Starting /dee2/code/volunteer_pipeline.sh SRR12671388 current disk space = 3053057683456 free memory = 1455105224 SRR12671388 SRAfilesize c54aec2339181448880a843c03e34923 SRR12671388.sra SRR12671388.sra file validated SRR12671388 is paired end SRR12671388 is conventional basespace SRR12671388 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671388_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.62 37.0 37.0 37.0 37.0 37.0 2 36.263 37.0 37.0 37.0 37.0 37.0 3 36.503 37.0 37.0 37.0 37.0 37.0 4 36.5815 37.0 37.0 37.0 37.0 37.0 5 36.6325 37.0 37.0 37.0 37.0 37.0 6 36.633 37.0 37.0 37.0 37.0 37.0 7 36.509 37.0 37.0 37.0 37.0 37.0 8 36.5635 37.0 37.0 37.0 37.0 37.0 9 36.6475 37.0 37.0 37.0 37.0 37.0 10-14 36.6041 37.0 37.0 37.0 37.0 37.0 15-19 36.5846 37.0 37.0 37.0 37.0 37.0 20-24 36.55890000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.5505 37.0 37.0 37.0 37.0 37.0 30-34 36.5178 37.0 37.0 37.0 37.0 37.0 35-39 36.4616 37.0 37.0 37.0 37.0 37.0 40-44 36.4731 37.0 37.0 37.0 37.0 37.0 45-49 36.4617 37.0 37.0 37.0 37.0 37.0 50-54 36.3969 37.0 37.0 37.0 37.0 37.0 55-59 36.4277 37.0 37.0 37.0 37.0 37.0 60-64 36.342999999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.346999999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.28000000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.254 37.0 37.0 37.0 37.0 37.0 80-84 36.3099 37.0 37.0 37.0 37.0 37.0 85-89 36.2413 37.0 37.0 37.0 37.0 37.0 90-94 36.239799999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.1999 37.0 37.0 37.0 37.0 37.0 100-104 36.161699999999996 37.0 37.0 37.0 37.0 37.0 105-109 36.162499999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.0751 37.0 37.0 37.0 37.0 37.0 115-119 36.0758 37.0 37.0 37.0 37.0 37.0 120-124 36.0769 37.0 37.0 37.0 37.0 37.0 125-129 36.053000000000004 37.0 37.0 37.0 37.0 37.0 130-134 36.0492 37.0 37.0 37.0 37.0 37.0 135-139 35.9676 37.0 37.0 37.0 37.0 37.0 140-144 35.8725 37.0 37.0 37.0 37.0 37.0 145-149 35.9088 37.0 37.0 37.0 37.0 37.0 150-151 35.724000000000004 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 3.0 21 4.0 22 0.0 23 2.0 24 5.0 25 6.0 26 5.0 27 4.0 28 12.0 29 19.0 30 18.0 31 30.0 32 47.0 33 63.0 34 122.0 35 250.0 36 2944.0 37 466.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 55.925000000000004 11.525 4.95 27.6 2 20.707831325301203 11.119477911646586 35.6425702811245 32.53012048192771 3 18.65 17.525 28.4 35.425000000000004 4 21.55 23.25 27.05 28.15 5 23.425 30.75 24.275 21.55 6 19.825 33.324999999999996 24.825 22.025 7 14.075 27.125 43.2 15.6 8 15.25 25.85 34.55 24.349999999999998 9 15.65 23.425 36.449999999999996 24.474999999999998 10-14 19.085 30.865 28.01 22.040000000000003 15-19 20.325 28.565 27.200000000000003 23.91 20-24 19.794999999999998 28.735 28.165000000000003 23.305 25-29 19.75 28.735 27.744999999999997 23.77 30-34 19.555 28.605000000000004 28.115000000000002 23.724999999999998 35-39 19.895 28.4 27.485 24.22 40-44 20.365 28.965000000000003 27.279999999999998 23.39 45-49 21.105 29.049999999999997 26.805 23.04 50-54 19.59 28.845 27.97 23.595 55-59 20.03 28.645 27.905 23.419999999999998 60-64 20.125 28.505000000000003 27.54 23.830000000000002 65-69 20.555 28.294999999999998 27.175 23.974999999999998 70-74 21.165 28.065 27.224999999999998 23.544999999999998 75-79 20.035 28.435 27.439999999999998 24.09 80-84 19.895 28.595 27.605 23.905 85-89 20.285 27.900000000000002 28.110000000000003 23.705000000000002 90-94 20.005 28.34 27.245 24.41 95-99 20.165 28.544999999999998 27.855 23.435 100-104 20.46 28.37 27.235 23.935000000000002 105-109 20.369999999999997 28.84 27.529999999999998 23.26 110-114 21.135 27.83 28.28 22.755 115-119 20.53 28.34 27.560000000000002 23.57 120-124 20.74 28.105000000000004 27.275 23.880000000000003 125-129 21.695 27.97 26.87 23.465 130-134 20.525 27.82 27.565 24.09 135-139 20.0 28.349999999999998 27.405 24.245 140-144 21.175 27.889999999999997 26.775 24.16 145-149 21.005 28.375 27.075 23.544999999999998 150-151 20.9375 28.425 26.937499999999996 23.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.5 15 1.0 16 0.0 17 0.5 18 0.5 19 0.5 20 1.5 21 1.0 22 1.5 23 2.5 24 2.5 25 4.0 26 9.0 27 14.0 28 14.5 29 21.0 30 28.5 31 30.0 32 33.5 33 45.5 34 58.0 35 70.0 36 78.5 37 87.5 38 101.5 39 128.5 40 166.5 41 201.5 42 229.5 43 256.5 44 284.0 45 286.5 46 277.5 47 253.0 48 226.0 49 214.5 50 183.5 51 138.5 52 118.0 53 106.0 54 89.0 55 68.0 56 44.0 57 29.5 58 21.0 59 17.0 60 13.0 61 10.0 62 8.0 63 5.5 64 3.5 65 2.5 66 1.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.175 #Duplication Level Percentage of deduplicated Percentage of total 1 84.82328482328482 71.39999999999999 2 12.236412236412237 20.599999999999998 3 2.376002376002376 6.0 4 0.44550044550044554 1.5 5 0.11880011880011879 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCCTTCAGGGATAGGCACCTTTACTTGCTGTGCCGCTTGGCCTCCCATC 5 0.125 No Hit GCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGC 5 0.125 No Hit ATGTGATTTAGCAGAATAGAGAAATCACCACGCGACTCAGGATATTTGGA 5 0.125 No Hit GCTCGCATTTTAAGAGAACAATTACAATGCACGACAACTCGAGCACTAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.7375 0.0 0.0 0.0 0.0 118-119 2.1 0.0 0.0 0.0 0.0 120-121 2.3625 0.0 0.0 0.0 0.0 122-123 2.4375 0.0 0.0 0.0 0.0 124-125 2.5375 0.0 0.0 0.0 0.0 126-127 2.6625 0.0 0.0 0.0 0.0 128-129 2.85 0.0 0.0 0.0 0.0 130-131 2.9875 0.0 0.0 0.0 0.0 132-133 3.125 0.0 0.0 0.0 0.0 134-135 3.2875 0.0 0.0 0.0 0.0 136-137 3.55 0.0 0.0 0.0 0.0 138-139 3.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATGGG 10 0.006830828 145.0 8 CCTATCA 10 0.006830828 145.0 3 AATTCTG 10 0.006830828 145.0 3 >>END_MODULE SRR12671388 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671388_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1385 37.0 37.0 37.0 37.0 37.0 2 35.732 37.0 37.0 37.0 37.0 37.0 3 35.777 37.0 37.0 37.0 37.0 37.0 4 36.032 37.0 37.0 37.0 37.0 37.0 5 36.015 37.0 37.0 37.0 37.0 37.0 6 35.9825 37.0 37.0 37.0 37.0 37.0 7 35.887 37.0 37.0 37.0 37.0 37.0 8 35.941 37.0 37.0 37.0 37.0 37.0 9 36.0115 37.0 37.0 37.0 37.0 37.0 10-14 36.0053 37.0 37.0 37.0 37.0 37.0 15-19 36.0006 37.0 37.0 37.0 37.0 37.0 20-24 35.9713 37.0 37.0 37.0 37.0 37.0 25-29 35.8986 37.0 37.0 37.0 37.0 37.0 30-34 35.7967 37.0 37.0 37.0 37.0 37.0 35-39 35.810100000000006 37.0 37.0 37.0 37.0 37.0 40-44 35.7828 37.0 37.0 37.0 37.0 37.0 45-49 35.732299999999995 37.0 37.0 37.0 37.0 37.0 50-54 35.707100000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.6743 37.0 37.0 37.0 37.0 37.0 60-64 35.6005 37.0 37.0 37.0 37.0 37.0 65-69 35.650499999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.6066 37.0 37.0 37.0 37.0 37.0 75-79 35.56420000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.532900000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.5724 37.0 37.0 37.0 37.0 37.0 90-94 35.5201 37.0 37.0 37.0 37.0 37.0 95-99 35.5406 37.0 37.0 37.0 37.0 37.0 100-104 35.472300000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.3979 37.0 37.0 37.0 37.0 37.0 110-114 35.39919999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.411899999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.378600000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.293499999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.320800000000006 37.0 37.0 37.0 34.6 37.0 135-139 35.185500000000005 37.0 37.0 37.0 29.8 37.0 140-144 35.1857 37.0 37.0 37.0 34.6 37.0 145-149 35.200100000000006 37.0 37.0 37.0 32.2 37.0 150-151 34.968999999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 5.0 13 6.0 14 7.0 15 8.0 16 4.0 17 4.0 18 4.0 19 4.0 20 8.0 21 4.0 22 7.0 23 10.0 24 12.0 25 13.0 26 8.0 27 14.0 28 24.0 29 24.0 30 24.0 31 34.0 32 62.0 33 101.0 34 192.0 35 609.0 36 2594.0 37 218.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.4 25.374999999999996 6.550000000000001 19.675 2 27.975 24.425 30.475 17.125 3 22.55 26.924999999999997 32.675 17.849999999999998 4 24.625 34.525 23.599999999999998 17.25 5 26.75 38.05 18.875 16.325 6 22.375 39.5 20.75 17.375 7 20.974999999999998 22.55 37.75 18.725 8 19.075 28.075 28.175 24.675 9 22.2 23.724999999999998 30.25 23.825 10-14 23.525 29.12 26.790000000000003 20.565 15-19 23.755000000000003 28.04 27.26 20.945 20-24 24.08 28.175 27.195000000000004 20.549999999999997 25-29 24.055 28.835 27.034999999999997 20.075000000000003 30-34 23.73 28.765 27.075 20.43 35-39 23.53 28.689999999999998 26.745 21.035 40-44 23.395 27.67 27.935 21.0 45-49 23.355 27.425 27.750000000000004 21.47 50-54 23.200000000000003 27.33 28.095 21.375 55-59 23.625 28.21 27.1 21.065 60-64 23.724999999999998 28.720000000000002 26.974999999999998 20.580000000000002 65-69 23.64 27.97 27.389999999999997 21.0 70-74 24.349999999999998 27.43 27.46 20.76 75-79 23.345 27.275 27.875 21.505 80-84 23.79 27.955000000000002 26.715 21.54 85-89 23.555 28.645 27.015 20.785 90-94 24.2 28.244999999999997 26.805 20.75 95-99 23.419999999999998 28.24 27.85 20.49 100-104 24.235 28.325 26.479999999999997 20.96 105-109 23.915 27.62 27.825 20.64 110-114 23.935000000000002 28.895 27.355 19.814999999999998 115-119 24.645 28.525 26.384999999999998 20.445 120-124 24.43 27.715 27.045 20.810000000000002 125-129 24.695 27.900000000000002 27.084999999999997 20.32 130-134 24.255 28.07 27.055 20.62 135-139 24.305 26.97 28.335 20.39 140-144 24.529999999999998 27.965 27.115000000000002 20.39 145-149 25.03 28.199999999999996 27.165 19.605 150-151 25.4 28.787499999999998 26.3125 19.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 1.0 7 1.5 8 1.5 9 1.0 10 0.5 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 1.0 17 1.0 18 1.0 19 1.5 20 1.5 21 1.0 22 2.0 23 3.0 24 3.0 25 4.5 26 4.0 27 4.5 28 10.0 29 9.5 30 8.5 31 16.5 32 28.5 33 39.5 34 41.5 35 53.0 36 78.0 37 103.0 38 128.5 39 154.5 40 198.5 41 226.5 42 255.5 43 266.5 44 277.5 45 274.5 46 235.0 47 238.0 48 239.0 49 213.0 50 159.5 51 128.5 52 117.0 53 100.5 54 88.0 55 67.5 56 48.0 57 32.5 58 29.5 59 23.0 60 15.0 61 11.0 62 4.0 63 1.5 64 1.5 65 2.0 66 2.0 67 1.0 68 0.0 69 1.0 70 1.0 71 0.0 72 1.0 73 1.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 1.0 85 0.5 86 1.0 87 2.0 88 1.5 89 0.5 90 2.0 91 3.0 92 1.0 93 1.0 94 1.5 95 1.0 96 0.5 97 0.5 98 1.0 99 1.5 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.725 #Duplication Level Percentage of deduplicated Percentage of total 1 85.60047211566834 72.52499999999999 2 11.89141339628209 20.150000000000002 3 1.8589554440838005 4.725 4 0.4426084390675715 1.5 5 0.14753614635585718 0.625 6 0.029507229271171435 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.029507229271171435 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 13 0.325 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit GGAACTTTCTATGGTTAGATCCCTACATCCTAGAGGCCTGGATGGGAGGC 5 0.125 No Hit CCCTGATTGTCCGAGGGCCTGGTGCTGGGGCTCAAGTGACAGCTGGTGGA 5 0.125 No Hit GAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACA 5 0.125 No Hit AAAATACTCAAATTATATTACAAACCGGATTCGAACAAGTTTTTGAGAGA 5 0.125 No Hit AGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8500000000000001 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.2625 0.0 0.0 0.0 0.0 110-111 1.4875 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 1.8875 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.5125 0.0 0.0 0.0 0.0 122-123 2.5875000000000004 0.0 0.0 0.0 0.0 124-125 2.6875 0.0 0.0 0.0 0.0 126-127 2.8125 0.0 0.0 0.0 0.0 128-129 3.0 0.0 0.0 0.0 0.0 130-131 3.125 0.0 0.0 0.0 0.0 132-133 3.2625 0.0 0.0 0.0 0.0 134-135 3.4375 0.0 0.0 0.0 0.0 136-137 3.7 0.0 0.0 0.0 0.0 138-139 3.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAGGA 10 0.006830828 145.0 145 TCTTCGG 10 0.006830828 145.0 7 CCCCCCC 40 0.0076550315 18.125 15-19 >>END_MODULE Read 1017014 spots for SRR12671388.sra Written 1017014 spots for SRR12671388.sra Read 1017014 spots for SRR12671388.sra Written 1017014 spots for SRR12671388.sra Read 1017014 spots for SRR12671388.sra Written 1017014 spots for SRR12671388.sra Read 1017014 spots for SRR12671388.sra Written 1017014 spots for SRR12671388.sra Read 1017014 spots for SRR12671388.sra Written 1017014 spots for SRR12671388.sra Read 1017014 spots for SRR12671388.sra Written 1017014 spots for SRR12671388.sra Read 1017014 spots for SRR12671388.sra Written 1017014 spots for SRR12671388.sra Read 1017014 spots for SRR12671388.sra Written 1017014 spots for SRR12671388.sra Read 1017014 spots for SRR12671388.sra Written 1017014 spots for SRR12671388.sra Read 1017014 spots for SRR12671388.sra Written 1017014 spots for SRR12671388.sra Read 1017014 spots for SRR12671388.sra Written 1017014 spots for SRR12671388.sra Read 1017014 spots for SRR12671388.sra Written 1017014 spots for SRR12671388.sra Read 1017014 spots for SRR12671388.sra Written 1017014 spots for SRR12671388.sra Read 1017014 spots for SRR12671388.sra Written 1017014 spots for SRR12671388.sra Read 1017014 spots for SRR12671388.sra Written 1017014 spots for SRR12671388.sra Read 1017028 spots for SRR12671388.sra Written 1017028 spots for SRR12671388.sra Read 1017014 spots for SRR12671388.sra Written 1017014 spots for SRR12671388.sra Read 1017014 spots for SRR12671388.sra Written 1017014 spots for SRR12671388.sra Read 1017014 spots for SRR12671388.sra Written 1017014 spots for SRR12671388.sra Read 1017014 spots for SRR12671388.sra Written 1017014 spots for SRR12671388.sra SRR ids: ['SRR12671388.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8yr71o9z SRR12671388.sra spots: 20340294 blocks: [[1, 1017014], [1017015, 2034028], [2034029, 3051042], [3051043, 4068056], [4068057, 5085070], [5085071, 6102084], [6102085, 7119098], [7119099, 8136112], [8136113, 9153126], [9153127, 10170140], [10170141, 11187154], [11187155, 12204168], [12204169, 13221182], [13221183, 14238196], [14238197, 15255210], [15255211, 16272224], [16272225, 17289238], [17289239, 18306252], [18306253, 19323266], [19323267, 20340294]] SRR12671388 file size 6890821 SRR12671388 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671388 SRR12671388_1.fastq SRR12671388_2.fastq Input file: SRR12671388_1.fastq Paired file: SRR12671388_2.fastq trimmed: SRR12671388-trimmed-pair1.fastq, SRR12671388-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:08:19 2025 >> started Tue Feb 11 21:08:43 2025 >> done (24.019s) 20340294 read pairs processed; of these: 182 ( 0.00%) short read pairs filtered out after trimming by size control 10252 ( 0.05%) empty read pairs filtered out after trimming by size control 20329860 (99.95%) read pairs available; of these: 1176813 ( 5.79%) trimmed read pairs available after processing 19153047 (94.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 16 0.00% 20 24 0.00% 21 12 0.00% 22 27 0.00% 23 30 0.00% 24 29 0.00% 25 37 0.00% 26 39 0.00% 27 40 0.00% 28 47 0.00% 29 34 0.00% 30 42 0.00% 31 36 0.00% 32 51 0.00% 33 33 0.00% 34 40 0.00% 35 43 0.00% 36 40 0.00% 37 60 0.00% 38 46 0.00% 39 52 0.00% 40 48 0.00% 41 47 0.00% 42 54 0.00% 43 36 0.00% 44 57 0.00% 45 73 0.00% 46 59 0.00% 47 59 0.00% 48 71 0.00% 49 99 0.00% 50 118 0.00% 51 103 0.00% 52 113 0.00% 53 133 0.00% 54 144 0.00% 55 138 0.00% 56 155 0.00% 57 203 0.00% 58 214 0.00% 59 303 0.00% 60 264 0.00% 61 309 0.00% 62 382 0.00% 63 405 0.00% 64 464 0.00% 65 437 0.00% 66 500 0.00% 67 572 0.00% 68 695 0.00% 69 718 0.00% 70 817 0.00% 71 942 0.00% 72 1152 0.01% 73 1315 0.01% 74 1397 0.01% 75 1565 0.01% 76 1771 0.01% 77 1881 0.01% 78 2013 0.01% 79 2155 0.01% 80 2417 0.01% 81 2679 0.01% 82 2983 0.01% 83 3195 0.02% 84 3641 0.02% 85 4053 0.02% 86 4290 0.02% 87 4503 0.02% 88 4855 0.02% 89 4961 0.02% 90 5295 0.03% 91 5626 0.03% 92 6216 0.03% 93 6847 0.03% 94 6996 0.03% 95 7653 0.04% 96 8065 0.04% 97 8231 0.04% 98 8536 0.04% 99 8944 0.04% 100 9233 0.05% 101 9406 0.05% 102 9901 0.05% 103 10537 0.05% 104 10993 0.05% 105 11405 0.06% 106 12126 0.06% 107 12403 0.06% 108 12788 0.06% 109 12973 0.06% 110 13084 0.06% 111 13785 0.07% 112 14193 0.07% 113 14474 0.07% 114 14789 0.07% 115 15577 0.08% 116 16392 0.08% 117 16884 0.08% 118 16921 0.08% 119 17386 0.09% 120 17718 0.09% 121 17764 0.09% 122 18186 0.09% 123 19009 0.09% 124 19476 0.10% 125 19571 0.10% 126 20579 0.10% 127 21156 0.10% 128 21964 0.11% 129 22582 0.11% 130 22727 0.11% 131 22477 0.11% 132 23497 0.12% 133 23612 0.12% 134 23745 0.12% 135 24722 0.12% 136 25246 0.12% 137 25945 0.13% 138 26788 0.13% 139 27679 0.14% 140 27273 0.13% 141 28403 0.14% 142 28529 0.14% 143 28566 0.14% 144 29640 0.15% 145 30276 0.15% 146 30772 0.15% 147 31717 0.16% 148 32501 0.16% 149 32488 0.16% 150 34200 0.17% 151 19153047 94.21% 20329860 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=21 prefix-density=0.57 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=33.28 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.5 sequence=AAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=32 prefix-density=0.68 prefix-fanout=2.0 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=18.11 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.0 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGGCCTCTCTGCTGACCCAGAGACCTTTGCCAAGAACCGTGAGCTTGAAGTCATCCATTCCAGGTGGGCCATGCTTGGAGC SRR12671388 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:09:27 Started mapping on | Feb 11 21:09:27 Finished on | Feb 11 21:11:40 Mapping speed, Million of reads per hour | 550.28 Number of input reads | 20329860 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 18784579 Uniquely mapped reads % | 92.40% Average mapped length | 297.31 Number of splices: Total | 19009487 Number of splices: Annotated (sjdb) | 18632110 Number of splices: GT/AG | 18633152 Number of splices: GC/AG | 315642 Number of splices: AT/AC | 11525 Number of splices: Non-canonical | 49168 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 461609 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 28195 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.01% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1083672 1083672 1083672 N_multimapping 461609 461609 461609 N_noFeature 607967 18476430 702889 N_ambiguous 332734 1117 119097 UnstrandedReadsAssigned:17843878 PositiveStrandReadsAssigned:307032 NegativeStrandReadsAssigned:17962593 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671388 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671388-trimmed-pair1.fastq SRR12671388-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,329,860 reads, 17,966,668 reads pseudoaligned [quant] estimated average fragment length: 286.142 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,218 rounds 52401 SRR12671388.ke.tsv 34699 SRR12671388.se.tsv 87100 total ==> SRR12671388.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1732.86 658 17.8567 Potri.005G024800.1.v4.1 1035 749.858 428 26.8412 Potri.004G059700.1.v4.1 961 676.008 6 0.417385 Potri.007G009000.2.v4.1 1416 1130.86 0 0 Potri.003G141000.2.v4.1 2943 2657.86 970 17.1624 Potri.016G087400.1.v4.1 270 73.3095 1025 657.507 Potri.015G069301.1.v4.1 564 294.086 0 0 Potri.010G195200.1.v4.1 1773 1487.86 50 1.58032 Potri.012G127500.1.v4.1 977 691.944 99 6.72824 ==> SRR12671388.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 202 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 303 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 20 SRR12671388 completed mapping pipeline successfully