Starting /dee2/code/volunteer_pipeline.sh SRR12671392 current disk space = 3052615106560 free memory = 1427703388 SRR12671392 SRAfilesize 4c7ecc757c087bc15647cf5bede14081 SRR12671392.sra SRR12671392.sra file validated SRR12671392 is paired end SRR12671392 is conventional basespace SRR12671392 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671392_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5335 37.0 37.0 37.0 37.0 37.0 2 36.28875 37.0 37.0 37.0 37.0 37.0 3 36.4695 37.0 37.0 37.0 37.0 37.0 4 36.582 37.0 37.0 37.0 37.0 37.0 5 36.58 37.0 37.0 37.0 37.0 37.0 6 36.575 37.0 37.0 37.0 37.0 37.0 7 36.5685 37.0 37.0 37.0 37.0 37.0 8 36.5385 37.0 37.0 37.0 37.0 37.0 9 36.512 37.0 37.0 37.0 37.0 37.0 10-14 36.5737 37.0 37.0 37.0 37.0 37.0 15-19 36.5145 37.0 37.0 37.0 37.0 37.0 20-24 36.461999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.417199999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.3543 37.0 37.0 37.0 37.0 37.0 35-39 36.299899999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.224900000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.148199999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.1759 37.0 37.0 37.0 37.0 37.0 55-59 36.1298 37.0 37.0 37.0 37.0 37.0 60-64 36.11 37.0 37.0 37.0 37.0 37.0 65-69 36.0749 37.0 37.0 37.0 37.0 37.0 70-74 36.060900000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.0813 37.0 37.0 37.0 37.0 37.0 80-84 36.0515 37.0 37.0 37.0 37.0 37.0 85-89 35.9596 37.0 37.0 37.0 37.0 37.0 90-94 35.983399999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.974700000000006 37.0 37.0 37.0 37.0 37.0 100-104 35.8839 37.0 37.0 37.0 37.0 37.0 105-109 35.9092 37.0 37.0 37.0 37.0 37.0 110-114 35.861599999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.832 37.0 37.0 37.0 37.0 37.0 120-124 35.8559 37.0 37.0 37.0 37.0 37.0 125-129 35.7988 37.0 37.0 37.0 37.0 37.0 130-134 35.8224 37.0 37.0 37.0 37.0 37.0 135-139 35.7288 37.0 37.0 37.0 37.0 37.0 140-144 35.7245 37.0 37.0 37.0 37.0 37.0 145-149 35.6711 37.0 37.0 37.0 37.0 37.0 150-151 35.593500000000006 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 1.0 19 1.0 20 7.0 21 4.0 22 8.0 23 7.0 24 16.0 25 12.0 26 8.0 27 11.0 28 18.0 29 17.0 30 30.0 31 35.0 32 41.0 33 71.0 34 118.0 35 267.0 36 2885.0 37 441.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.05 13.3 7.9 26.75 2 20.170383362565772 13.004259584064146 35.63016787772489 31.1951891756452 3 16.3 22.075 35.825 25.8 4 21.65 26.650000000000002 27.425 24.275 5 20.150000000000002 35.35 25.55 18.95 6 19.325 37.6 24.5 18.575 7 14.399999999999999 26.1 42.5 17.0 8 15.225 24.575 33.425 26.775 9 16.675 22.25 35.55 25.525 10-14 20.65 28.645 28.4 22.305 15-19 19.85 28.355000000000004 28.16 23.635 20-24 19.759999999999998 28.415000000000003 27.99 23.835 25-29 20.355 28.585 28.22 22.84 30-34 19.96 29.225 27.250000000000004 23.565 35-39 19.96 28.865000000000002 27.605 23.57 40-44 20.355 29.39 27.500000000000004 22.755 45-49 20.39 29.099999999999998 27.68 22.830000000000002 50-54 20.115 28.825 27.529999999999998 23.53 55-59 20.09 29.044999999999998 27.305 23.56 60-64 20.405 28.99 27.6 23.005 65-69 20.26 29.9 26.69 23.150000000000002 70-74 20.51 28.115000000000002 27.55 23.825 75-79 20.805 28.155 27.750000000000004 23.29 80-84 20.71 28.349999999999998 27.505000000000003 23.435 85-89 20.51 28.59 27.55 23.35 90-94 20.424999999999997 28.28 27.715 23.580000000000002 95-99 20.544999999999998 28.744999999999997 26.724999999999998 23.985 100-104 20.665 28.62 27.455000000000002 23.26 105-109 21.34 29.054999999999996 26.435 23.169999999999998 110-114 20.66 28.87 27.665 22.805 115-119 20.62 29.365000000000002 26.479999999999997 23.535 120-124 20.8 28.775000000000002 27.284999999999997 23.14 125-129 21.135 27.96 27.095000000000002 23.810000000000002 130-134 21.575 28.305000000000003 26.69 23.43 135-139 21.88 28.535 27.060000000000002 22.525000000000002 140-144 21.759999999999998 28.505000000000003 26.365 23.369999999999997 145-149 21.46 28.494999999999997 25.61 24.435000000000002 150-151 21.675 27.625 26.650000000000002 24.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 2.5 2 2.0 3 2.0 4 1.5 5 2.0 6 1.5 7 2.0 8 4.0 9 4.5 10 3.0 11 2.0 12 2.0 13 4.0 14 2.5 15 1.0 16 2.0 17 2.0 18 1.0 19 0.0 20 0.5 21 2.0 22 4.0 23 5.0 24 5.5 25 7.0 26 8.5 27 7.5 28 17.0 29 27.0 30 25.5 31 30.5 32 34.5 33 42.0 34 60.0 35 70.0 36 85.5 37 108.0 38 117.5 39 138.0 40 173.0 41 206.0 42 231.0 43 220.5 44 225.0 45 245.5 46 257.5 47 254.0 48 218.0 49 210.5 50 196.5 51 159.0 52 130.0 53 108.0 54 81.5 55 60.5 56 52.5 57 34.5 58 26.0 59 19.5 60 12.0 61 9.5 62 4.0 63 4.0 64 4.5 65 6.0 66 6.5 67 2.5 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.075 #Duplication Level Percentage of deduplicated Percentage of total 1 85.31073446327684 71.72500000000001 2 11.656259292298543 19.6 3 2.289622360987214 5.775 4 0.5947071067499257 2.0 5 0.08920606601248886 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02973535533749628 0.22499999999999998 >10 0.02973535533749628 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 12 0.3 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATAGGCTATCTCGTAT 9 0.22499999999999998 TruSeq Adapter, Index 9 (97% over 36bp) GGAGCACCTCATCACTCACTACACCCTTCACATAACCTTTCAAACGGTTC 5 0.125 No Hit GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 5 0.125 No Hit TTAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.425 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.8624999999999998 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.3 0.0 0.0 0.0 0.0 120-121 2.425 0.0 0.0 0.0 0.0 122-123 2.7125000000000004 0.0 0.0 0.0 0.0 124-125 3.0999999999999996 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.6875 0.0 0.0 0.0 0.0 130-131 4.137499999999999 0.0 0.0 0.0 0.0 132-133 4.637499999999999 0.0 0.0 0.0 0.0 134-135 5.0625 0.0 0.0 0.0 0.0 136-137 5.574999999999999 0.0 0.0 0.0 0.0 138-139 5.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACAAT 10 0.006830828 145.0 1 ATCTGTT 10 0.006830828 145.0 6 >>END_MODULE SRR12671392 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671392_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.97 37.0 37.0 37.0 37.0 37.0 2 35.8815 37.0 37.0 37.0 37.0 37.0 3 35.957 37.0 37.0 37.0 37.0 37.0 4 36.085 37.0 37.0 37.0 37.0 37.0 5 35.9925 37.0 37.0 37.0 37.0 37.0 6 36.018 37.0 37.0 37.0 37.0 37.0 7 36.002 37.0 37.0 37.0 37.0 37.0 8 35.9555 37.0 37.0 37.0 37.0 37.0 9 35.866 37.0 37.0 37.0 37.0 37.0 10-14 35.862199999999994 37.0 37.0 37.0 37.0 37.0 15-19 35.7461 37.0 37.0 37.0 37.0 37.0 20-24 35.62329999999999 37.0 37.0 37.0 37.0 37.0 25-29 35.6018 37.0 37.0 37.0 37.0 37.0 30-34 35.5674 37.0 37.0 37.0 37.0 37.0 35-39 35.4732 37.0 37.0 37.0 37.0 37.0 40-44 35.4324 37.0 37.0 37.0 37.0 37.0 45-49 35.4176 37.0 37.0 37.0 37.0 37.0 50-54 35.4163 37.0 37.0 37.0 37.0 37.0 55-59 35.3323 37.0 37.0 37.0 37.0 37.0 60-64 35.3953 37.0 37.0 37.0 37.0 37.0 65-69 35.3957 37.0 37.0 37.0 37.0 37.0 70-74 35.3371 37.0 37.0 37.0 37.0 37.0 75-79 35.3043 37.0 37.0 37.0 37.0 37.0 80-84 35.2666 37.0 37.0 37.0 37.0 37.0 85-89 35.3108 37.0 37.0 37.0 37.0 37.0 90-94 35.2961 37.0 37.0 37.0 37.0 37.0 95-99 35.241 37.0 37.0 37.0 37.0 37.0 100-104 35.2331 37.0 37.0 37.0 34.6 37.0 105-109 35.16160000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.1533 37.0 37.0 37.0 34.6 37.0 115-119 35.1696 37.0 37.0 37.0 37.0 37.0 120-124 35.1931 37.0 37.0 37.0 34.6 37.0 125-129 35.0916 37.0 37.0 37.0 27.4 37.0 130-134 34.9991 37.0 37.0 37.0 29.8 37.0 135-139 34.973400000000005 37.0 37.0 37.0 27.4 37.0 140-144 34.9628 37.0 37.0 37.0 25.0 37.0 145-149 34.8866 37.0 37.0 37.0 25.0 37.0 150-151 34.69775 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 6.0 13 15.0 14 27.0 15 16.0 16 6.0 17 3.0 18 8.0 19 5.0 20 5.0 21 8.0 22 12.0 23 10.0 24 12.0 25 16.0 26 17.0 27 14.0 28 23.0 29 26.0 30 30.0 31 42.0 32 52.0 33 97.0 34 177.0 35 481.0 36 2633.0 37 258.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 58.099999999999994 19.725 7.6499999999999995 14.524999999999999 2 30.425 19.325 29.625 20.625 3 24.6 25.074999999999996 34.55 15.775 4 26.650000000000002 31.974999999999998 22.25 19.125 5 26.325 36.925000000000004 19.625 17.125 6 24.45 37.35 20.349999999999998 17.849999999999998 7 24.55 23.400000000000002 33.800000000000004 18.25 8 22.375 25.424999999999997 28.449999999999996 23.75 9 24.5 23.525 27.125 24.85 10-14 25.895000000000003 27.525 25.56 21.02 15-19 25.185000000000002 27.76 26.735 20.32 20-24 24.740000000000002 27.63 26.985 20.645 25-29 25.085 27.68 27.12 20.115 30-34 24.8 27.694999999999997 26.865 20.64 35-39 24.08 27.935 27.455000000000002 20.53 40-44 24.759999999999998 28.26 27.05 19.93 45-49 23.77 27.905 27.55 20.775 50-54 23.419999999999998 28.1 27.500000000000004 20.979999999999997 55-59 24.135 27.925 27.185 20.755000000000003 60-64 23.56 28.52 27.279999999999998 20.64 65-69 23.9 27.985 27.310000000000002 20.805 70-74 24.79 28.13 26.275 20.805 75-79 24.104999999999997 28.384999999999998 26.534999999999997 20.974999999999998 80-84 24.404999999999998 28.689999999999998 26.415 20.49 85-89 24.03 27.92 27.224999999999998 20.825 90-94 24.235 28.505000000000003 26.490000000000002 20.77 95-99 24.235 28.835 26.700000000000003 20.23 100-104 23.955000000000002 28.494999999999997 27.26 20.29 105-109 24.215 28.43 27.089999999999996 20.265 110-114 24.52 28.410000000000004 27.05 20.02 115-119 24.39 27.845 27.455000000000002 20.31 120-124 24.69 28.610000000000003 26.735 19.965 125-129 24.68 28.935 26.345000000000002 20.04 130-134 25.259999999999998 28.294999999999998 26.474999999999998 19.97 135-139 25.385 28.32 26.61 19.685 140-144 25.005 28.849999999999998 26.36 19.785 145-149 25.942594259425945 27.847784778477845 26.667666766676668 19.541954195419542 150-151 26.4125 28.050000000000004 26.437500000000004 19.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.0 4 0.5 5 1.5 6 2.0 7 1.0 8 2.0 9 3.0 10 3.0 11 2.0 12 1.0 13 2.0 14 2.5 15 2.5 16 2.5 17 1.5 18 1.5 19 1.0 20 1.0 21 2.5 22 3.5 23 2.5 24 3.5 25 4.0 26 7.0 27 11.0 28 9.0 29 9.0 30 15.0 31 16.0 32 21.0 33 34.5 34 34.0 35 43.0 36 75.0 37 99.0 38 123.0 39 150.0 40 164.0 41 197.0 42 221.5 43 235.0 44 241.0 45 234.5 46 264.5 47 266.0 48 242.5 49 236.0 50 180.5 51 129.0 52 117.0 53 102.5 54 97.0 55 84.0 56 68.0 57 48.0 58 28.0 59 20.5 60 13.5 61 13.0 62 11.5 63 9.5 64 8.5 65 3.5 66 1.0 67 2.0 68 2.0 69 0.5 70 1.0 71 1.5 72 1.5 73 3.0 74 2.5 75 1.0 76 1.0 77 1.0 78 1.0 79 0.5 80 1.5 81 1.5 82 0.5 83 1.0 84 1.0 85 1.0 86 0.5 87 0.5 88 1.0 89 1.5 90 2.5 91 1.5 92 1.0 93 3.0 94 2.0 95 0.5 96 0.5 97 2.0 98 3.0 99 2.5 100 11.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.475 #Duplication Level Percentage of deduplicated Percentage of total 1 86.03137022787807 72.675 2 11.038768866528558 18.65 3 2.3083752589523527 5.8500000000000005 4 0.4439183190292986 1.5 5 0.08878366380585972 0.375 6 0.029594554601953243 0.15 7 0.0 0.0 8 0.029594554601953243 0.2 9 0.0 0.0 >10 0.029594554601953243 0.6 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 24 0.6 No Hit GGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGT 8 0.2 No Hit CAAATGGCCACTACTGCTTCTCCAATGGCCAGCCAGCTCAAAAGCAGCCT 6 0.15 No Hit GATACCTGTCACTTGTTCTGGGGTGTCTGCTAGACAACGAAGGGTGAATA 5 0.125 No Hit GTTCAATGCATGCAGGTGTGGCCACCAACTGGATTGAAGAAGTTCGAGAC 5 0.125 No Hit GCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.1875 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.575 0.0 0.0 0.0 0.0 114-115 1.8624999999999998 0.0 0.0 0.0 0.0 116-117 2.05 0.0 0.0 0.0 0.0 118-119 2.3 0.0 0.0 0.0 0.0 120-121 2.425 0.0 0.0 0.0 0.0 122-123 2.7125000000000004 0.0 0.0 0.0 0.0 124-125 3.0999999999999996 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.6875 0.0 0.0 0.0 0.0 130-131 4.112500000000001 0.0 0.0 0.0 0.0 132-133 4.612500000000001 0.0 0.0 0.0 0.0 134-135 5.0375 0.0 0.0 0.0 0.0 136-137 5.550000000000001 0.0 0.0 0.0 0.0 138-139 5.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTCAGA 10 0.006830828 145.0 1 >>END_MODULE Read 771791 spots for SRR12671392.sra Written 771791 spots for SRR12671392.sra Read 771791 spots for SRR12671392.sra Written 771791 spots for SRR12671392.sra Read 771791 spots for SRR12671392.sra Written 771791 spots for SRR12671392.sra Read 771791 spots for SRR12671392.sra Written 771791 spots for SRR12671392.sra Read 771791 spots for SRR12671392.sra Written 771791 spots for SRR12671392.sra Read 771791 spots for SRR12671392.sra Written 771791 spots for SRR12671392.sra Read 771791 spots for SRR12671392.sra Written 771791 spots for SRR12671392.sra Read 771791 spots for SRR12671392.sra Written 771791 spots for SRR12671392.sra Read 771791 spots for SRR12671392.sra Written 771791 spots for SRR12671392.sra Read 771791 spots for SRR12671392.sra Written 771791 spots for SRR12671392.sra Read 771791 spots for SRR12671392.sra Written 771791 spots for SRR12671392.sra Read 771791 spots for SRR12671392.sra Written 771791 spots for SRR12671392.sra Read 771791 spots for SRR12671392.sra Written 771791 spots for SRR12671392.sra Read 771791 spots for SRR12671392.sra Written 771791 spots for SRR12671392.sra Read 771791 spots for SRR12671392.sra Written 771791 spots for SRR12671392.sra Read 771791 spots for SRR12671392.sra Written 771791 spots for SRR12671392.sra Read 771791 spots for SRR12671392.sra Written 771791 spots for SRR12671392.sra Read 771791 spots for SRR12671392.sra Written 771791 spots for SRR12671392.sra Read 771791 spots for SRR12671392.sra Written 771791 spots for SRR12671392.sra Read 771802 spots for SRR12671392.sra Written 771802 spots for SRR12671392.sra SRR ids: ['SRR12671392.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p1pkdedr SRR12671392.sra spots: 15435831 blocks: [[1, 771791], [771792, 1543582], [1543583, 2315373], [2315374, 3087164], [3087165, 3858955], [3858956, 4630746], [4630747, 5402537], [5402538, 6174328], [6174329, 6946119], [6946120, 7717910], [7717911, 8489701], [8489702, 9261492], [9261493, 10033283], [10033284, 10805074], [10805075, 11576865], [11576866, 12348656], [12348657, 13120447], [13120448, 13892238], [13892239, 14664029], [14664030, 15435831]] SRR12671392 file size 5224070 SRR12671392 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671392 SRR12671392_1.fastq SRR12671392_2.fastq Input file: SRR12671392_1.fastq Paired file: SRR12671392_2.fastq trimmed: SRR12671392-trimmed-pair1.fastq, SRR12671392-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:43:17 2025 >> started Tue Feb 11 21:43:42 2025 >> done (25.077s) 15435831 read pairs processed; of these: 453 ( 0.00%) short read pairs filtered out after trimming by size control 33166 ( 0.21%) empty read pairs filtered out after trimming by size control 15402212 (99.78%) read pairs available; of these: 1308585 ( 8.50%) trimmed read pairs available after processing 14093627 (91.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 47 0.00% 19 42 0.00% 20 61 0.00% 21 46 0.00% 22 72 0.00% 23 83 0.00% 24 95 0.00% 25 114 0.00% 26 147 0.00% 27 93 0.00% 28 128 0.00% 29 107 0.00% 30 132 0.00% 31 113 0.00% 32 84 0.00% 33 102 0.00% 34 83 0.00% 35 88 0.00% 36 94 0.00% 37 73 0.00% 38 107 0.00% 39 117 0.00% 40 91 0.00% 41 84 0.00% 42 79 0.00% 43 91 0.00% 44 84 0.00% 45 98 0.00% 46 98 0.00% 47 98 0.00% 48 108 0.00% 49 131 0.00% 50 131 0.00% 51 151 0.00% 52 140 0.00% 53 171 0.00% 54 162 0.00% 55 196 0.00% 56 215 0.00% 57 222 0.00% 58 251 0.00% 59 278 0.00% 60 358 0.00% 61 441 0.00% 62 430 0.00% 63 591 0.00% 64 518 0.00% 65 622 0.00% 66 682 0.00% 67 802 0.01% 68 883 0.01% 69 977 0.01% 70 1105 0.01% 71 1213 0.01% 72 1372 0.01% 73 1548 0.01% 74 1694 0.01% 75 1828 0.01% 76 1916 0.01% 77 2284 0.01% 78 2335 0.02% 79 2621 0.02% 80 2804 0.02% 81 3132 0.02% 82 3653 0.02% 83 3755 0.02% 84 4157 0.03% 85 4419 0.03% 86 4483 0.03% 87 4658 0.03% 88 4838 0.03% 89 5271 0.03% 90 5732 0.04% 91 6244 0.04% 92 6624 0.04% 93 7258 0.05% 94 7617 0.05% 95 8125 0.05% 96 8285 0.05% 97 8664 0.06% 98 8481 0.06% 99 8856 0.06% 100 9671 0.06% 101 10130 0.07% 102 10747 0.07% 103 11098 0.07% 104 11955 0.08% 105 12652 0.08% 106 12314 0.08% 107 12708 0.08% 108 12945 0.08% 109 13256 0.09% 110 13221 0.09% 111 14755 0.10% 112 15343 0.10% 113 15786 0.10% 114 16433 0.11% 115 17141 0.11% 116 17514 0.11% 117 18057 0.12% 118 18014 0.12% 119 18534 0.12% 120 18904 0.12% 121 19336 0.13% 122 20199 0.13% 123 21559 0.14% 124 22518 0.15% 125 22919 0.15% 126 23547 0.15% 127 23795 0.15% 128 23965 0.16% 129 24799 0.16% 130 24795 0.16% 131 24974 0.16% 132 25870 0.17% 133 27351 0.18% 134 28237 0.18% 135 29366 0.19% 136 28970 0.19% 137 29860 0.19% 138 30043 0.20% 139 30575 0.20% 140 30211 0.20% 141 31410 0.20% 142 31261 0.20% 143 33011 0.21% 144 34674 0.23% 145 35278 0.23% 146 35560 0.23% 147 35734 0.23% 148 36634 0.24% 149 36533 0.24% 150 38240 0.25% 151 14093627 91.50% 15402212 reads passed initial QC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=17 prefix-density=0.83 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=205.55 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=11.6 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=1.11 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=21 prefix-density=1.12 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=12.73 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.2 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGTATGCTTTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR12671392 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:44:38 Started mapping on | Feb 11 21:44:38 Finished on | Feb 11 21:47:03 Mapping speed, Million of reads per hour | 382.40 Number of input reads | 15402212 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 13267253 Uniquely mapped reads % | 86.14% Average mapped length | 295.36 Number of splices: Total | 12918152 Number of splices: Annotated (sjdb) | 12667779 Number of splices: GT/AG | 12644832 Number of splices: GC/AG | 228323 Number of splices: AT/AC | 7497 Number of splices: Non-canonical | 37500 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 323199 % of reads mapped to multiple loci | 2.10% Number of reads mapped to too many loci | 29260 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.02% % of reads unmapped: other | 0.55% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1811760 1811760 1811760 N_multimapping 323199 323199 323199 N_noFeature 413546 13002942 491604 N_ambiguous 279816 1057 93077 UnstrandedReadsAssigned:12573891 PositiveStrandReadsAssigned:263254 NegativeStrandReadsAssigned:12682572 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671392 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671392-trimmed-pair1.fastq SRR12671392-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,402,212 reads, 12,939,014 reads pseudoaligned [quant] estimated average fragment length: 267.833 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,309 rounds 52401 SRR12671392.ke.tsv 34699 SRR12671392.se.tsv 87100 total ==> SRR12671392.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.17 347 12.4791 Potri.005G024800.1.v4.1 1035 768.167 160 13.1174 Potri.004G059700.1.v4.1 961 694.329 3 0.272106 Potri.007G009000.2.v4.1 1416 1149.17 0 0 Potri.003G141000.2.v4.1 2943 2676.17 795.095 18.7106 Potri.016G087400.1.v4.1 270 82.5308 506 386.115 Potri.015G069301.1.v4.1 564 313.56 0 0 Potri.010G195200.1.v4.1 1773 1506.17 42 1.75614 Potri.012G127500.1.v4.1 977 710.263 135 11.9701 ==> SRR12671392.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 120 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 225 Potri.001G212900.v4.1 35 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671392 completed mapping pipeline successfully