Starting /dee2/code/volunteer_pipeline.sh SRR12671389 current disk space = 3053003739136 free memory = 1404351248 SRR12671389 SRAfilesize c7ab7855b9090752870f401fa43ae5a4 SRR12671389.sra SRR12671389.sra file validated SRR12671389 is paired end SRR12671389 is conventional basespace SRR12671389 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671389_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.613 37.0 37.0 37.0 37.0 37.0 2 36.46025 37.0 37.0 37.0 37.0 37.0 3 36.5835 37.0 37.0 37.0 37.0 37.0 4 36.649 37.0 37.0 37.0 37.0 37.0 5 36.643 37.0 37.0 37.0 37.0 37.0 6 36.646 37.0 37.0 37.0 37.0 37.0 7 36.5545 37.0 37.0 37.0 37.0 37.0 8 36.597 37.0 37.0 37.0 37.0 37.0 9 36.601 37.0 37.0 37.0 37.0 37.0 10-14 36.643499999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.6391 37.0 37.0 37.0 37.0 37.0 20-24 36.5997 37.0 37.0 37.0 37.0 37.0 25-29 36.58239999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.5197 37.0 37.0 37.0 37.0 37.0 35-39 36.5007 37.0 37.0 37.0 37.0 37.0 40-44 36.5325 37.0 37.0 37.0 37.0 37.0 45-49 36.4652 37.0 37.0 37.0 37.0 37.0 50-54 36.461 37.0 37.0 37.0 37.0 37.0 55-59 36.4028 37.0 37.0 37.0 37.0 37.0 60-64 36.397499999999994 37.0 37.0 37.0 37.0 37.0 65-69 36.3429 37.0 37.0 37.0 37.0 37.0 70-74 36.3344 37.0 37.0 37.0 37.0 37.0 75-79 36.3053 37.0 37.0 37.0 37.0 37.0 80-84 36.3211 37.0 37.0 37.0 37.0 37.0 85-89 36.2919 37.0 37.0 37.0 37.0 37.0 90-94 36.2387 37.0 37.0 37.0 37.0 37.0 95-99 36.1649 37.0 37.0 37.0 37.0 37.0 100-104 36.2117 37.0 37.0 37.0 37.0 37.0 105-109 36.248599999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1358 37.0 37.0 37.0 37.0 37.0 115-119 36.1641 37.0 37.0 37.0 37.0 37.0 120-124 36.130300000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.1046 37.0 37.0 37.0 37.0 37.0 130-134 36.0529 37.0 37.0 37.0 37.0 37.0 135-139 35.9636 37.0 37.0 37.0 37.0 37.0 140-144 35.9039 37.0 37.0 37.0 37.0 37.0 145-149 35.9239 37.0 37.0 37.0 37.0 37.0 150-151 35.836 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 0.0 21 3.0 22 1.0 23 2.0 24 4.0 25 1.0 26 2.0 27 6.0 28 9.0 29 14.0 30 18.0 31 27.0 32 38.0 33 78.0 34 102.0 35 272.0 36 2992.0 37 429.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.05 10.575 6.375 40.0 2 19.16812828864946 11.325482335254321 38.687045853169636 30.819343522926584 3 18.025 18.425 28.349999999999998 35.199999999999996 4 22.15 25.025 24.275 28.549999999999997 5 22.75 32.074999999999996 25.55 19.625 6 19.025 33.800000000000004 25.424999999999997 21.75 7 15.299999999999999 25.0 42.275 17.424999999999997 8 14.549999999999999 24.8 35.725 24.925 9 16.425 22.8 37.55 23.225 10-14 19.31 29.81 28.01 22.869999999999997 15-19 19.805 28.389999999999997 28.12 23.685000000000002 20-24 19.915 28.060000000000002 28.249999999999996 23.775 25-29 19.81 28.694999999999997 28.26 23.235 30-34 20.31 28.48 27.725 23.485 35-39 19.545 28.675 27.975 23.805 40-44 19.475 28.78 28.42 23.325000000000003 45-49 20.294999999999998 29.26 27.395000000000003 23.05 50-54 20.11 28.99 27.215 23.685000000000002 55-59 20.11 28.945 27.495000000000005 23.45 60-64 20.06 27.860000000000003 28.000000000000004 24.08 65-69 19.695 28.79 27.22 24.295 70-74 20.275000000000002 28.335 27.54 23.849999999999998 75-79 20.03 27.77 28.470000000000002 23.73 80-84 20.84 27.88 27.800000000000004 23.48 85-89 20.294999999999998 29.154999999999998 27.36 23.189999999999998 90-94 20.330000000000002 28.585 27.71 23.375 95-99 20.435 28.110000000000003 28.225 23.23 100-104 20.155 28.43 27.700000000000003 23.715 105-109 20.150000000000002 28.860000000000003 27.675 23.315 110-114 20.424999999999997 28.32 27.625 23.630000000000003 115-119 21.05 28.79 26.919999999999998 23.24 120-124 20.505000000000003 28.444999999999997 27.825 23.225 125-129 20.05 28.134999999999998 28.1 23.715 130-134 20.64 28.21 27.655 23.494999999999997 135-139 20.32 28.09 27.639999999999997 23.95 140-144 20.68 28.005000000000003 27.52 23.794999999999998 145-149 20.445 28.535 27.169999999999998 23.849999999999998 150-151 21.925 27.775 27.05 23.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 1.0 6 1.0 7 1.5 8 1.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 3.5 22 3.0 23 3.0 24 4.0 25 3.0 26 7.0 27 10.5 28 10.5 29 10.5 30 15.0 31 33.5 32 47.0 33 50.5 34 57.5 35 71.0 36 87.0 37 106.5 38 143.5 39 163.5 40 176.5 41 202.5 42 221.0 43 239.0 44 256.0 45 267.0 46 276.0 47 255.0 48 219.5 49 207.0 50 185.5 51 141.5 52 113.0 53 88.0 54 64.5 55 58.5 56 55.0 57 46.0 58 27.0 59 16.5 60 12.0 61 8.5 62 6.0 63 4.0 64 3.0 65 2.5 66 3.0 67 2.5 68 1.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 87.01936976004626 75.25 2 10.812373518357907 18.7 3 1.7635154668979474 4.575 4 0.31801098583405607 1.0999999999999999 5 0.08673026886383348 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTGGAACCAGCCGGCGATTTTAACACGGGCTTTGGATTAGGTTTAAGTA 5 0.125 No Hit CTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAAC 5 0.125 No Hit TTTTTTTTTTCCAAAAGGATAATTAGTGTGGATATTATTTCTCATCAGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.1749999999999998 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.4875 0.0 0.0 0.0 0.0 120-121 1.6749999999999998 0.0 0.0 0.0 0.0 122-123 1.8625 0.0 0.0 0.0 0.0 124-125 2.1125 0.0 0.0 0.0 0.0 126-127 2.25 0.0 0.0 0.0 0.0 128-129 2.425 0.0 0.0 0.0 0.0 130-131 2.6625 0.0 0.0 0.0 0.0 132-133 2.875 0.0 0.0 0.0 0.0 134-135 3.0999999999999996 0.0 0.0 0.0 0.0 136-137 3.325 0.0 0.0 0.0 0.0 138-139 3.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 95 0.004191872 30.526318 1 >>END_MODULE SRR12671389 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671389_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3155 37.0 37.0 37.0 37.0 37.0 2 35.97 37.0 37.0 37.0 37.0 37.0 3 36.163 37.0 37.0 37.0 37.0 37.0 4 36.1865 37.0 37.0 37.0 37.0 37.0 5 36.259 37.0 37.0 37.0 37.0 37.0 6 36.257 37.0 37.0 37.0 37.0 37.0 7 36.178 37.0 37.0 37.0 37.0 37.0 8 36.2525 37.0 37.0 37.0 37.0 37.0 9 36.324 37.0 37.0 37.0 37.0 37.0 10-14 36.2477 37.0 37.0 37.0 37.0 37.0 15-19 36.230700000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.2159 37.0 37.0 37.0 37.0 37.0 25-29 36.1618 37.0 37.0 37.0 37.0 37.0 30-34 36.1395 37.0 37.0 37.0 37.0 37.0 35-39 36.1543 37.0 37.0 37.0 37.0 37.0 40-44 36.106700000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.0801 37.0 37.0 37.0 37.0 37.0 50-54 36.0443 37.0 37.0 37.0 37.0 37.0 55-59 36.0145 37.0 37.0 37.0 37.0 37.0 60-64 35.959199999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.948 37.0 37.0 37.0 37.0 37.0 70-74 35.9415 37.0 37.0 37.0 37.0 37.0 75-79 35.9184 37.0 37.0 37.0 37.0 37.0 80-84 35.8943 37.0 37.0 37.0 37.0 37.0 85-89 35.931 37.0 37.0 37.0 37.0 37.0 90-94 35.9157 37.0 37.0 37.0 37.0 37.0 95-99 35.853 37.0 37.0 37.0 37.0 37.0 100-104 35.846999999999994 37.0 37.0 37.0 37.0 37.0 105-109 35.7556 37.0 37.0 37.0 37.0 37.0 110-114 35.7276 37.0 37.0 37.0 37.0 37.0 115-119 35.7907 37.0 37.0 37.0 37.0 37.0 120-124 35.768600000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.7473 37.0 37.0 37.0 37.0 37.0 130-134 35.690900000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.5328 37.0 37.0 37.0 37.0 37.0 140-144 35.67530000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.579 37.0 37.0 37.0 37.0 37.0 150-151 35.293 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 1.0 15 3.0 16 1.0 17 3.0 18 0.0 19 0.0 20 5.0 21 1.0 22 1.0 23 2.0 24 6.0 25 7.0 26 6.0 27 9.0 28 19.0 29 13.0 30 20.0 31 38.0 32 50.0 33 100.0 34 176.0 35 532.0 36 2774.0 37 227.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.2 23.0 9.8 27.0 2 24.55 25.825 33.95 15.675 3 19.35 27.474999999999998 34.175 19.0 4 23.45 32.775 23.849999999999998 19.925 5 24.2 37.65 21.45 16.7 6 19.950000000000003 40.849999999999994 21.075 18.125 7 19.825 21.275 39.675 19.225 8 18.85 25.25 31.25 24.65 9 21.825 24.625 30.349999999999998 23.200000000000003 10-14 22.634999999999998 29.64 26.915 20.810000000000002 15-19 22.655 27.97 27.975 21.4 20-24 22.33 29.349999999999998 27.894999999999996 20.424999999999997 25-29 22.285 28.139999999999997 28.62 20.955 30-34 22.185 27.965 28.915000000000003 20.935000000000002 35-39 22.845 28.395 27.875 20.885 40-44 22.650000000000002 28.875 28.139999999999997 20.335 45-49 21.77 28.044999999999998 29.005 21.18 50-54 21.884999999999998 29.145 27.694999999999997 21.275 55-59 23.549999999999997 28.144999999999996 27.18 21.125 60-64 23.23 28.285 28.1 20.385 65-69 22.97 27.845 27.905 21.279999999999998 70-74 23.735 27.725 27.255000000000003 21.285 75-79 23.57 27.765 27.83 20.835 80-84 23.615 27.93 27.87 20.585 85-89 23.474999999999998 27.74 27.815 20.97 90-94 23.695 27.455000000000002 27.82 21.029999999999998 95-99 23.315 27.85 27.925 20.91 100-104 23.549999999999997 28.33 27.445000000000004 20.674999999999997 105-109 23.24 27.435 28.055000000000003 21.27 110-114 23.515 28.395 27.38 20.71 115-119 23.835 28.470000000000002 27.12 20.575 120-124 24.195 28.73 27.12 19.955000000000002 125-129 24.16 27.73 28.1 20.01 130-134 23.45 27.834999999999997 27.99 20.724999999999998 135-139 23.494999999999997 27.295 28.349999999999998 20.86 140-144 24.01 28.084999999999997 27.284999999999997 20.62 145-149 24.362436243624362 28.092809280928094 27.562756275627564 19.98199819981998 150-151 25.637500000000003 26.5625 27.675 20.125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 1.5 15 2.0 16 2.0 17 3.0 18 2.0 19 1.0 20 0.5 21 0.0 22 2.5 23 3.0 24 2.5 25 4.0 26 7.0 27 10.5 28 12.5 29 16.0 30 15.5 31 20.5 32 29.5 33 39.0 34 55.0 35 71.0 36 79.5 37 99.5 38 150.0 39 183.5 40 211.5 41 249.0 42 257.5 43 289.0 44 298.5 45 262.0 46 237.5 47 224.0 48 216.5 49 184.5 50 137.0 51 119.0 52 101.5 53 70.0 54 65.5 55 63.0 56 46.5 57 32.5 58 28.0 59 23.5 60 15.5 61 12.5 62 8.5 63 6.0 64 7.0 65 6.5 66 4.0 67 1.5 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.1 #Duplication Level Percentage of deduplicated Percentage of total 1 87.36933797909407 75.225 2 10.452961672473867 18.0 3 1.713124274099884 4.425 4 0.29036004645760743 1.0 5 0.05807200929152149 0.25 6 0.0 0.0 7 0.029036004645760744 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.08710801393728224 0.9249999999999999 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 17 0.42500000000000004 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 10 0.25 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 10 0.25 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit AGATGATCAAGCACGTCATAAGATGATCTGATGCTGGAAATGGATGCAGA 5 0.125 No Hit CCTATCTTCCCATCCCATTTTCTCATTAAGGGTGTTTTTAGGTTTCTTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88-89 0.05 0.0 0.0 0.025 0.0 90-91 0.0625 0.0 0.0 0.025 0.0 92-93 0.125 0.0 0.0 0.025 0.0 94-95 0.2375 0.0 0.0 0.025 0.0 96-97 0.3375 0.0 0.0 0.025 0.0 98-99 0.3625 0.0 0.0 0.025 0.0 100-101 0.45 0.0 0.0 0.025 0.0 102-103 0.6375 0.0 0.0 0.025 0.0 104-105 0.675 0.0 0.0 0.025 0.0 106-107 0.7124999999999999 0.0 0.0 0.025 0.0 108-109 0.8 0.0 0.0 0.025 0.0 110-111 0.8875 0.0 0.0 0.025 0.0 112-113 1.0499999999999998 0.0 0.0 0.025 0.0 114-115 1.225 0.0 0.0 0.025 0.0 116-117 1.35 0.0 0.0 0.025 0.0 118-119 1.5625 0.0 0.0 0.025 0.0 120-121 1.75 0.0 0.0 0.025 0.0 122-123 1.9375 0.0 0.0 0.025 0.0 124-125 2.1875 0.0 0.0 0.025 0.0 126-127 2.3125 0.0 0.0 0.025 0.0 128-129 2.4625 0.0 0.0 0.025 0.0 130-131 2.6875 0.0 0.0 0.025 0.0 132-133 2.9125 0.0 0.0 0.025 0.0 134-135 3.1625 0.0 0.0 0.025 0.0 136-137 3.425 0.0 0.0 0.025 0.0 138-139 3.6125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATAC 10 0.006830828 145.0 5 CACATTC 10 0.006830828 145.0 1 GTCAAAG 10 0.006830828 145.0 145 CATTCAT 10 0.006830828 145.0 3 ACATTCA 10 0.006830828 145.0 2 ATACTCC 10 0.006830828 145.0 8 TACTCCA 10 0.006830828 145.0 9 CATACTC 10 0.006830828 145.0 7 ATTCATA 10 0.006830828 145.0 4 TCATACT 10 0.006830828 145.0 6 >>END_MODULE Read 945674 spots for SRR12671389.sra Written 945674 spots for SRR12671389.sra Read 945674 spots for SRR12671389.sra Written 945674 spots for SRR12671389.sra Read 945674 spots for SRR12671389.sra Written 945674 spots for SRR12671389.sra Read 945674 spots for SRR12671389.sra Written 945674 spots for SRR12671389.sra Read 945674 spots for SRR12671389.sra Written 945674 spots for SRR12671389.sra Read 945674 spots for SRR12671389.sra Written 945674 spots for SRR12671389.sra Read 945674 spots for SRR12671389.sra Written 945674 spots for SRR12671389.sra Read 945674 spots for SRR12671389.sra Written 945674 spots for SRR12671389.sra Read 945674 spots for SRR12671389.sra Written 945674 spots for SRR12671389.sra Read 945674 spots for SRR12671389.sra Written 945674 spots for SRR12671389.sra Read 945674 spots for SRR12671389.sra Written 945674 spots for SRR12671389.sra Read 945674 spots for SRR12671389.sra Written 945674 spots for SRR12671389.sra Read 945674 spots for SRR12671389.sra Written 945674 spots for SRR12671389.sra Read 945679 spots for SRR12671389.sra Written 945679 spots for SRR12671389.sra Read 945674 spots for SRR12671389.sra Written 945674 spots for SRR12671389.sra Read 945674 spots for SRR12671389.sra Written 945674 spots for SRR12671389.sra Read 945674 spots for SRR12671389.sra Written 945674 spots for SRR12671389.sra Read 945674 spots for SRR12671389.sra Written 945674 spots for SRR12671389.sra Read 945674 spots for SRR12671389.sra Written 945674 spots for SRR12671389.sra Read 945674 spots for SRR12671389.sra Written 945674 spots for SRR12671389.sra SRR ids: ['SRR12671389.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1urtptaf SRR12671389.sra spots: 18913485 blocks: [[1, 945674], [945675, 1891348], [1891349, 2837022], [2837023, 3782696], [3782697, 4728370], [4728371, 5674044], [5674045, 6619718], [6619719, 7565392], [7565393, 8511066], [8511067, 9456740], [9456741, 10402414], [10402415, 11348088], [11348089, 12293762], [12293763, 13239436], [13239437, 14185110], [14185111, 15130784], [15130785, 16076458], [16076459, 17022132], [17022133, 17967806], [17967807, 18913485]] SRR12671389 file size 6405929 SRR12671389 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671389 SRR12671389_1.fastq SRR12671389_2.fastq Input file: SRR12671389_1.fastq Paired file: SRR12671389_2.fastq trimmed: SRR12671389-trimmed-pair1.fastq, SRR12671389-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:13:06 2025 >> started Tue Feb 11 21:13:28 2025 >> done (22.019s) 18913485 read pairs processed; of these: 88 ( 0.00%) short read pairs filtered out after trimming by size control 2236 ( 0.01%) empty read pairs filtered out after trimming by size control 18911161 (99.99%) read pairs available; of these: 1017188 ( 5.38%) trimmed read pairs available after processing 17893973 (94.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 8 0.00% 21 12 0.00% 22 13 0.00% 23 13 0.00% 24 12 0.00% 25 20 0.00% 26 10 0.00% 27 8 0.00% 28 17 0.00% 29 18 0.00% 30 18 0.00% 31 21 0.00% 32 23 0.00% 33 22 0.00% 34 23 0.00% 35 32 0.00% 36 18 0.00% 37 17 0.00% 38 20 0.00% 39 25 0.00% 40 22 0.00% 41 28 0.00% 42 24 0.00% 43 29 0.00% 44 26 0.00% 45 40 0.00% 46 36 0.00% 47 41 0.00% 48 35 0.00% 49 48 0.00% 50 55 0.00% 51 85 0.00% 52 70 0.00% 53 77 0.00% 54 102 0.00% 55 86 0.00% 56 96 0.00% 57 110 0.00% 58 114 0.00% 59 150 0.00% 60 179 0.00% 61 191 0.00% 62 235 0.00% 63 244 0.00% 64 284 0.00% 65 318 0.00% 66 376 0.00% 67 401 0.00% 68 429 0.00% 69 445 0.00% 70 550 0.00% 71 579 0.00% 72 743 0.00% 73 850 0.00% 74 892 0.00% 75 996 0.01% 76 1124 0.01% 77 1273 0.01% 78 1351 0.01% 79 1523 0.01% 80 1624 0.01% 81 1879 0.01% 82 2025 0.01% 83 2334 0.01% 84 2552 0.01% 85 2765 0.01% 86 3076 0.02% 87 3225 0.02% 88 3502 0.02% 89 3559 0.02% 90 3827 0.02% 91 4170 0.02% 92 4396 0.02% 93 4855 0.03% 94 5234 0.03% 95 5629 0.03% 96 5973 0.03% 97 6309 0.03% 98 6492 0.03% 99 6775 0.04% 100 7364 0.04% 101 7514 0.04% 102 7837 0.04% 103 8146 0.04% 104 8716 0.05% 105 8966 0.05% 106 9420 0.05% 107 9776 0.05% 108 10139 0.05% 109 10593 0.06% 110 10580 0.06% 111 11290 0.06% 112 11604 0.06% 113 11731 0.06% 114 12285 0.06% 115 13030 0.07% 116 13434 0.07% 117 14102 0.07% 118 14672 0.08% 119 14634 0.08% 120 15240 0.08% 121 15788 0.08% 122 16036 0.08% 123 16799 0.09% 124 16858 0.09% 125 17405 0.09% 126 18181 0.10% 127 18591 0.10% 128 18993 0.10% 129 19605 0.10% 130 20087 0.11% 131 20151 0.11% 132 20579 0.11% 133 21178 0.11% 134 21235 0.11% 135 21786 0.12% 136 22790 0.12% 137 23349 0.12% 138 23915 0.13% 139 25417 0.13% 140 25359 0.13% 141 26071 0.14% 142 26157 0.14% 143 26615 0.14% 144 27557 0.15% 145 28098 0.15% 146 28626 0.15% 147 29203 0.15% 148 31504 0.17% 149 30808 0.16% 150 32557 0.17% 151 17893973 94.62% 18911161 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=5.79 fanout-score-rank=7 prefix-density=0.61 prefix-fanout=3.4 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=591.69 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=17.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=1.78 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=31 prefix-density=1.76 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=26.51 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=9.9 sequence=AAGAAAGCTTACCCTAAC SRR12671389 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:14:13 Started mapping on | Feb 11 21:14:13 Finished on | Feb 11 21:16:57 Mapping speed, Million of reads per hour | 415.12 Number of input reads | 18911161 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 17386530 Uniquely mapped reads % | 91.94% Average mapped length | 297.70 Number of splices: Total | 17312882 Number of splices: Annotated (sjdb) | 16899194 Number of splices: GT/AG | 16979937 Number of splices: GC/AG | 251826 Number of splices: AT/AC | 11194 Number of splices: Non-canonical | 69925 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 3.08 Insertion rate per base | 0.03% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 465865 % of reads mapped to multiple loci | 2.46% Number of reads mapped to too many loci | 46654 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.25% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1058766 1058766 1058766 N_multimapping 465865 465865 465865 N_noFeature 663692 17038728 753260 N_ambiguous 395775 1128 136980 UnstrandedReadsAssigned:16327063 PositiveStrandReadsAssigned:346674 NegativeStrandReadsAssigned:16496290 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671389 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671389-trimmed-pair1.fastq SRR12671389-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,911,161 reads, 16,335,871 reads pseudoaligned [quant] estimated average fragment length: 291.134 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52401 SRR12671389.ke.tsv 34699 SRR12671389.se.tsv 87100 total ==> SRR12671389.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1727.87 1014 27.0196 Potri.005G024800.1.v4.1 1035 744.866 421 26.0228 Potri.004G059700.1.v4.1 961 671.028 6 0.411681 Potri.007G009000.2.v4.1 1416 1125.87 0 0 Potri.003G141000.2.v4.1 2943 2652.87 838 14.5438 Potri.016G087400.1.v4.1 270 73.2336 838 526.847 Potri.015G069301.1.v4.1 564 291.779 0 0 Potri.010G195200.1.v4.1 1773 1482.87 612.942 19.0313 Potri.012G127500.1.v4.1 977 686.954 293 19.6377 ==> SRR12671389.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 266 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 223 Potri.001G212900.v4.1 170 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12671389 completed mapping pipeline successfully