Starting /dee2/code/volunteer_pipeline.sh SRR12671390 current disk space = 3052585775104 free memory = 1400028912 SRR12671390 SRAfilesize 4712bc78c7c6f7daa04fc8c5fba0a490 SRR12671390.sra SRR12671390.sra file validated SRR12671390 is paired end SRR12671390 is conventional basespace SRR12671390 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671390_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5445 37.0 37.0 37.0 37.0 37.0 2 36.43775 37.0 37.0 37.0 37.0 37.0 3 36.573 37.0 37.0 37.0 37.0 37.0 4 36.7265 37.0 37.0 37.0 37.0 37.0 5 36.632 37.0 37.0 37.0 37.0 37.0 6 36.591 37.0 37.0 37.0 37.0 37.0 7 36.529 37.0 37.0 37.0 37.0 37.0 8 36.6825 37.0 37.0 37.0 37.0 37.0 9 36.643 37.0 37.0 37.0 37.0 37.0 10-14 36.6516 37.0 37.0 37.0 37.0 37.0 15-19 36.608399999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.577999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.584199999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.4951 37.0 37.0 37.0 37.0 37.0 35-39 36.4815 37.0 37.0 37.0 37.0 37.0 40-44 36.4274 37.0 37.0 37.0 37.0 37.0 45-49 36.497 37.0 37.0 37.0 37.0 37.0 50-54 36.4259 37.0 37.0 37.0 37.0 37.0 55-59 36.4144 37.0 37.0 37.0 37.0 37.0 60-64 36.430400000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.3706 37.0 37.0 37.0 37.0 37.0 70-74 36.3598 37.0 37.0 37.0 37.0 37.0 75-79 36.3559 37.0 37.0 37.0 37.0 37.0 80-84 36.3326 37.0 37.0 37.0 37.0 37.0 85-89 36.2679 37.0 37.0 37.0 37.0 37.0 90-94 36.2821 37.0 37.0 37.0 37.0 37.0 95-99 36.2447 37.0 37.0 37.0 37.0 37.0 100-104 36.2287 37.0 37.0 37.0 37.0 37.0 105-109 36.2264 37.0 37.0 37.0 37.0 37.0 110-114 36.1348 37.0 37.0 37.0 37.0 37.0 115-119 36.111000000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.1187 37.0 37.0 37.0 37.0 37.0 125-129 36.0486 37.0 37.0 37.0 37.0 37.0 130-134 36.039199999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.983999999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.9346 37.0 37.0 37.0 37.0 37.0 145-149 35.9337 37.0 37.0 37.0 37.0 37.0 150-151 35.83625 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 1.0 23 4.0 24 0.0 25 4.0 26 4.0 27 3.0 28 9.0 29 18.0 30 19.0 31 25.0 32 59.0 33 59.0 34 108.0 35 274.0 36 2961.0 37 450.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.199999999999996 11.125 5.8999999999999995 40.775 2 18.901980446227125 11.882677362747556 38.43068438205064 30.78465780897468 3 17.825 16.85 29.475 35.85 4 23.75 24.375 22.825 29.049999999999997 5 24.15 31.7 23.549999999999997 20.599999999999998 6 19.950000000000003 33.4 24.2 22.45 7 14.2 26.700000000000003 43.25 15.85 8 17.2 23.775 34.849999999999994 24.175 9 16.8 22.15 37.475 23.575 10-14 19.07 30.264999999999997 27.61 23.055 15-19 19.67 28.360000000000003 28.060000000000002 23.91 20-24 20.105 28.785 27.185 23.925 25-29 19.855 28.125 28.375 23.645 30-34 20.015 27.83 28.705000000000002 23.45 35-39 19.74 28.27 27.825 24.165 40-44 20.225 28.365000000000002 27.794999999999998 23.615 45-49 19.625 28.689999999999998 27.83 23.855 50-54 21.07 28.365000000000002 27.339999999999996 23.225 55-59 19.775000000000002 28.555000000000003 27.175 24.495 60-64 20.244999999999997 28.54 26.93 24.285 65-69 20.265 28.465 27.61 23.66 70-74 20.18 28.645 27.284999999999997 23.89 75-79 19.919999999999998 28.189999999999998 27.37 24.52 80-84 20.275000000000002 28.799999999999997 26.950000000000003 23.974999999999998 85-89 20.555 28.355000000000004 27.47 23.62 90-94 20.41 28.375 27.750000000000004 23.465 95-99 20.979999999999997 27.465 27.97 23.585 100-104 20.66 28.74 27.534999999999997 23.064999999999998 105-109 20.810000000000002 27.694999999999997 27.615000000000002 23.880000000000003 110-114 21.22 27.68 27.485 23.615 115-119 21.029999999999998 28.1 27.245 23.625 120-124 20.895 28.244999999999997 27.279999999999998 23.580000000000002 125-129 20.5 27.950000000000003 27.284999999999997 24.265 130-134 20.735 27.32 27.87 24.075 135-139 21.105 28.255000000000003 26.884999999999998 23.755000000000003 140-144 20.845 27.900000000000002 27.36 23.895 145-149 20.435 28.205000000000002 27.195000000000004 24.165 150-151 20.2625 27.1375 28.575 24.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 1.0 12 0.5 13 0.5 14 0.5 15 0.0 16 0.5 17 1.5 18 1.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 2.5 25 4.0 26 5.5 27 5.5 28 7.0 29 15.5 30 26.0 31 23.5 32 30.0 33 47.5 34 59.0 35 73.5 36 76.5 37 85.0 38 120.5 39 146.5 40 174.5 41 207.0 42 236.0 43 256.0 44 250.0 45 248.0 46 261.0 47 272.0 48 252.5 49 213.0 50 171.5 51 146.0 52 126.5 53 106.0 54 92.0 55 65.5 56 47.5 57 37.5 58 29.5 59 22.0 60 15.5 61 12.0 62 7.0 63 3.0 64 1.5 65 2.0 66 1.0 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.92500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.71849865951742 71.1 2 12.064343163538874 20.25 3 2.7703306523681857 6.9750000000000005 4 0.3276735180220435 1.0999999999999999 5 0.08936550491510277 0.375 6 0.0 0.0 7 0.0 0.0 8 0.02978850163836759 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGAGTTTTCCTCGATAGTGTACTTTGATGCTATCTCCCTTGTGAGCCTG 8 0.2 No Hit CCAGAGTTCCCACAATGTCTTCCACTACTTTGTTCCTTGAAAATGATTTG 5 0.125 No Hit GGCGTTTTGCAATATATGGATAGGCAACCTCAAGAAATTTAAAATCTGGC 5 0.125 No Hit GCACAGAACACGAAAATACTCAGGCGAAGTAGCCTGAAAAAGGTATATAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 0.9874999999999999 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.1375 0.0 0.0 0.0 0.0 116-117 2.25 0.0 0.0 0.0 0.0 118-119 2.4000000000000004 0.0 0.0 0.0 0.0 120-121 2.5375 0.0 0.0 0.0 0.0 122-123 2.7375 0.0 0.0 0.0 0.0 124-125 2.975 0.0 0.0 0.0 0.0 126-127 3.4125 0.0 0.0 0.0 0.0 128-129 3.7625 0.0 0.0 0.0 0.0 130-131 4.1 0.0 0.0 0.0 0.0 132-133 4.375 0.0 0.0 0.0 0.0 134-135 4.7625 0.0 0.0 0.0 0.0 136-137 5.0625 0.0 0.0 0.0 0.0 138-139 5.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCTTAA 10 0.006830828 145.0 4 GCTTGCT 10 0.006830828 145.0 1 CTTGCTT 10 0.006830828 145.0 2 CTTAATG 10 0.006830828 145.0 6 ATTCTTG 10 0.006830828 145.0 5 GCTTCCC 10 0.006830828 145.0 145 AATGACC 10 0.006830828 145.0 9 GCTTAAT 10 0.006830828 145.0 5 >>END_MODULE SRR12671390 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671390_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3245 37.0 37.0 37.0 37.0 37.0 2 35.946 37.0 37.0 37.0 37.0 37.0 3 36.2875 37.0 37.0 37.0 37.0 37.0 4 36.4055 37.0 37.0 37.0 37.0 37.0 5 36.305 37.0 37.0 37.0 37.0 37.0 6 36.273 37.0 37.0 37.0 37.0 37.0 7 36.3505 37.0 37.0 37.0 37.0 37.0 8 36.3275 37.0 37.0 37.0 37.0 37.0 9 36.323 37.0 37.0 37.0 37.0 37.0 10-14 36.324400000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.3305 37.0 37.0 37.0 37.0 37.0 20-24 36.2823 37.0 37.0 37.0 37.0 37.0 25-29 36.2587 37.0 37.0 37.0 37.0 37.0 30-34 36.1768 37.0 37.0 37.0 37.0 37.0 35-39 36.268899999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.1961 37.0 37.0 37.0 37.0 37.0 45-49 36.151300000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.1623 37.0 37.0 37.0 37.0 37.0 55-59 36.114799999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.118 37.0 37.0 37.0 37.0 37.0 65-69 36.10940000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.0908 37.0 37.0 37.0 37.0 37.0 75-79 36.053399999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.971 37.0 37.0 37.0 37.0 37.0 85-89 36.0265 37.0 37.0 37.0 37.0 37.0 90-94 35.9995 37.0 37.0 37.0 37.0 37.0 95-99 35.948600000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.9248 37.0 37.0 37.0 37.0 37.0 105-109 35.82899999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.8409 37.0 37.0 37.0 37.0 37.0 115-119 35.8929 37.0 37.0 37.0 37.0 37.0 120-124 35.857299999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.7579 37.0 37.0 37.0 37.0 37.0 130-134 35.7125 37.0 37.0 37.0 37.0 37.0 135-139 35.677099999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.6111 37.0 37.0 37.0 37.0 37.0 145-149 35.6158 37.0 37.0 37.0 37.0 37.0 150-151 35.26875 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 0.0 16 0.0 17 3.0 18 0.0 19 0.0 20 1.0 21 0.0 22 1.0 23 7.0 24 4.0 25 15.0 26 3.0 27 11.0 28 13.0 29 19.0 30 28.0 31 40.0 32 51.0 33 80.0 34 159.0 35 507.0 36 2737.0 37 318.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.45 24.0 10.5 26.05 2 25.650000000000002 25.224999999999998 34.050000000000004 15.075 3 20.1 28.425 33.475 18.0 4 25.674999999999997 33.625 22.575 18.125 5 25.924999999999997 37.4 21.15 15.525 6 19.1 41.25 21.725 17.925 7 19.875 22.15 38.7 19.275000000000002 8 18.175 25.5 30.775000000000002 25.55 9 21.15 24.2 30.925000000000004 23.724999999999998 10-14 23.41 30.2 25.735000000000003 20.655 15-19 23.235 28.249999999999996 26.87 21.645 20-24 22.53 29.060000000000002 26.974999999999998 21.435000000000002 25-29 23.0 28.749999999999996 27.51 20.74 30-34 22.935 29.28 27.315 20.47 35-39 23.43 27.889999999999997 27.12 21.560000000000002 40-44 23.165 28.084999999999997 27.900000000000002 20.849999999999998 45-49 23.345 27.98 27.605 21.07 50-54 22.29 28.18 28.125 21.404999999999998 55-59 23.555 27.875 27.555000000000003 21.015 60-64 23.155 27.665 27.74 21.44 65-69 22.765 27.935 27.865000000000002 21.435000000000002 70-74 23.375 28.299999999999997 26.534999999999997 21.790000000000003 75-79 22.96 27.925 27.42 21.695 80-84 23.189999999999998 28.03 27.384999999999998 21.395 85-89 22.900000000000002 27.884999999999998 27.584999999999997 21.63 90-94 23.990000000000002 28.02 26.965 21.025 95-99 23.53 27.815 26.96 21.695 100-104 23.715 28.08 27.555000000000003 20.65 105-109 23.724999999999998 28.065 27.46 20.75 110-114 24.075 27.58 27.644999999999996 20.7 115-119 24.099999999999998 28.825 26.6 20.474999999999998 120-124 24.12 28.525 27.485 19.869999999999997 125-129 24.779999999999998 28.075 26.38 20.765 130-134 23.955000000000002 28.325 26.875 20.845 135-139 24.255 27.355 27.565 20.825 140-144 24.0 27.785 26.87 21.345 145-149 24.87 27.37 26.76 21.0 150-151 26.0625 27.487499999999997 27.175 19.275000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 0.0 12 0.5 13 1.0 14 1.5 15 1.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.5 22 1.5 23 0.5 24 3.0 25 7.0 26 4.5 27 4.0 28 8.5 29 12.0 30 15.5 31 16.5 32 20.0 33 39.5 34 52.0 35 54.5 36 65.0 37 97.5 38 135.0 39 157.0 40 174.5 41 210.5 42 265.0 43 299.5 44 281.0 45 261.0 46 277.0 47 254.0 48 220.5 49 208.0 50 165.5 51 131.5 52 117.5 53 96.0 54 82.0 55 66.0 56 55.0 57 40.0 58 24.0 59 17.0 60 13.5 61 12.0 62 7.5 63 5.0 64 2.5 65 1.0 66 0.5 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.025 #Duplication Level Percentage of deduplicated Percentage of total 1 85.5400178518298 71.875 2 11.395418030348111 19.15 3 2.3504909253198454 5.925 4 0.5058018446890806 1.7000000000000002 5 0.05950609937518596 0.25 6 0.02975304968759298 0.15 7 0.02975304968759298 0.17500000000000002 8 0.02975304968759298 0.2 9 0.0 0.0 >10 0.05950609937518596 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 12 0.3 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 11 0.27499999999999997 No Hit CCGCAATTTGCAAAGATGGGCTTCAACTGCGCATCCAAGGCGACCGCGAT 8 0.2 No Hit CTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTATGATCTCA 7 0.17500000000000002 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit CATGTTTTGTTTTGTTTTTTTTTTAGTTTTTTCTTTTTCACATACATAGT 5 0.125 No Hit AAAGGATGTCATGGATACACTCCCTAAAAAGGTGTTTGAGATTGATGATA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.725 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.425 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 1.8624999999999998 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.2249999999999996 0.0 0.0 0.0 0.0 116-117 2.35 0.0 0.0 0.0 0.0 118-119 2.5 0.0 0.0 0.0 0.0 120-121 2.6375 0.0 0.0 0.0 0.0 122-123 2.8375 0.0 0.0 0.0 0.0 124-125 3.075 0.0 0.0 0.0 0.0 126-127 3.5125 0.0 0.0 0.0 0.0 128-129 3.8625000000000003 0.0 0.0 0.0 0.0 130-131 4.2 0.0 0.0 0.0 0.0 132-133 4.45 0.0 0.0 0.0 0.0 134-135 4.85 0.0 0.0 0.0 0.0 136-137 5.1625 0.0 0.0 0.0 0.0 138-139 5.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 844034 spots for SRR12671390.sra Written 844034 spots for SRR12671390.sra Read 844034 spots for SRR12671390.sra Written 844034 spots for SRR12671390.sra Read 844034 spots for SRR12671390.sra Written 844034 spots for SRR12671390.sra Read 844034 spots for SRR12671390.sra Written 844034 spots for SRR12671390.sra Read 844034 spots for SRR12671390.sra Written 844034 spots for SRR12671390.sra Read 844034 spots for SRR12671390.sra Written 844034 spots for SRR12671390.sra Read 844034 spots for SRR12671390.sra Written 844034 spots for SRR12671390.sra Read 844034 spots for SRR12671390.sra Written 844034 spots for SRR12671390.sra Read 844034 spots for SRR12671390.sra Written 844034 spots for SRR12671390.sra Read 844034 spots for SRR12671390.sra Written 844034 spots for SRR12671390.sra Read 844034 spots for SRR12671390.sra Written 844034 spots for SRR12671390.sra Read 844034 spots for SRR12671390.sra Written 844034 spots for SRR12671390.sra Read 844034 spots for SRR12671390.sra Written 844034 spots for SRR12671390.sra Read 844034 spots for SRR12671390.sra Written 844034 spots for SRR12671390.sra Read 844034 spots for SRR12671390.sra Written 844034 spots for SRR12671390.sra Read 844034 spots for SRR12671390.sra Written 844034 spots for SRR12671390.sra Read 844034 spots for SRR12671390.sra Written 844034 spots for SRR12671390.sra Read 844034 spots for SRR12671390.sra Written 844034 spots for SRR12671390.sra Read 844048 spots for SRR12671390.sra Written 844048 spots for SRR12671390.sra Read 844034 spots for SRR12671390.sra Written 844034 spots for SRR12671390.sra SRR ids: ['SRR12671390.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3lijpvo4 SRR12671390.sra spots: 16880694 blocks: [[1, 844034], [844035, 1688068], [1688069, 2532102], [2532103, 3376136], [3376137, 4220170], [4220171, 5064204], [5064205, 5908238], [5908239, 6752272], [6752273, 7596306], [7596307, 8440340], [8440341, 9284374], [9284375, 10128408], [10128409, 10972442], [10972443, 11816476], [11816477, 12660510], [12660511, 13504544], [13504545, 14348578], [14348579, 15192612], [15192613, 16036646], [16036647, 16880694]] SRR12671390 file size 5715097 SRR12671390 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671390 SRR12671390_1.fastq SRR12671390_2.fastq Input file: SRR12671390_1.fastq Paired file: SRR12671390_2.fastq trimmed: SRR12671390-trimmed-pair1.fastq, SRR12671390-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:33:52 2025 >> started Tue Feb 11 21:34:09 2025 >> done (17.345s) 16880694 read pairs processed; of these: 147 ( 0.00%) short read pairs filtered out after trimming by size control 3919 ( 0.02%) empty read pairs filtered out after trimming by size control 16876628 (99.98%) read pairs available; of these: 1076259 ( 6.38%) trimmed read pairs available after processing 15800369 (93.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 10 0.00% 20 5 0.00% 21 6 0.00% 22 8 0.00% 23 25 0.00% 24 22 0.00% 25 8 0.00% 26 15 0.00% 27 11 0.00% 28 19 0.00% 29 20 0.00% 30 16 0.00% 31 23 0.00% 32 19 0.00% 33 17 0.00% 34 28 0.00% 35 31 0.00% 36 20 0.00% 37 14 0.00% 38 25 0.00% 39 29 0.00% 40 42 0.00% 41 31 0.00% 42 32 0.00% 43 25 0.00% 44 59 0.00% 45 40 0.00% 46 34 0.00% 47 61 0.00% 48 64 0.00% 49 55 0.00% 50 70 0.00% 51 89 0.00% 52 90 0.00% 53 96 0.00% 54 104 0.00% 55 83 0.00% 56 143 0.00% 57 139 0.00% 58 129 0.00% 59 179 0.00% 60 294 0.00% 61 267 0.00% 62 280 0.00% 63 306 0.00% 64 372 0.00% 65 362 0.00% 66 485 0.00% 67 543 0.00% 68 521 0.00% 69 613 0.00% 70 727 0.00% 71 834 0.00% 72 934 0.01% 73 1155 0.01% 74 1231 0.01% 75 1306 0.01% 76 1464 0.01% 77 1529 0.01% 78 1708 0.01% 79 1869 0.01% 80 2031 0.01% 81 2493 0.01% 82 2567 0.02% 83 2812 0.02% 84 3213 0.02% 85 3408 0.02% 86 3632 0.02% 87 3917 0.02% 88 4266 0.03% 89 4429 0.03% 90 4816 0.03% 91 4983 0.03% 92 5287 0.03% 93 5659 0.03% 94 6221 0.04% 95 6596 0.04% 96 6900 0.04% 97 7267 0.04% 98 7469 0.04% 99 7768 0.05% 100 8152 0.05% 101 8417 0.05% 102 8845 0.05% 103 9121 0.05% 104 9686 0.06% 105 10131 0.06% 106 10304 0.06% 107 10900 0.06% 108 11369 0.07% 109 11556 0.07% 110 11857 0.07% 111 12275 0.07% 112 12763 0.08% 113 12640 0.07% 114 12920 0.08% 115 13874 0.08% 116 14326 0.08% 117 15135 0.09% 118 15364 0.09% 119 15711 0.09% 120 16421 0.10% 121 16475 0.10% 122 16960 0.10% 123 17639 0.10% 124 17764 0.11% 125 18106 0.11% 126 19180 0.11% 127 19326 0.11% 128 19939 0.12% 129 20241 0.12% 130 21050 0.12% 131 21146 0.13% 132 21457 0.13% 133 22300 0.13% 134 22326 0.13% 135 22874 0.14% 136 23387 0.14% 137 24164 0.14% 138 24812 0.15% 139 25975 0.15% 140 26072 0.15% 141 26597 0.16% 142 26798 0.16% 143 27129 0.16% 144 27870 0.17% 145 28533 0.17% 146 28723 0.17% 147 29294 0.17% 148 30895 0.18% 149 30966 0.18% 150 32017 0.19% 151 15800369 93.62% 16876628 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=22 prefix-density=0.58 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=452.75 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=15.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=1.28 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=1.28 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.17 sequence-density-rank=21 fanout-score=21.62 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=6.1 sequence=GCAATGGCAGCCTCAGTTATGGCTTCA SRR12671390 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:34:53 Started mapping on | Feb 11 21:34:54 Finished on | Feb 11 21:36:33 Mapping speed, Million of reads per hour | 613.70 Number of input reads | 16876628 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 15919232 Uniquely mapped reads % | 94.33% Average mapped length | 297.37 Number of splices: Total | 16319189 Number of splices: Annotated (sjdb) | 16017877 Number of splices: GT/AG | 15987309 Number of splices: GC/AG | 279192 Number of splices: AT/AC | 9795 Number of splices: Non-canonical | 42893 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 371337 % of reads mapped to multiple loci | 2.20% Number of reads mapped to too many loci | 38866 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.14% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 586059 586059 586059 N_multimapping 371337 371337 371337 N_noFeature 539537 15639601 620106 N_ambiguous 308168 1324 108286 UnstrandedReadsAssigned:15071527 PositiveStrandReadsAssigned:278307 NegativeStrandReadsAssigned:15190840 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671390 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671390-trimmed-pair1.fastq SRR12671390-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,876,628 reads, 15,127,254 reads pseudoaligned [quant] estimated average fragment length: 285.926 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR12671390.ke.tsv 34699 SRR12671390.se.tsv 87100 total ==> SRR12671390.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1733.07 661 20.8466 Potri.005G024800.1.v4.1 1035 750.074 270 19.6748 Potri.004G059700.1.v4.1 961 676.308 2 0.161636 Potri.007G009000.2.v4.1 1416 1131.07 0 0 Potri.003G141000.2.v4.1 2943 2658.07 895 18.4038 Potri.016G087400.1.v4.1 270 75.7569 915 660.162 Potri.015G069301.1.v4.1 564 296.741 0 0 Potri.010G195200.1.v4.1 1773 1488.07 45.9055 1.68614 Potri.012G127500.1.v4.1 977 692.209 69 5.44834 ==> SRR12671390.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 77 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 181 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12671390 completed mapping pipeline successfully