra Read 860704 spots for SRR12671387.sra Written 860704 spots for SRR12671387.sra Read 860704 spots for SRR12671387.sra Written 860704 spots for SRR12671387.sra Read 860709 spots for SRR12671387.sra Written 860709 spots for SRR12671387.sra SRR ids: ['SRR12671387.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nq4u4cjw SRR12671387.sra spots: 17214085 blocks: [[1, 860704], [860705, 1721408], [1721409, 2582112], [2582113, 3442816], [3442817, 4303520], [4303521, 5164224], [5164225, 6024928], [6024929, 6885632], [6885633, 7746336], [7746337, 8607040], [8607041, 9467744], [9467745, 10328448], [10328449, 11189152], [11189153, 12049856], [12049857, 12910560], [12910561, 13771264], [13771265, 14631968], [14631969, 15492672], [15492673, 16353376], [16353377, 17214085]] SRR12671387 file size 5828398 SRR12671387 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671387 SRR12671387_1.fastq SRR12671387_2.fastq Input file: SRR12671387_1.fastq Paired file: SRR12671387_2.fastq trimmed: SRR12671387-trimmed-pair1.fastq, SRR12671387-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:32:59 2025 >> started Tue Feb 11 21:33:18 2025 >> done (18.924s) 17214085 read pairs processed; of these: 37 ( 0.00%) short read pairs filtered out after trimming by size control 2649 ( 0.02%) empty read pairs filtered out after trimming by size control 17211399 (99.98%) read pairs available; of these: 910183 ( 5.29%) trimmed read pairs available after processing 16301216 (94.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 4 0.00% 21 6 0.00% 22 4 0.00% 23 7 0.00% 24 5 0.00% 25 5 0.00% 26 5 0.00% 27 7 0.00% 28 12 0.00% 29 7 0.00% 30 12 0.00% 31 10 0.00% 32 14 0.00% 33 14 0.00% 34 12 0.00% 35 18 0.00% 36 18 0.00% 37 22 0.00% 38 28 0.00% 39 17 0.00% 40 22 0.00% 41 25 0.00% 42 22 0.00% 43 32 0.00% 44 29 0.00% 45 33 0.00% 46 43 0.00% 47 40 0.00% 48 39 0.00% 49 44 0.00% 50 67 0.00% 51 75 0.00% 52 72 0.00% 53 80 0.00% 54 89 0.00% 55 71 0.00% 56 109 0.00% 57 113 0.00% 58 148 0.00% 59 125 0.00% 60 187 0.00% 61 159 0.00% 62 212 0.00% 63 278 0.00% 64 287 0.00% 65 261 0.00% 66 320 0.00% 67 356 0.00% 68 391 0.00% 69 455 0.00% 70 543 0.00% 71 633 0.00% 72 705 0.00% 73 859 0.00% 74 907 0.01% 75 992 0.01% 76 1083 0.01% 77 1211 0.01% 78 1312 0.01% 79 1533 0.01% 80 1586 0.01% 81 1804 0.01% 82 1933 0.01% 83 2121 0.01% 84 2469 0.01% 85 2637 0.02% 86 3024 0.02% 87 3105 0.02% 88 3326 0.02% 89 3555 0.02% 90 3686 0.02% 91 3932 0.02% 92 4305 0.03% 93 4596 0.03% 94 4970 0.03% 95 5236 0.03% 96 5634 0.03% 97 5791 0.03% 98 6143 0.04% 99 6527 0.04% 100 6696 0.04% 101 6863 0.04% 102 7223 0.04% 103 7483 0.04% 104 7900 0.05% 105 8225 0.05% 106 8652 0.05% 107 9075 0.05% 108 9358 0.05% 109 9592 0.06% 110 9756 0.06% 111 10333 0.06% 112 10417 0.06% 113 10713 0.06% 114 11383 0.07% 115 11550 0.07% 116 12257 0.07% 117 12523 0.07% 118 13018 0.08% 119 13168 0.08% 120 13644 0.08% 121 13992 0.08% 122 14229 0.08% 123 14601 0.08% 124 15043 0.09% 125 15025 0.09% 126 16230 0.09% 127 16529 0.10% 128 16917 0.10% 129 17235 0.10% 130 18068 0.10% 131 17981 0.10% 132 18388 0.11% 133 19060 0.11% 134 18917 0.11% 135 19478 0.11% 136 20079 0.12% 137 20371 0.12% 138 21292 0.12% 139 21982 0.13% 140 22420 0.13% 141 23051 0.13% 142 23563 0.14% 143 23848 0.14% 144 24249 0.14% 145 24248 0.14% 146 25139 0.15% 147 25537 0.15% 148 26965 0.16% 149 27032 0.16% 150 28314 0.16% 151 16301216 94.71% 17211399 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=23 prefix-density=0.48 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.19 sequence-density-rank=17 fanout-score=13.05 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=6.4 sequence=TTCTTTCCAATGCT criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=26 prefix-density=0.77 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=41.01 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.3 sequence=TGGCCATGTAAAACACAATATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCTTATCCATGGCAGCTCGAGAATTGGTCGACTATGGAAAAGATAGCGTTACCGTCAATATCCCATCAACTGGCGATGTATCATCTAGAAGCCAGCCTCCTACCTATGCCCCACGAACTGGCAGTGGAT SRR12671387 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:34:01 Started mapping on | Feb 11 21:34:02 Finished on | Feb 11 21:36:08 Mapping speed, Million of reads per hour | 491.75 Number of input reads | 17211399 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 15951170 Uniquely mapped reads % | 92.68% Average mapped length | 297.98 Number of splices: Total | 15968013 Number of splices: Annotated (sjdb) | 15643021 Number of splices: GT/AG | 15656394 Number of splices: GC/AG | 255215 Number of splices: AT/AC | 8762 Number of splices: Non-canonical | 47642 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430809 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 123972 % of reads mapped to too many loci | 0.72% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.93% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 829420 829420 829420 N_multimapping 430809 430809 430809 N_noFeature 606265 15679129 685195 N_ambiguous 304805 1388 111194 UnstrandedReadsAssigned:15040100 PositiveStrandReadsAssigned:270653 NegativeStrandReadsAssigned:15154781 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671387 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671387-trimmed-pair1.fastq SRR12671387-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,211,399 reads, 15,121,967 reads pseudoaligned [quant] estimated average fragment length: 285.439 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR12671387.ke.tsv 34699 SRR12671387.se.tsv 87100 total ==> SRR12671387.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1733.56 678 20.9286 Potri.005G024800.1.v4.1 1035 750.561 465 33.1525 Potri.004G059700.1.v4.1 961 676.632 0 0 Potri.007G009000.2.v4.1 1416 1131.56 0 0 Potri.003G141000.2.v4.1 2943 2658.56 985.248 19.8312 Potri.016G087400.1.v4.1 270 71.0803 1114.76 839.23 Potri.015G069301.1.v4.1 564 292.426 0 0 Potri.010G195200.1.v4.1 1773 1488.56 425 15.2782 Potri.012G127500.1.v4.1 977 692.591 77 5.94927 ==> SRR12671387.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 89 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 273 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12671387 completed mapping pipeline successfully