Starting /dee2/code/volunteer_pipeline.sh SRR12671393 current disk space = 3052573511680 free memory = 1467878236 SRR12671393 SRAfilesize ec9be88cb8f1edbc7941944b5f2fb926 SRR12671393.sra SRR12671393.sra file validated SRR12671393 is paired end SRR12671393 is conventional basespace SRR12671393 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671393_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.367 37.0 37.0 37.0 37.0 37.0 2 36.03925 37.0 37.0 37.0 37.0 37.0 3 36.4265 37.0 37.0 37.0 37.0 37.0 4 36.4545 37.0 37.0 37.0 37.0 37.0 5 36.4535 37.0 37.0 37.0 37.0 37.0 6 36.497 37.0 37.0 37.0 37.0 37.0 7 36.418 37.0 37.0 37.0 37.0 37.0 8 36.546 37.0 37.0 37.0 37.0 37.0 9 36.541 37.0 37.0 37.0 37.0 37.0 10-14 36.5407 37.0 37.0 37.0 37.0 37.0 15-19 36.535199999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5142 37.0 37.0 37.0 37.0 37.0 25-29 36.4644 37.0 37.0 37.0 37.0 37.0 30-34 36.4517 37.0 37.0 37.0 37.0 37.0 35-39 36.489 37.0 37.0 37.0 37.0 37.0 40-44 36.4236 37.0 37.0 37.0 37.0 37.0 45-49 36.428399999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.398799999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.383399999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.3432 37.0 37.0 37.0 37.0 37.0 65-69 36.2984 37.0 37.0 37.0 37.0 37.0 70-74 36.3178 37.0 37.0 37.0 37.0 37.0 75-79 36.3174 37.0 37.0 37.0 37.0 37.0 80-84 36.2263 37.0 37.0 37.0 37.0 37.0 85-89 36.18339999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.2055 37.0 37.0 37.0 37.0 37.0 95-99 36.1622 37.0 37.0 37.0 37.0 37.0 100-104 36.1913 37.0 37.0 37.0 37.0 37.0 105-109 36.191500000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.9939 37.0 37.0 37.0 37.0 37.0 115-119 36.051100000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.079 37.0 37.0 37.0 37.0 37.0 125-129 36.00940000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.9375 37.0 37.0 37.0 37.0 37.0 135-139 35.92399999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.7851 37.0 37.0 37.0 37.0 37.0 145-149 35.690200000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.6045 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 1.0 21 0.0 22 2.0 23 1.0 24 1.0 25 1.0 26 2.0 27 7.0 28 9.0 29 14.0 30 17.0 31 32.0 32 42.0 33 100.0 34 146.0 35 361.0 36 2925.0 37 338.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.224999999999994 10.775 5.2 39.800000000000004 2 18.35966892400301 13.844996237772762 40.63205417607224 27.163280662151994 3 18.7 17.75 27.500000000000004 36.05 4 21.275 24.474999999999998 25.674999999999997 28.575 5 21.925 32.275 25.3 20.5 6 18.675 33.45 25.474999999999998 22.400000000000002 7 15.475 24.95 42.775 16.8 8 15.9 24.175 35.0 24.925 9 16.925 22.875 35.85 24.349999999999998 10-14 19.545 29.854999999999997 27.544999999999998 23.055 15-19 19.695 28.29 27.765 24.25 20-24 19.765 28.810000000000002 27.735 23.69 25-29 18.985 28.444999999999997 28.655 23.915 30-34 19.564999999999998 28.76 27.91 23.765 35-39 19.865 27.61 28.38 24.145 40-44 19.939999999999998 28.7 27.889999999999997 23.47 45-49 19.585 28.185 28.22 24.01 50-54 19.8 28.615000000000002 27.810000000000002 23.775 55-59 19.965 28.655 27.744999999999997 23.635 60-64 20.74 28.299999999999997 26.97 23.990000000000002 65-69 20.68 28.375 27.894999999999996 23.05 70-74 20.005 28.005000000000003 27.839999999999996 24.15 75-79 19.79 28.125 27.560000000000002 24.525 80-84 20.53 27.675 28.275 23.52 85-89 20.215 28.485 27.51 23.79 90-94 20.51 27.82 28.005000000000003 23.665 95-99 20.025000000000002 27.975 28.4 23.599999999999998 100-104 20.565 27.875 27.794999999999998 23.765 105-109 20.035 28.994999999999997 27.634999999999998 23.335 110-114 21.41 27.83 27.400000000000002 23.36 115-119 20.585 27.685 28.139999999999997 23.59 120-124 21.12 27.755000000000003 27.485 23.64 125-129 20.19 27.815 27.74 24.255 130-134 20.34 28.275 27.725 23.66 135-139 20.935000000000002 28.15 27.384999999999998 23.53 140-144 21.035 28.345 26.71 23.91 145-149 21.46 28.485 26.355 23.7 150-151 21.087500000000002 28.3375 26.875 23.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 2.0 19 2.0 20 1.0 21 1.0 22 2.0 23 4.5 24 7.0 25 8.5 26 11.0 27 10.5 28 8.5 29 18.0 30 25.0 31 29.5 32 37.5 33 40.5 34 50.5 35 59.0 36 75.5 37 102.5 38 128.0 39 160.5 40 182.5 41 206.0 42 233.5 43 243.0 44 240.0 45 249.5 46 277.5 47 270.0 48 230.0 49 223.0 50 197.5 51 140.0 52 112.0 53 96.5 54 74.0 55 53.0 56 45.0 57 37.0 58 26.5 59 22.5 60 17.5 61 10.0 62 4.0 63 3.0 64 3.0 65 3.0 66 2.0 67 1.5 68 2.5 69 2.5 70 1.5 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.65 #Duplication Level Percentage of deduplicated Percentage of total 1 85.02658003544005 71.975 2 12.492616656822209 21.15 3 2.008269344359126 5.1 4 0.38393384524512697 1.3 5 0.05906674542232723 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.029533372711163616 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAAC 9 0.22499999999999998 No Hit GTTGTGAGTTCCAGTTCCCTGGGGGGCTTGGAAAAGAGAGTCCACCATAC 5 0.125 No Hit CTCTACTCTCTCCATCAAGACCAGAACTTGAAGCTGAAGAGAATCCTTCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.7375 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.0875 0.0 0.0 0.0 0.0 120-121 2.3 0.0 0.0 0.0 0.0 122-123 2.55 0.0 0.0 0.0 0.0 124-125 2.9000000000000004 0.0 0.0 0.0 0.0 126-127 3.1375 0.0 0.0 0.0 0.0 128-129 3.3499999999999996 0.0 0.0 0.0 0.0 130-131 3.6 0.0 0.0 0.0 0.0 132-133 3.825 0.0 0.0 0.0 0.0 134-135 4.1 0.0 0.0 0.0 0.0 136-137 4.3375 0.0 0.0 0.0 0.0 138-139 4.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGTTT 10 0.006830828 145.0 3 AAAAAAA 85 0.0031733946 11.941176 80-84 >>END_MODULE SRR12671393 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671393_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1745 37.0 37.0 37.0 37.0 37.0 2 36.06 37.0 37.0 37.0 37.0 37.0 3 36.0835 37.0 37.0 37.0 37.0 37.0 4 36.169 37.0 37.0 37.0 37.0 37.0 5 36.094 37.0 37.0 37.0 37.0 37.0 6 36.109 37.0 37.0 37.0 37.0 37.0 7 36.0925 37.0 37.0 37.0 37.0 37.0 8 36.07 37.0 37.0 37.0 37.0 37.0 9 36.172 37.0 37.0 37.0 37.0 37.0 10-14 36.1841 37.0 37.0 37.0 37.0 37.0 15-19 36.184400000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.094100000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.1722 37.0 37.0 37.0 37.0 37.0 30-34 36.061 37.0 37.0 37.0 37.0 37.0 35-39 36.0343 37.0 37.0 37.0 37.0 37.0 40-44 36.013099999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.0195 37.0 37.0 37.0 37.0 37.0 50-54 35.9874 37.0 37.0 37.0 37.0 37.0 55-59 35.9597 37.0 37.0 37.0 37.0 37.0 60-64 35.912699999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.885200000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.832899999999995 37.0 37.0 37.0 37.0 37.0 75-79 35.881899999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.7348 37.0 37.0 37.0 37.0 37.0 85-89 35.833600000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.728899999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.7318 37.0 37.0 37.0 37.0 37.0 100-104 35.715500000000006 37.0 37.0 37.0 37.0 37.0 105-109 35.629099999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.59349999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.6422 37.0 37.0 37.0 37.0 37.0 120-124 35.606399999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.518299999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.4904 37.0 37.0 37.0 37.0 37.0 135-139 35.3592 37.0 37.0 37.0 34.6 37.0 140-144 35.3683 37.0 37.0 37.0 37.0 37.0 145-149 35.3741 37.0 37.0 37.0 37.0 37.0 150-151 35.031499999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 6.0 23 3.0 24 7.0 25 11.0 26 10.0 27 18.0 28 17.0 29 24.0 30 34.0 31 31.0 32 60.0 33 116.0 34 262.0 35 613.0 36 2558.0 37 222.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.75 24.625 9.950000000000001 25.674999999999997 2 25.2 24.625 34.949999999999996 15.225 3 20.075000000000003 27.224999999999998 33.775 18.925 4 24.375 34.0 23.175 18.45 5 24.8 37.775 21.05 16.375 6 19.7 38.9 23.075000000000003 18.325 7 18.875 21.3 40.475 19.35 8 19.900000000000002 26.55 29.099999999999998 24.45 9 21.65 23.599999999999998 29.799999999999997 24.95 10-14 22.925 29.104999999999997 26.815 21.154999999999998 15-19 23.22 28.110000000000003 27.72 20.95 20-24 23.04 29.21 27.125 20.625 25-29 22.939999999999998 27.939999999999998 28.084999999999997 21.035 30-34 22.91 28.42 27.665 21.005 35-39 23.165 27.99 27.800000000000004 21.044999999999998 40-44 22.945 28.26 27.72 21.075 45-49 22.650000000000002 28.305000000000003 27.82 21.224999999999998 50-54 22.935 27.735 28.299999999999997 21.029999999999998 55-59 23.335 28.015 27.265 21.385 60-64 23.105 28.595 27.310000000000002 20.990000000000002 65-69 23.285 27.200000000000003 28.215 21.3 70-74 23.235 27.49 27.915 21.36 75-79 23.25 28.189999999999998 27.389999999999997 21.17 80-84 22.965 28.43 27.615000000000002 20.990000000000002 85-89 22.745 28.665000000000003 27.139999999999997 21.45 90-94 23.674999999999997 28.439999999999998 27.08 20.805 95-99 23.055 28.549999999999997 27.145000000000003 21.25 100-104 24.55 27.189999999999998 27.71 20.549999999999997 105-109 23.11 28.73 27.235 20.925 110-114 23.445 28.025 28.050000000000004 20.48 115-119 23.855 28.305000000000003 27.27 20.57 120-124 24.115000000000002 28.355000000000004 27.445000000000004 20.085 125-129 23.35 28.01 28.075 20.565 130-134 24.545 27.605 27.139999999999997 20.71 135-139 24.54 27.275 27.855 20.330000000000002 140-144 24.69 27.584999999999997 27.43 20.294999999999998 145-149 25.72757275727573 27.687768776877686 26.732673267326735 19.851985198519852 150-151 25.124999999999996 27.900000000000002 27.737499999999997 19.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.5 22 2.0 23 2.0 24 2.5 25 3.0 26 4.5 27 5.5 28 9.5 29 16.5 30 18.0 31 26.0 32 37.5 33 38.5 34 50.5 35 66.0 36 87.5 37 115.5 38 136.0 39 168.5 40 204.0 41 236.5 42 250.5 43 237.0 44 242.5 45 260.0 46 252.0 47 246.5 48 230.0 49 197.0 50 173.0 51 133.0 52 107.5 53 95.0 54 76.5 55 66.5 56 54.5 57 35.5 58 23.5 59 20.5 60 14.5 61 13.0 62 10.5 63 6.5 64 4.0 65 1.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 1.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.05 #Duplication Level Percentage of deduplicated Percentage of total 1 85.44973544973546 72.675 2 12.110523221634333 20.599999999999998 3 1.9400352733686066 4.95 4 0.411522633744856 1.4000000000000001 5 0.08818342151675485 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTTGATGTTATTCCAGTACAAAGTGGTGACAGTGTAGACCAGCAAGAAG 5 0.125 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.7625 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.0625 0.0 0.0 0.0 0.0 120-121 2.2750000000000004 0.0 0.0 0.0 0.0 122-123 2.5250000000000004 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 3.1125 0.0 0.0 0.0 0.0 128-129 3.3375 0.0 0.0 0.0 0.0 130-131 3.6 0.0 0.0 0.0 0.0 132-133 3.825 0.0 0.0 0.0 0.0 134-135 4.1 0.0 0.0 0.0 0.0 136-137 4.3625 0.0 0.0 0.0 0.0 138-139 4.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCTCAT 10 0.006830828 145.0 4 ATACCTA 10 0.006830828 145.0 6 TACCTAA 10 0.006830828 145.0 7 AAAAAAA 30 0.0014437955 24.166668 55-59 >>END_MODULE Read 865147 spots for SRR12671393.sra Written 865147 spots for SRR12671393.sra Read 865147 spots for SRR12671393.sra Written 865147 spots for SRR12671393.sra Read 865147 spots for SRR12671393.sra Written 865147 spots for SRR12671393.sra Read 865147 spots for SRR12671393.sra Written 865147 spots for SRR12671393.sra Read 865147 spots for SRR12671393.sra Written 865147 spots for SRR12671393.sra Read 865147 spots for SRR12671393.sra Written 865147 spots for SRR12671393.sra Read 865147 spots for SRR12671393.sra Written 865147 spots for SRR12671393.sra Read 865147 spots for SRR12671393.sra Written 865147 spots for SRR12671393.sra Read 865147 spots for SRR12671393.sra Written 865147 spots for SRR12671393.sra Read 865147 spots for SRR12671393.sra Written 865147 spots for SRR12671393.sra Read 865147 spots for SRR12671393.sra Written 865147 spots for SRR12671393.sra Read 865147 spots for SRR12671393.sra Written 865147 spots for SRR12671393.sra Read 865147 spots for SRR12671393.sra Written 865147 spots for SRR12671393.sra Read 865147 spots for SRR12671393.sra Written 865147 spots for SRR12671393.sra Read 865147 spots for SRR12671393.sra Written 865147 spots for SRR12671393.sra Read 865147 spots for SRR12671393.sra Written 865147 spots for SRR12671393.sra Read 865147 spots for SRR12671393.sra Written 865147 spots for SRR12671393.sra Read 865147 spots for SRR12671393.sra Written 865147 spots for SRR12671393.sra Read 865158 spots for SRR12671393.sra Written 865158 spots for SRR12671393.sra Read 865147 spots for SRR12671393.sra Written 865147 spots for SRR12671393.sra SRR ids: ['SRR12671393.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nl8jei2_ SRR12671393.sra spots: 17302951 blocks: [[1, 865147], [865148, 1730294], [1730295, 2595441], [2595442, 3460588], [3460589, 4325735], [4325736, 5190882], [5190883, 6056029], [6056030, 6921176], [6921177, 7786323], [7786324, 8651470], [8651471, 9516617], [9516618, 10381764], [10381765, 11246911], [11246912, 12112058], [12112059, 12977205], [12977206, 13842352], [13842353, 14707499], [14707500, 15572646], [15572647, 16437793], [16437794, 17302951]] SRR12671393 file size 5858599 SRR12671393 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671393 SRR12671393_1.fastq SRR12671393_2.fastq Input file: SRR12671393_1.fastq Paired file: SRR12671393_2.fastq trimmed: SRR12671393-trimmed-pair1.fastq, SRR12671393-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:46:14 2025 >> started Tue Feb 11 21:46:44 2025 >> done (29.828s) 17302951 read pairs processed; of these: 56 ( 0.00%) short read pairs filtered out after trimming by size control 3087 ( 0.02%) empty read pairs filtered out after trimming by size control 17299808 (99.98%) read pairs available; of these: 1201233 ( 6.94%) trimmed read pairs available after processing 16098575 (93.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 1 0.00% 21 5 0.00% 22 6 0.00% 23 21 0.00% 24 11 0.00% 25 10 0.00% 26 14 0.00% 27 15 0.00% 28 17 0.00% 29 24 0.00% 30 19 0.00% 31 14 0.00% 32 18 0.00% 33 21 0.00% 34 20 0.00% 35 24 0.00% 36 19 0.00% 37 21 0.00% 38 26 0.00% 39 39 0.00% 40 25 0.00% 41 31 0.00% 42 40 0.00% 43 37 0.00% 44 41 0.00% 45 55 0.00% 46 37 0.00% 47 62 0.00% 48 67 0.00% 49 73 0.00% 50 83 0.00% 51 83 0.00% 52 98 0.00% 53 107 0.00% 54 126 0.00% 55 109 0.00% 56 148 0.00% 57 157 0.00% 58 168 0.00% 59 190 0.00% 60 217 0.00% 61 240 0.00% 62 278 0.00% 63 366 0.00% 64 379 0.00% 65 374 0.00% 66 449 0.00% 67 562 0.00% 68 590 0.00% 69 645 0.00% 70 695 0.00% 71 860 0.00% 72 976 0.01% 73 1099 0.01% 74 1130 0.01% 75 1340 0.01% 76 1541 0.01% 77 1620 0.01% 78 1810 0.01% 79 1958 0.01% 80 2198 0.01% 81 2415 0.01% 82 2769 0.02% 83 2781 0.02% 84 3191 0.02% 85 3437 0.02% 86 3666 0.02% 87 4025 0.02% 88 4220 0.02% 89 4482 0.03% 90 4898 0.03% 91 5081 0.03% 92 5330 0.03% 93 5847 0.03% 94 6314 0.04% 95 6708 0.04% 96 7127 0.04% 97 7518 0.04% 98 7801 0.05% 99 8177 0.05% 100 8356 0.05% 101 8695 0.05% 102 9313 0.05% 103 9616 0.06% 104 10208 0.06% 105 10498 0.06% 106 10927 0.06% 107 11525 0.07% 108 11920 0.07% 109 12145 0.07% 110 12404 0.07% 111 12707 0.07% 112 13467 0.08% 113 13737 0.08% 114 14439 0.08% 115 15111 0.09% 116 15605 0.09% 117 16510 0.10% 118 16888 0.10% 119 17127 0.10% 120 18063 0.10% 121 18193 0.11% 122 18804 0.11% 123 19355 0.11% 124 19990 0.12% 125 20499 0.12% 126 21647 0.13% 127 21712 0.13% 128 22598 0.13% 129 23049 0.13% 130 24028 0.14% 131 23889 0.14% 132 24782 0.14% 133 25157 0.15% 134 25405 0.15% 135 26646 0.15% 136 27124 0.16% 137 27941 0.16% 138 28432 0.16% 139 30179 0.17% 140 29687 0.17% 141 30643 0.18% 142 31135 0.18% 143 31749 0.18% 144 32662 0.19% 145 33301 0.19% 146 33463 0.19% 147 34338 0.20% 148 35329 0.20% 149 35738 0.21% 150 37291 0.22% 151 16098575 93.06% 17299808 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=19 prefix-density=0.55 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=37.28 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.0 sequence=TAAAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=21 prefix-density=0.97 prefix-fanout=2.2 sequence=GCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=26.10 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.8 sequence=AAAGGATGGTAGAGTAGCATCCTTAGCGTTGCTGGTTTACTTTCCTAACAATCCTCAAAACCATTCTTCTTAGACTCTCTATACATTCCAAATAACC SRR12671393 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:47:32 Started mapping on | Feb 11 21:47:32 Finished on | Feb 11 21:51:02 Mapping speed, Million of reads per hour | 296.57 Number of input reads | 17299808 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 16047102 Uniquely mapped reads % | 92.76% Average mapped length | 296.98 Number of splices: Total | 15961816 Number of splices: Annotated (sjdb) | 15656195 Number of splices: GT/AG | 15645457 Number of splices: GC/AG | 265955 Number of splices: AT/AC | 9736 Number of splices: Non-canonical | 40668 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.96 Insertion rate per base | 0.03% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 404650 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 172202 % of reads mapped to too many loci | 1.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.69% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 848056 848056 848056 N_multimapping 404650 404650 404650 N_noFeature 634233 15805915 715197 N_ambiguous 266833 1140 105890 UnstrandedReadsAssigned:15146036 PositiveStrandReadsAssigned:240047 NegativeStrandReadsAssigned:15226015 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671393 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671393-trimmed-pair1.fastq SRR12671393-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,299,808 reads, 15,326,192 reads pseudoaligned [quant] estimated average fragment length: 285.063 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR12671393.ke.tsv 34699 SRR12671393.se.tsv 87100 total ==> SRR12671393.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1733.94 565 19.9744 Potri.005G024800.1.v4.1 1035 750.937 296 24.1628 Potri.004G059700.1.v4.1 961 677.207 1 0.0905185 Potri.007G009000.2.v4.1 1416 1131.94 0 0 Potri.003G141000.2.v4.1 2943 2658.94 1010.08 23.2865 Potri.016G087400.1.v4.1 270 78.4556 640 500.051 Potri.015G069301.1.v4.1 564 301.34 0 0 Potri.010G195200.1.v4.1 1773 1488.94 63 2.59372 Potri.012G127500.1.v4.1 977 693.13 56 4.95259 ==> SRR12671393.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 47 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 192 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12671393 completed mapping pipeline successfully