Starting /dee2/code/volunteer_pipeline.sh SRR12671394 current disk space = 3052590317568 free memory = 1465793896 SRR12671394 SRAfilesize 9b832f10943a54a69d5b5961578b89f6 SRR12671394.sra SRR12671394.sra file validated SRR12671394 is paired end SRR12671394 is conventional basespace SRR12671394 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671394_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6995 37.0 37.0 37.0 37.0 37.0 2 36.509 37.0 37.0 37.0 37.0 37.0 3 36.6485 37.0 37.0 37.0 37.0 37.0 4 36.6805 37.0 37.0 37.0 37.0 37.0 5 36.6205 37.0 37.0 37.0 37.0 37.0 6 36.678 37.0 37.0 37.0 37.0 37.0 7 36.648 37.0 37.0 37.0 37.0 37.0 8 36.61 37.0 37.0 37.0 37.0 37.0 9 36.595 37.0 37.0 37.0 37.0 37.0 10-14 36.64809999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.5769 37.0 37.0 37.0 37.0 37.0 20-24 36.5788 37.0 37.0 37.0 37.0 37.0 25-29 36.549699999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.5104 37.0 37.0 37.0 37.0 37.0 35-39 36.4855 37.0 37.0 37.0 37.0 37.0 40-44 36.4148 37.0 37.0 37.0 37.0 37.0 45-49 36.367599999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.356700000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.27329999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.2609 37.0 37.0 37.0 37.0 37.0 65-69 36.2545 37.0 37.0 37.0 37.0 37.0 70-74 36.292500000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.2964 37.0 37.0 37.0 37.0 37.0 80-84 36.2922 37.0 37.0 37.0 37.0 37.0 85-89 36.270799999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.2701 37.0 37.0 37.0 37.0 37.0 95-99 36.2606 37.0 37.0 37.0 37.0 37.0 100-104 36.2071 37.0 37.0 37.0 37.0 37.0 105-109 36.263799999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1544 37.0 37.0 37.0 37.0 37.0 115-119 36.2033 37.0 37.0 37.0 37.0 37.0 120-124 36.1118 37.0 37.0 37.0 37.0 37.0 125-129 36.075399999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.914699999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.880399999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.802800000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.714 37.0 37.0 37.0 37.0 37.0 150-151 35.4945 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 3.0 22 2.0 23 1.0 24 1.0 25 7.0 26 5.0 27 8.0 28 13.0 29 14.0 30 29.0 31 35.0 32 50.0 33 76.0 34 101.0 35 233.0 36 2901.0 37 519.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.575 11.55 5.7250000000000005 32.15 2 20.29058116232465 11.89879759519038 38.37675350701403 29.43386773547094 3 18.75 18.15 30.0 33.1 4 23.3 24.175 24.875 27.650000000000002 5 24.65 31.075000000000003 23.925 20.349999999999998 6 20.825 33.575 24.175 21.425 7 14.649999999999999 28.175 42.5 14.674999999999999 8 15.9 23.974999999999998 35.425000000000004 24.7 9 16.150000000000002 23.575 36.425000000000004 23.849999999999998 10-14 19.744999999999997 30.9 27.634999999999998 21.72 15-19 19.73 28.93 27.99 23.35 20-24 19.650000000000002 29.695 27.325 23.330000000000002 25-29 19.689999999999998 29.62 27.365000000000002 23.325000000000003 30-34 19.865 28.975 27.605 23.555 35-39 20.080000000000002 29.294999999999998 26.815 23.810000000000002 40-44 20.625 29.854999999999997 26.88 22.64 45-49 20.18 29.959999999999997 26.490000000000002 23.369999999999997 50-54 20.16 29.354999999999997 27.185 23.3 55-59 20.61 29.044999999999998 26.790000000000003 23.555 60-64 20.615 28.939999999999998 27.279999999999998 23.165 65-69 20.155 29.195 26.96 23.69 70-74 20.43 29.04 27.555000000000003 22.975 75-79 20.385 28.48 27.755000000000003 23.380000000000003 80-84 20.880000000000003 28.804999999999996 26.790000000000003 23.525 85-89 20.630000000000003 29.110000000000003 27.265 22.994999999999997 90-94 20.76 28.139999999999997 27.224999999999998 23.875 95-99 20.990000000000002 28.625 26.745 23.64 100-104 21.075 29.17 26.955000000000002 22.8 105-109 20.745 28.720000000000002 27.384999999999998 23.150000000000002 110-114 21.2 27.99 26.965 23.845 115-119 21.38 28.87 26.179999999999996 23.57 120-124 21.42 28.655 26.450000000000003 23.474999999999998 125-129 21.634999999999998 27.425 26.76 24.18 130-134 21.035 28.435 26.145000000000003 24.385 135-139 22.355 28.165000000000003 25.71 23.77 140-144 21.44 28.389999999999997 26.090000000000003 24.08 145-149 22.134999999999998 27.67 26.83 23.365 150-151 22.35 27.55 25.687500000000004 24.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.5 5 1.0 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 0.5 17 0.5 18 1.0 19 1.5 20 1.5 21 5.0 22 5.0 23 2.5 24 7.5 25 8.0 26 9.0 27 13.5 28 14.0 29 17.0 30 30.5 31 38.0 32 38.0 33 57.5 34 72.0 35 86.0 36 103.5 37 116.5 38 142.5 39 162.5 40 172.0 41 193.0 42 203.0 43 218.0 44 238.0 45 235.0 46 216.5 47 210.5 48 223.0 49 201.5 50 170.0 51 142.0 52 119.0 53 98.5 54 86.5 55 86.0 56 70.0 57 49.5 58 31.5 59 24.5 60 18.0 61 12.5 62 9.0 63 4.0 64 4.0 65 3.0 66 3.0 67 5.0 68 5.5 69 2.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 1.0 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 85.12911843276937 71.7 2 11.962006530127635 20.150000000000002 3 2.2558622736717124 5.7 4 0.4749183734045711 1.6 5 0.11872959335114278 0.5 6 0.029682398337785694 0.15 7 0.0 0.0 8 0.029682398337785694 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTT 8 0.2 No Hit GCTTGTTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGC 6 0.15 No Hit GGGAGATATGACATGCCAAAGGAGTAAAGATAGCTATCAAGGCCAAGAAG 5 0.125 No Hit GGGTGGAAGAAGTTGGTGCCATGGGAAAAGGATCACTTGCGGCTACATCT 5 0.125 No Hit CTTGAAAGGACTTTTACTTGACAATATTATCTACTGCTTGGTGGGGGGGA 5 0.125 No Hit GCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.4125 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.5874999999999999 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.8500000000000001 0.0 0.0 0.0 0.0 88-89 0.975 0.0 0.0 0.0 0.0 90-91 1.025 0.0 0.0 0.0 0.0 92-93 1.1 0.0 0.0 0.0 0.0 94-95 1.2125 0.0 0.0 0.0 0.0 96-97 1.4874999999999998 0.0 0.0 0.0 0.0 98-99 1.65 0.0 0.0 0.0 0.0 100-101 1.8375 0.0 0.0 0.0 0.0 102-103 2.125 0.0 0.0 0.0 0.0 104-105 2.3875 0.0 0.0 0.0 0.0 106-107 2.8875 0.0 0.0 0.0 0.0 108-109 3.2125 0.0 0.0 0.0 0.0 110-111 3.6 0.0 0.0 0.0 0.0 112-113 3.9125 0.0 0.0 0.0 0.0 114-115 4.3 0.0 0.0 0.0 0.0 116-117 4.8375 0.0 0.0 0.0 0.0 118-119 5.2125 0.0 0.0 0.0 0.0 120-121 5.5375 0.0 0.0 0.0 0.0 122-123 5.9375 0.0 0.0 0.0 0.0 124-125 6.375 0.0 0.0 0.0 0.0 126-127 7.0375 0.0 0.0 0.0 0.0 128-129 7.575 0.0 0.0 0.0 0.0 130-131 8.1625 0.0 0.0 0.0 0.0 132-133 8.775 0.0 0.0 0.0 0.0 134-135 9.45 0.0 0.0 0.0 0.0 136-137 10.05 0.0 0.0 0.0 0.0 138-139 10.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCGCT 10 0.006830828 145.0 1 TCTACAA 10 0.006830828 145.0 8 AGCATTA 10 0.006830828 145.0 145 TTGCTGC 10 0.006830828 145.0 3 >>END_MODULE SRR12671394 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671394_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.442 37.0 37.0 37.0 37.0 37.0 2 36.1375 37.0 37.0 37.0 37.0 37.0 3 36.2865 37.0 37.0 37.0 37.0 37.0 4 36.2445 37.0 37.0 37.0 37.0 37.0 5 36.2935 37.0 37.0 37.0 37.0 37.0 6 36.2625 37.0 37.0 37.0 37.0 37.0 7 36.3145 37.0 37.0 37.0 37.0 37.0 8 36.2235 37.0 37.0 37.0 37.0 37.0 9 36.2745 37.0 37.0 37.0 37.0 37.0 10-14 36.256600000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.2441 37.0 37.0 37.0 37.0 37.0 20-24 36.1032 37.0 37.0 37.0 37.0 37.0 25-29 36.157399999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.0264 37.0 37.0 37.0 37.0 37.0 35-39 36.0858 37.0 37.0 37.0 37.0 37.0 40-44 35.9976 37.0 37.0 37.0 37.0 37.0 45-49 35.9844 37.0 37.0 37.0 37.0 37.0 50-54 35.9492 37.0 37.0 37.0 37.0 37.0 55-59 35.9597 37.0 37.0 37.0 37.0 37.0 60-64 35.975 37.0 37.0 37.0 37.0 37.0 65-69 35.893 37.0 37.0 37.0 37.0 37.0 70-74 35.8874 37.0 37.0 37.0 37.0 37.0 75-79 35.8806 37.0 37.0 37.0 37.0 37.0 80-84 35.8638 37.0 37.0 37.0 37.0 37.0 85-89 35.90650000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.8485 37.0 37.0 37.0 37.0 37.0 95-99 35.8467 37.0 37.0 37.0 37.0 37.0 100-104 35.8386 37.0 37.0 37.0 37.0 37.0 105-109 35.730900000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.727000000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.78830000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.7198 37.0 37.0 37.0 37.0 37.0 125-129 35.5998 37.0 37.0 37.0 37.0 37.0 130-134 35.61 37.0 37.0 37.0 37.0 37.0 135-139 35.4415 37.0 37.0 37.0 37.0 37.0 140-144 35.433800000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.3291 37.0 37.0 37.0 37.0 37.0 150-151 35.0135 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 5.0 14 10.0 15 12.0 16 6.0 17 4.0 18 3.0 19 1.0 20 5.0 21 4.0 22 13.0 23 6.0 24 9.0 25 14.0 26 10.0 27 18.0 28 10.0 29 12.0 30 16.0 31 23.0 32 37.0 33 73.0 34 112.0 35 366.0 36 2875.0 37 356.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.475 24.6 7.124999999999999 18.8 2 29.775000000000002 24.075 29.2 16.950000000000003 3 22.825 24.775 34.35 18.05 4 26.325 32.9 21.9 18.875 5 26.700000000000003 37.15 18.4 17.75 6 21.45 40.2 19.55 18.8 7 22.025 22.35 36.95 18.675 8 20.9 24.725 30.075000000000003 24.3 9 22.475 23.25 30.225 24.05 10-14 25.205 28.605000000000004 26.340000000000003 19.85 15-19 25.52 27.295 26.685 20.5 20-24 23.875 28.08 27.42 20.625 25-29 24.13 26.815 28.18 20.875 30-34 23.455000000000002 28.144999999999996 27.275 21.125 35-39 23.515 28.294999999999998 27.175 21.015 40-44 24.135 28.415000000000003 27.005000000000003 20.445 45-49 23.745 27.38 28.499999999999996 20.375 50-54 23.5 28.285 27.334999999999997 20.880000000000003 55-59 24.515 28.13 27.195000000000004 20.16 60-64 23.68 27.96 27.68 20.68 65-69 23.9 27.534999999999997 27.61 20.955 70-74 23.775 27.744999999999997 27.29 21.19 75-79 23.35 27.700000000000003 27.675 21.275 80-84 23.849999999999998 27.694999999999997 26.91 21.545 85-89 24.15 27.495000000000005 26.97 21.385 90-94 24.45 27.400000000000002 26.935 21.215 95-99 24.37 28.215 27.11 20.305 100-104 24.195 28.255000000000003 26.97 20.580000000000002 105-109 24.325 27.889999999999997 27.155 20.630000000000003 110-114 24.845 27.33 27.315 20.51 115-119 25.44 28.02 26.595000000000002 19.945 120-124 25.28 27.555000000000003 27.04 20.125 125-129 25.240000000000002 28.04 26.99 19.73 130-134 25.835 27.62 26.6 19.945 135-139 26.075 27.485 27.060000000000002 19.38 140-144 26.405 28.065 26.395000000000003 19.134999999999998 145-149 26.665 27.115000000000002 27.125 19.095000000000002 150-151 26.85 27.4125 27.237499999999997 18.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 1.0 9 2.0 10 2.5 11 4.0 12 2.5 13 0.5 14 0.5 15 1.5 16 2.0 17 1.5 18 2.0 19 2.0 20 2.0 21 2.5 22 2.0 23 2.5 24 2.5 25 2.5 26 5.0 27 7.0 28 14.0 29 17.0 30 14.5 31 15.5 32 23.0 33 30.5 34 41.5 35 69.0 36 90.0 37 109.5 38 129.0 39 139.0 40 159.0 41 192.5 42 237.0 43 257.5 44 265.5 45 267.5 46 240.5 47 230.0 48 236.0 49 200.5 50 157.5 51 143.0 52 133.5 53 108.5 54 77.0 55 64.0 56 61.5 57 56.0 58 44.5 59 23.5 60 10.5 61 11.0 62 7.5 63 7.5 64 5.5 65 2.5 66 1.5 67 1.5 68 1.5 69 3.0 70 2.5 71 0.0 72 0.0 73 1.0 74 1.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.5 83 1.0 84 1.0 85 0.5 86 0.5 87 1.0 88 1.5 89 1.0 90 0.5 91 1.0 92 1.5 93 3.0 94 4.0 95 2.0 96 0.0 97 0.5 98 1.0 99 1.5 100 11.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 85.75244879786287 72.225 2 11.665182546749778 19.650000000000002 3 1.8403086969427132 4.65 4 0.5342831700801425 1.7999999999999998 5 0.08904719501335707 0.375 6 0.029682398337785694 0.15 7 0.0 0.0 8 0.029682398337785694 0.2 9 0.029682398337785694 0.22499999999999998 >10 0.029682398337785694 0.7250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 29 0.7250000000000001 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 9 0.22499999999999998 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 8 0.2 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit GCAAAGTTCATCACAGAGGCTGCACCACCACAATATATTAGTGTCATGAG 5 0.125 No Hit AGCGTCTCCTCAAAGCCTTACTTAGCCGGCGCAAATCTAAGAAAGATGAA 5 0.125 No Hit GTACTACTAGATGAATATATGTTCAGTATCTTGCACTACCTAACATAATA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.11249999999999999 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.5625 0.0 0.0 0.0 0.0 84-85 0.7250000000000001 0.0 0.0 0.0 0.0 86-87 0.825 0.0 0.0 0.0 0.0 88-89 0.95 0.0 0.0 0.0 0.0 90-91 1.0 0.0 0.0 0.0 0.0 92-93 1.0750000000000002 0.0 0.0 0.0 0.0 94-95 1.1875 0.0 0.0 0.0 0.0 96-97 1.4625 0.0 0.0 0.0 0.0 98-99 1.625 0.0 0.0 0.0 0.0 100-101 1.8125 0.0 0.0 0.0 0.0 102-103 2.1 0.0 0.0 0.0 0.0 104-105 2.3625 0.0 0.0 0.0 0.0 106-107 2.8625 0.0 0.0 0.0 0.0 108-109 3.1875 0.0 0.0 0.0 0.0 110-111 3.5625 0.0 0.0 0.0 0.0 112-113 3.8625 0.0 0.0 0.0 0.0 114-115 4.25 0.0 0.0 0.0 0.0 116-117 4.7875 0.0 0.0 0.0 0.0 118-119 5.25 0.0 0.0 0.0 0.0 120-121 5.637499999999999 0.0 0.0 0.0 0.0 122-123 6.0375 0.0 0.0 0.0 0.0 124-125 6.475 0.0 0.0 0.0 0.0 126-127 7.137499999999999 0.0 0.0 0.0 0.0 128-129 7.6875 0.0 0.0 0.0 0.0 130-131 8.275 0.0 0.0 0.0 0.0 132-133 8.875 0.0 0.0 0.0 0.0 134-135 9.55 0.0 0.0 0.0 0.0 136-137 10.2375 0.0 0.0 0.0 0.0 138-139 10.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCTTA 10 0.006830828 145.0 7 >>END_MODULE Read 692109 spots for SRR12671394.sra Written 692109 spots for SRR12671394.sra Read 692109 spots for SRR12671394.sra Written 692109 spots for SRR12671394.sra Read 692109 spots for SRR12671394.sra Written 692109 spots for SRR12671394.sra Read 692109 spots for SRR12671394.sra Written 692109 spots for SRR12671394.sra Read 692109 spots for SRR12671394.sra Written 692109 spots for SRR12671394.sra Read 692109 spots for SRR12671394.sra Written 692109 spots for SRR12671394.sra Read 692109 spots for SRR12671394.sra Written 692109 spots for SRR12671394.sra Read 692109 spots for SRR12671394.sra Written 692109 spots for SRR12671394.sra Read 692109 spots for SRR12671394.sra Written 692109 spots for SRR12671394.sra Read 692109 spots for SRR12671394.sra Written 692109 spots for SRR12671394.sra Read 692109 spots for SRR12671394.sra Written 692109 spots for SRR12671394.sra Read 692117 spots for SRR12671394.sra Written 692117 spots for SRR12671394.sra Read 692109 spots for SRR12671394.sra Written 692109 spots for SRR12671394.sra Read 692109 spots for SRR12671394.sra Written 692109 spots for SRR12671394.sra Read 692109 spots for SRR12671394.sra Written 692109 spots for SRR12671394.sra Read 692109 spots for SRR12671394.sra Written 692109 spots for SRR12671394.sra Read 692109 spots for SRR12671394.sra Written 692109 spots for SRR12671394.sra Read 692109 spots for SRR12671394.sra Written 692109 spots for SRR12671394.sra Read 692109 spots for SRR12671394.sra Written 692109 spots for SRR12671394.sra Read 692109 spots for SRR12671394.sra Written 692109 spots for SRR12671394.sra SRR ids: ['SRR12671394.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kyh2xvw3 SRR12671394.sra spots: 13842188 blocks: [[1, 692109], [692110, 1384218], [1384219, 2076327], [2076328, 2768436], [2768437, 3460545], [3460546, 4152654], [4152655, 4844763], [4844764, 5536872], [5536873, 6228981], [6228982, 6921090], [6921091, 7613199], [7613200, 8305308], [8305309, 8997417], [8997418, 9689526], [9689527, 10381635], [10381636, 11073744], [11073745, 11765853], [11765854, 12457962], [12457963, 13150071], [13150072, 13842188]] SRR12671394 file size 4682480 SRR12671394 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671394 SRR12671394_1.fastq SRR12671394_2.fastq Input file: SRR12671394_1.fastq Paired file: SRR12671394_2.fastq trimmed: SRR12671394-trimmed-pair1.fastq, SRR12671394-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:46:30 2025 >> started Tue Feb 11 21:46:46 2025 >> done (16.233s) 13842188 read pairs processed; of these: 76 ( 0.00%) short read pairs filtered out after trimming by size control 41855 ( 0.30%) empty read pairs filtered out after trimming by size control 13800257 (99.70%) read pairs available; of these: 2037788 (14.77%) trimmed read pairs available after processing 11762469 (85.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 9 0.00% 20 14 0.00% 21 12 0.00% 22 13 0.00% 23 27 0.00% 24 29 0.00% 25 26 0.00% 26 44 0.00% 27 44 0.00% 28 51 0.00% 29 47 0.00% 30 52 0.00% 31 42 0.00% 32 40 0.00% 33 48 0.00% 34 47 0.00% 35 46 0.00% 36 36 0.00% 37 51 0.00% 38 56 0.00% 39 50 0.00% 40 55 0.00% 41 62 0.00% 42 63 0.00% 43 68 0.00% 44 85 0.00% 45 65 0.00% 46 86 0.00% 47 103 0.00% 48 141 0.00% 49 129 0.00% 50 170 0.00% 51 190 0.00% 52 179 0.00% 53 215 0.00% 54 221 0.00% 55 248 0.00% 56 258 0.00% 57 338 0.00% 58 398 0.00% 59 454 0.00% 60 499 0.00% 61 598 0.00% 62 659 0.00% 63 745 0.01% 64 858 0.01% 65 847 0.01% 66 962 0.01% 67 1148 0.01% 68 1272 0.01% 69 1445 0.01% 70 1686 0.01% 71 1978 0.01% 72 2115 0.02% 73 2437 0.02% 74 2790 0.02% 75 3015 0.02% 76 3252 0.02% 77 3474 0.03% 78 3721 0.03% 79 4245 0.03% 80 4742 0.03% 81 5420 0.04% 82 5931 0.04% 83 6404 0.05% 84 7512 0.05% 85 7755 0.06% 86 8248 0.06% 87 8567 0.06% 88 8958 0.06% 89 9423 0.07% 90 10206 0.07% 91 10799 0.08% 92 11495 0.08% 93 12616 0.09% 94 13401 0.10% 95 14257 0.10% 96 15004 0.11% 97 15603 0.11% 98 15303 0.11% 99 16252 0.12% 100 16716 0.12% 101 17037 0.12% 102 18245 0.13% 103 19002 0.14% 104 20212 0.15% 105 21343 0.15% 106 21670 0.16% 107 22546 0.16% 108 22722 0.16% 109 23054 0.17% 110 23586 0.17% 111 24363 0.18% 112 25359 0.18% 113 25558 0.19% 114 26777 0.19% 115 27865 0.20% 116 29094 0.21% 117 30029 0.22% 118 30734 0.22% 119 30841 0.22% 120 31635 0.23% 121 32060 0.23% 122 32639 0.24% 123 33283 0.24% 124 34700 0.25% 125 34922 0.25% 126 37017 0.27% 127 37513 0.27% 128 38095 0.28% 129 39373 0.29% 130 38968 0.28% 131 38586 0.28% 132 40082 0.29% 133 39937 0.29% 134 40612 0.29% 135 42270 0.31% 136 43026 0.31% 137 43495 0.32% 138 44988 0.33% 139 46065 0.33% 140 45380 0.33% 141 46599 0.34% 142 46317 0.34% 143 46713 0.34% 144 47995 0.35% 145 48385 0.35% 146 49292 0.36% 147 50888 0.37% 148 53160 0.39% 149 52284 0.38% 150 54794 0.40% 151 11762469 85.23% 13800257 reads passed initial QC criterion=sequence-density sequence-density=1.13 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=20 prefix-density=1.13 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=44.96 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.6 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=1.37 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=25 prefix-density=1.41 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=36.78 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.7 sequence=AAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12671394 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:47:32 Started mapping on | Feb 11 21:47:32 Finished on | Feb 11 21:49:43 Mapping speed, Million of reads per hour | 379.24 Number of input reads | 13800257 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12326240 Uniquely mapped reads % | 89.32% Average mapped length | 292.15 Number of splices: Total | 10704766 Number of splices: Annotated (sjdb) | 10503422 Number of splices: GT/AG | 10475560 Number of splices: GC/AG | 185482 Number of splices: AT/AC | 8144 Number of splices: Non-canonical | 35580 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.03% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 360359 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 30122 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.43% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1113658 1113658 1113658 N_multimapping 360359 360359 360359 N_noFeature 397570 11998563 499637 N_ambiguous 306083 953 80026 UnstrandedReadsAssigned:11622587 PositiveStrandReadsAssigned:326724 NegativeStrandReadsAssigned:11746577 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671394 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671394-trimmed-pair1.fastq SRR12671394-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,800,257 reads, 11,859,413 reads pseudoaligned [quant] estimated average fragment length: 231.941 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52401 SRR12671394.ke.tsv 34699 SRR12671394.se.tsv 87100 total ==> SRR12671394.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.06 494 16.6127 Potri.005G024800.1.v4.1 1035 804.059 358 26.7576 Potri.004G059700.1.v4.1 961 730.1 3 0.24694 Potri.007G009000.2.v4.1 1416 1185.06 0 0 Potri.003G141000.2.v4.1 2943 2712.06 645 14.2927 Potri.016G087400.1.v4.1 270 91.0024 696 459.63 Potri.015G069301.1.v4.1 564 339.623 0 0 Potri.010G195200.1.v4.1 1773 1542.06 210 8.18409 Potri.012G127500.1.v4.1 977 746.08 136 10.9548 ==> SRR12671394.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 52 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 260 Potri.001G212900.v4.1 75 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 12 SRR12671394 completed mapping pipeline successfully