Starting /dee2/code/volunteer_pipeline.sh SRR12671391 current disk space = 3052675100672 free memory = 1460873580 SRR12671391 SRAfilesize 35ddbdd098a3ac994d5d2b0139576541 SRR12671391.sra SRR12671391.sra file validated SRR12671391 is paired end SRR12671391 is conventional basespace SRR12671391 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671391_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6245 37.0 37.0 37.0 37.0 37.0 2 36.44075 37.0 37.0 37.0 37.0 37.0 3 36.578 37.0 37.0 37.0 37.0 37.0 4 36.647 37.0 37.0 37.0 37.0 37.0 5 36.6705 37.0 37.0 37.0 37.0 37.0 6 36.666 37.0 37.0 37.0 37.0 37.0 7 36.5395 37.0 37.0 37.0 37.0 37.0 8 36.567 37.0 37.0 37.0 37.0 37.0 9 36.6355 37.0 37.0 37.0 37.0 37.0 10-14 36.6435 37.0 37.0 37.0 37.0 37.0 15-19 36.6207 37.0 37.0 37.0 37.0 37.0 20-24 36.5761 37.0 37.0 37.0 37.0 37.0 25-29 36.5718 37.0 37.0 37.0 37.0 37.0 30-34 36.5606 37.0 37.0 37.0 37.0 37.0 35-39 36.4782 37.0 37.0 37.0 37.0 37.0 40-44 36.4948 37.0 37.0 37.0 37.0 37.0 45-49 36.460300000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.4346 37.0 37.0 37.0 37.0 37.0 55-59 36.403999999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.4172 37.0 37.0 37.0 37.0 37.0 65-69 36.400400000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.3616 37.0 37.0 37.0 37.0 37.0 75-79 36.360699999999994 37.0 37.0 37.0 37.0 37.0 80-84 36.3542 37.0 37.0 37.0 37.0 37.0 85-89 36.2617 37.0 37.0 37.0 37.0 37.0 90-94 36.2039 37.0 37.0 37.0 37.0 37.0 95-99 36.2666 37.0 37.0 37.0 37.0 37.0 100-104 36.248900000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.2535 37.0 37.0 37.0 37.0 37.0 110-114 36.1731 37.0 37.0 37.0 37.0 37.0 115-119 36.154999999999994 37.0 37.0 37.0 37.0 37.0 120-124 36.1302 37.0 37.0 37.0 37.0 37.0 125-129 36.096000000000004 37.0 37.0 37.0 37.0 37.0 130-134 36.0288 37.0 37.0 37.0 37.0 37.0 135-139 35.958000000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.8671 37.0 37.0 37.0 37.0 37.0 145-149 35.814 37.0 37.0 37.0 37.0 37.0 150-151 35.786 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 2.0 22 2.0 23 1.0 24 5.0 25 4.0 26 1.0 27 7.0 28 8.0 29 15.0 30 21.0 31 40.0 32 44.0 33 64.0 34 103.0 35 241.0 36 2929.0 37 511.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.075 11.375 6.9750000000000005 39.574999999999996 2 18.795483061480553 11.718946047678795 38.36888331242158 31.11668757841907 3 18.099999999999998 16.625 28.849999999999998 36.425000000000004 4 21.975 24.575 24.75 28.7 5 24.925 29.9 24.925 20.25 6 19.5 33.275 24.65 22.575 7 14.899999999999999 27.200000000000003 41.475 16.425 8 15.725 26.1 33.825 24.349999999999998 9 15.725 23.825 37.4 23.05 10-14 19.72 29.485 28.565 22.23 15-19 19.975 28.28 28.155 23.59 20-24 19.85 28.000000000000004 28.825 23.325000000000003 25-29 19.955000000000002 28.555000000000003 27.82 23.669999999999998 30-34 20.064999999999998 27.855 28.005000000000003 24.075 35-39 20.215 28.28 27.73 23.775 40-44 19.675 28.155 28.000000000000004 24.169999999999998 45-49 19.75 28.005000000000003 27.839999999999996 24.404999999999998 50-54 20.085 28.175 27.865000000000002 23.875 55-59 19.650000000000002 28.535 27.884999999999998 23.93 60-64 20.285 28.244999999999997 27.339999999999996 24.13 65-69 21.385 27.500000000000004 27.96 23.155 70-74 20.645 28.155 27.650000000000002 23.549999999999997 75-79 20.095 27.88 27.96 24.065 80-84 20.195 28.22 27.639999999999997 23.945 85-89 20.4 28.255000000000003 27.62 23.724999999999998 90-94 20.330000000000002 28.015 27.860000000000003 23.794999999999998 95-99 20.315 28.89 26.825 23.97 100-104 20.5 28.865000000000002 26.91 23.724999999999998 105-109 20.549999999999997 28.155 27.85 23.445 110-114 20.62 28.575 27.405 23.400000000000002 115-119 20.94 27.785 27.725 23.549999999999997 120-124 20.71 27.55 27.775 23.965 125-129 20.94 28.310000000000002 27.33 23.419999999999998 130-134 20.8 28.310000000000002 27.55 23.34 135-139 21.435000000000002 28.42 26.950000000000003 23.195 140-144 21.095 28.04 26.86 24.005000000000003 145-149 20.495 28.225 27.415 23.865 150-151 21.45 28.4125 26.724999999999998 23.4125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 1.0 20 1.5 21 2.5 22 2.5 23 1.0 24 5.5 25 8.0 26 5.5 27 7.0 28 9.5 29 13.5 30 17.0 31 22.5 32 29.0 33 41.5 34 61.5 35 83.0 36 96.0 37 111.0 38 131.0 39 160.0 40 183.5 41 182.0 42 196.5 43 229.5 44 246.5 45 246.0 46 251.5 47 255.0 48 240.5 49 240.0 50 212.5 51 166.5 52 122.5 53 77.0 54 71.0 55 71.5 56 60.0 57 40.5 58 23.0 59 18.0 60 15.5 61 9.5 62 5.0 63 5.5 64 5.0 65 2.5 66 3.0 67 1.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 85.09187907528157 71.775 2 12.151748666271487 20.5 3 2.015411973918198 5.1 4 0.6520450503852994 2.1999999999999997 5 0.05927682276229994 0.25 6 0.0 0.0 7 0.02963841138114997 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTCAGGATCAGATCCAAGACCTAGAGGATCGAAACCAAAGTCTCCAGGGA 7 0.17500000000000002 No Hit AGCCGTTCCAACAAAAGTTATACGCATCACAACTTCTAAATCATTCACAG 5 0.125 No Hit GCACTTTCAAAATTAACAAATCCAAAACATTTTGATTTACCATCAGCATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.23750000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.1125 0.0 0.0 0.0 0.0 108-109 1.2625000000000002 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.6125 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.125 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.5125 0.0 0.0 0.0 0.0 122-123 2.6375 0.0 0.0 0.0 0.0 124-125 2.7 0.0 0.0 0.0 0.0 126-127 2.8375 0.0 0.0 0.0 0.0 128-129 3.0125 0.0 0.0 0.0 0.0 130-131 3.4125 0.0 0.0 0.0 0.0 132-133 3.6875 0.0 0.0 0.0 0.0 134-135 3.8625 0.0 0.0 0.0 0.0 136-137 4.15 0.0 0.0 0.0 0.0 138-139 4.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATAAGTC 10 0.006830828 145.0 6 TCAGAAG 10 0.006830828 145.0 2 GTCAGAA 10 0.006830828 145.0 1 >>END_MODULE SRR12671391 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671391_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.414 37.0 37.0 37.0 37.0 37.0 2 36.018 37.0 37.0 37.0 37.0 37.0 3 36.082 37.0 37.0 37.0 37.0 37.0 4 36.256 37.0 37.0 37.0 37.0 37.0 5 36.2575 37.0 37.0 37.0 37.0 37.0 6 36.2165 37.0 37.0 37.0 37.0 37.0 7 36.2855 37.0 37.0 37.0 37.0 37.0 8 36.3275 37.0 37.0 37.0 37.0 37.0 9 36.263 37.0 37.0 37.0 37.0 37.0 10-14 36.3093 37.0 37.0 37.0 37.0 37.0 15-19 36.3118 37.0 37.0 37.0 37.0 37.0 20-24 36.2556 37.0 37.0 37.0 37.0 37.0 25-29 36.2084 37.0 37.0 37.0 37.0 37.0 30-34 36.2226 37.0 37.0 37.0 37.0 37.0 35-39 36.192099999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.1717 37.0 37.0 37.0 37.0 37.0 45-49 36.1508 37.0 37.0 37.0 37.0 37.0 50-54 36.161500000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.1369 37.0 37.0 37.0 37.0 37.0 60-64 36.0886 37.0 37.0 37.0 37.0 37.0 65-69 36.051300000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.028299999999994 37.0 37.0 37.0 37.0 37.0 75-79 36.0721 37.0 37.0 37.0 37.0 37.0 80-84 35.9714 37.0 37.0 37.0 37.0 37.0 85-89 35.99059999999999 37.0 37.0 37.0 37.0 37.0 90-94 35.943 37.0 37.0 37.0 37.0 37.0 95-99 35.8615 37.0 37.0 37.0 37.0 37.0 100-104 35.9054 37.0 37.0 37.0 37.0 37.0 105-109 35.8197 37.0 37.0 37.0 37.0 37.0 110-114 35.7924 37.0 37.0 37.0 37.0 37.0 115-119 35.9148 37.0 37.0 37.0 37.0 37.0 120-124 35.8217 37.0 37.0 37.0 37.0 37.0 125-129 35.825900000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.757 37.0 37.0 37.0 37.0 37.0 135-139 35.6493 37.0 37.0 37.0 37.0 37.0 140-144 35.6466 37.0 37.0 37.0 37.0 37.0 145-149 35.6348 37.0 37.0 37.0 37.0 37.0 150-151 35.289249999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 1.0 15 4.0 16 4.0 17 1.0 18 1.0 19 1.0 20 2.0 21 4.0 22 1.0 23 1.0 24 4.0 25 3.0 26 10.0 27 9.0 28 17.0 29 13.0 30 15.0 31 33.0 32 56.0 33 75.0 34 170.0 35 524.0 36 2749.0 37 298.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.125 23.35 9.3 27.224999999999998 2 25.724999999999998 26.450000000000003 32.35 15.475 3 19.775000000000002 27.150000000000002 34.975 18.099999999999998 4 24.4 34.449999999999996 22.0 19.15 5 26.125 37.425000000000004 21.224999999999998 15.225 6 19.425 41.925000000000004 21.975 16.675 7 21.65 21.325 38.35 18.675 8 18.85 26.1 30.049999999999997 25.0 9 21.099999999999998 25.25 31.674999999999997 21.975 10-14 23.86 29.294999999999998 26.105 20.74 15-19 22.66 28.215 27.500000000000004 21.625 20-24 24.005000000000003 28.470000000000002 27.500000000000004 20.025000000000002 25-29 22.99 28.23 28.235 20.544999999999998 30-34 22.435 28.46 28.42 20.685000000000002 35-39 22.375 28.625 27.845 21.154999999999998 40-44 23.385 28.04 28.12 20.455000000000002 45-49 23.53 27.584999999999997 28.08 20.805 50-54 22.835 28.92 27.67 20.575 55-59 23.21 28.215 27.644999999999996 20.93 60-64 22.725 28.415000000000003 27.57 21.29 65-69 23.39 27.685 27.815 21.11 70-74 23.82 27.485 26.99 21.705 75-79 23.87 27.175 27.665 21.29 80-84 23.06 27.555000000000003 27.825 21.560000000000002 85-89 24.075 28.165000000000003 26.924999999999997 20.835 90-94 24.035 27.85 27.63 20.485 95-99 23.635 27.889999999999997 27.915 20.560000000000002 100-104 23.7 27.384999999999998 27.93 20.985 105-109 23.215 28.335 28.134999999999998 20.315 110-114 23.765 27.634999999999998 28.065 20.535 115-119 24.175 28.48 26.400000000000002 20.945 120-124 24.235 27.589999999999996 27.589999999999996 20.585 125-129 23.91 28.02 27.400000000000002 20.669999999999998 130-134 24.72 27.815 27.525 19.939999999999998 135-139 24.615000000000002 28.415000000000003 26.77 20.200000000000003 140-144 24.05 28.110000000000003 27.805000000000003 20.035 145-149 24.902490249024904 28.112811281128113 26.367636763676366 20.617061706170617 150-151 25.362499999999997 28.3125 25.7125 20.6125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 3.0 19 3.0 20 0.5 21 1.0 22 1.5 23 2.0 24 1.5 25 1.5 26 3.5 27 5.0 28 6.0 29 11.5 30 20.5 31 26.5 32 24.5 33 30.5 34 46.5 35 58.5 36 75.0 37 89.0 38 130.5 39 180.5 40 194.0 41 216.5 42 238.0 43 274.0 44 296.0 45 280.5 46 263.0 47 256.0 48 248.5 49 204.5 50 181.0 51 153.5 52 111.5 53 84.5 54 58.5 55 43.5 56 39.5 57 31.0 58 25.5 59 21.5 60 14.5 61 10.5 62 4.0 63 4.0 64 3.5 65 1.5 66 0.5 67 1.5 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 1.0 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.2 #Duplication Level Percentage of deduplicated Percentage of total 1 85.0059382422803 71.575 2 12.292161520190023 20.7 3 1.8705463182897861 4.725 4 0.6532066508313539 2.1999999999999997 5 0.14845605700712589 0.625 6 0.0 0.0 7 0.02969121140142518 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAATCTTTTGGCCACAAAAATGGCTTCTGTTTGTGCTTCTTCTGCCAT 7 0.17500000000000002 No Hit GACAGAGATGGTGCTCTATATAGCATAAAATTCAACAATGTATTTGTGAA 5 0.125 No Hit GAACAACTTCGTATTTAGTTCATCCATTTGCTTCATCAATCAATCACCAT 5 0.125 No Hit GGAACTTTATCACCTTTCCTGGCAGCAAGCCAATCTACTATGGAAGAACA 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.4375 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.6375 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.175 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.5625 0.0 0.0 0.0 0.0 122-123 2.6875 0.0 0.0 0.0 0.0 124-125 2.75 0.0 0.0 0.0 0.0 126-127 2.8875 0.0 0.0 0.0 0.0 128-129 3.0625 0.0 0.0 0.0 0.0 130-131 3.5 0.0 0.0 0.0 0.0 132-133 3.7750000000000004 0.0 0.0 0.0 0.0 134-135 3.9625 0.0 0.0 0.0 0.0 136-137 4.25 0.0 0.0 0.0 0.0 138-139 4.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1166140 spots for SRR12671391.sra Written 1166140 spots for SRR12671391.sra Read 1166140 spots for SRR12671391.sra Written 1166140 spots for SRR12671391.sra Read 1166140 spots for SRR12671391.sra Written 1166140 spots for SRR12671391.sra Read 1166140 spots for SRR12671391.sra Written 1166140 spots for SRR12671391.sra Read 1166140 spots for SRR12671391.sra Written 1166140 spots for SRR12671391.sra Read 1166140 spots for SRR12671391.sra Written 1166140 spots for SRR12671391.sra Read 1166140 spots for SRR12671391.sra Written 1166140 spots for SRR12671391.sra Read 1166140 spots for SRR12671391.sra Written 1166140 spots for SRR12671391.sra Read 1166140 spots for SRR12671391.sra Written 1166140 spots for SRR12671391.sra Read 1166140 spots for SRR12671391.sra Written 1166140 spots for SRR12671391.sra Read 1166140 spots for SRR12671391.sra Written 1166140 spots for SRR12671391.sra Read 1166140 spots for SRR12671391.sra Written 1166140 spots for SRR12671391.sra Read 1166140 spots for SRR12671391.sra Written 1166140 spots for SRR12671391.sra Read 1166140 spots for SRR12671391.sra Written 1166140 spots for SRR12671391.sra Read 1166140 spots for SRR12671391.sra Written 1166140 spots for SRR12671391.sra Read 1166140 spots for SRR12671391.sra Written 1166140 spots for SRR12671391.sra Read 1166140 spots for SRR12671391.sra Written 1166140 spots for SRR12671391.sra Read 1166140 spots for SRR12671391.sra Written 1166140 spots for SRR12671391.sra Read 1166140 spots for SRR12671391.sra Written 1166140 spots for SRR12671391.sra Read 1166159 spots for SRR12671391.sra Written 1166159 spots for SRR12671391.sra SRR ids: ['SRR12671391.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lnu1hryc SRR12671391.sra spots: 23322819 blocks: [[1, 1166140], [1166141, 2332280], [2332281, 3498420], [3498421, 4664560], [4664561, 5830700], [5830701, 6996840], [6996841, 8162980], [8162981, 9329120], [9329121, 10495260], [10495261, 11661400], [11661401, 12827540], [12827541, 13993680], [13993681, 15159820], [15159821, 16325960], [16325961, 17492100], [17492101, 18658240], [18658241, 19824380], [19824381, 20990520], [20990521, 22156660], [22156661, 23322819]] SRR12671391 file size 7904413 SRR12671391 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671391 SRR12671391_1.fastq SRR12671391_2.fastq Input file: SRR12671391_1.fastq Paired file: SRR12671391_2.fastq trimmed: SRR12671391-trimmed-pair1.fastq, SRR12671391-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:26:58 2025 >> started Tue Feb 11 21:27:27 2025 >> done (29.271s) 23322819 read pairs processed; of these: 142 ( 0.00%) short read pairs filtered out after trimming by size control 3553 ( 0.02%) empty read pairs filtered out after trimming by size control 23319124 (99.98%) read pairs available; of these: 1737921 ( 7.45%) trimmed read pairs available after processing 21581203 (92.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 8 0.00% 20 15 0.00% 21 18 0.00% 22 20 0.00% 23 19 0.00% 24 11 0.00% 25 19 0.00% 26 18 0.00% 27 26 0.00% 28 36 0.00% 29 20 0.00% 30 22 0.00% 31 23 0.00% 32 31 0.00% 33 30 0.00% 34 22 0.00% 35 26 0.00% 36 28 0.00% 37 27 0.00% 38 34 0.00% 39 43 0.00% 40 47 0.00% 41 50 0.00% 42 47 0.00% 43 51 0.00% 44 42 0.00% 45 30 0.00% 46 66 0.00% 47 57 0.00% 48 72 0.00% 49 84 0.00% 50 105 0.00% 51 119 0.00% 52 136 0.00% 53 148 0.00% 54 136 0.00% 55 153 0.00% 56 157 0.00% 57 219 0.00% 58 217 0.00% 59 281 0.00% 60 311 0.00% 61 368 0.00% 62 406 0.00% 63 442 0.00% 64 502 0.00% 65 510 0.00% 66 561 0.00% 67 652 0.00% 68 773 0.00% 69 880 0.00% 70 996 0.00% 71 1159 0.00% 72 1286 0.01% 73 1402 0.01% 74 1663 0.01% 75 1889 0.01% 76 1968 0.01% 77 2233 0.01% 78 2436 0.01% 79 2657 0.01% 80 2938 0.01% 81 3304 0.01% 82 3678 0.02% 83 4026 0.02% 84 4401 0.02% 85 4994 0.02% 86 5505 0.02% 87 5733 0.02% 88 6054 0.03% 89 6447 0.03% 90 6863 0.03% 91 7497 0.03% 92 7801 0.03% 93 8507 0.04% 94 9277 0.04% 95 9799 0.04% 96 10491 0.04% 97 11167 0.05% 98 11400 0.05% 99 12018 0.05% 100 12152 0.05% 101 12565 0.05% 102 13472 0.06% 103 14055 0.06% 104 14567 0.06% 105 15279 0.07% 106 16352 0.07% 107 16782 0.07% 108 17596 0.08% 109 18280 0.08% 110 18415 0.08% 111 18894 0.08% 112 19589 0.08% 113 20275 0.09% 114 21053 0.09% 115 21940 0.09% 116 22646 0.10% 117 23726 0.10% 118 24920 0.11% 119 25065 0.11% 120 26459 0.11% 121 26677 0.11% 122 26824 0.12% 123 27833 0.12% 124 28950 0.12% 125 29374 0.13% 126 31013 0.13% 127 31583 0.14% 128 32542 0.14% 129 33440 0.14% 130 34390 0.15% 131 34571 0.15% 132 35431 0.15% 133 36746 0.16% 134 37074 0.16% 135 37859 0.16% 136 39146 0.17% 137 40090 0.17% 138 41027 0.18% 139 42982 0.18% 140 43714 0.19% 141 44281 0.19% 142 44666 0.19% 143 45674 0.20% 144 47469 0.20% 145 47435 0.20% 146 48767 0.21% 147 49842 0.21% 148 51873 0.22% 149 51543 0.22% 150 53300 0.23% 151 21581203 92.55% 23319124 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=23 prefix-density=0.58 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=347.05 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=15.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=25 prefix-density=0.93 prefix-fanout=2.0 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=25 fanout-score=25.16 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=7.1 sequence=AAAAAAGAAAGATGGCCTCGGCATCATTTCTCAAGTCATCACCAGTTCTAGACAAGTCTGAGTTTGTTAAGGGTCAGACCCTCCGCTTGCCTTCTGCCTCCATTGTCCGGTGCCGCTCCACCGCCCCTTCTGCTCTTACCGTTCGTGCTGGTTCCTATGCTGAGGAGCTTGTCAAAACCGCGAAAACAATTGCATCTCCTGGCCGAGGTATTTTGGCCATGGATGAGTCTAACGCTACCTGTGGAAAACGTCTCGCCTCAATCGGGCTAGAGAACACCGAGGCTAACCGCCAGGCATACCGTACCCTTCTTGTGACAGTCCCTGGCCTTGGTGATTACGTCTCTGGTGCCATCCTTTTTGAGGAGACTCTCTACCAATCCAC SRR12671391 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:28:10 Started mapping on | Feb 11 21:28:11 Finished on | Feb 11 21:30:38 Mapping speed, Million of reads per hour | 571.08 Number of input reads | 23319124 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 22067771 Uniquely mapped reads % | 94.63% Average mapped length | 297.06 Number of splices: Total | 22353265 Number of splices: Annotated (sjdb) | 21946313 Number of splices: GT/AG | 21907369 Number of splices: GC/AG | 375485 Number of splices: AT/AC | 12461 Number of splices: Non-canonical | 57950 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.98 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 510416 % of reads mapped to multiple loci | 2.19% Number of reads mapped to too many loci | 38072 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.92% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 740937 740937 740937 N_multimapping 510416 510416 510416 N_noFeature 734560 21646794 884741 N_ambiguous 418171 1752 146230 UnstrandedReadsAssigned:20915040 PositiveStrandReadsAssigned:419225 NegativeStrandReadsAssigned:21036800 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671391 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671391-trimmed-pair1.fastq SRR12671391-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,319,124 reads, 20,987,595 reads pseudoaligned [quant] estimated average fragment length: 265.444 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR12671391.ke.tsv 34699 SRR12671391.se.tsv 87100 total ==> SRR12671391.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.56 761 16.6587 Potri.005G024800.1.v4.1 1035 770.556 271 13.5003 Potri.004G059700.1.v4.1 961 696.654 2 0.110202 Potri.007G009000.2.v4.1 1416 1151.56 0 0 Potri.003G141000.2.v4.1 2943 2678.56 1352 19.3755 Potri.016G087400.1.v4.1 270 77.3405 994 493.351 Potri.015G069301.1.v4.1 564 310.783 0 0 Potri.010G195200.1.v4.1 1773 1508.56 147 3.74053 Potri.012G127500.1.v4.1 977 712.633 184 9.91126 ==> SRR12671391.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 83 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 328 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12671391 completed mapping pipeline successfully