Starting /dee2/code/volunteer_pipeline.sh SRR12671395 current disk space = 3052607193088 free memory = 1444838212 SRR12671395 SRAfilesize 238a5ab47cb6e9aa97e8bdb668ebcd51 SRR12671395.sra SRR12671395.sra file validated SRR12671395 is paired end SRR12671395 is conventional basespace SRR12671395 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671395_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.613 37.0 37.0 37.0 37.0 37.0 2 36.3025 37.0 37.0 37.0 37.0 37.0 3 36.6195 37.0 37.0 37.0 37.0 37.0 4 36.709 37.0 37.0 37.0 37.0 37.0 5 36.636 37.0 37.0 37.0 37.0 37.0 6 36.6295 37.0 37.0 37.0 37.0 37.0 7 36.568 37.0 37.0 37.0 37.0 37.0 8 36.6335 37.0 37.0 37.0 37.0 37.0 9 36.5425 37.0 37.0 37.0 37.0 37.0 10-14 36.6442 37.0 37.0 37.0 37.0 37.0 15-19 36.611200000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5793 37.0 37.0 37.0 37.0 37.0 25-29 36.5166 37.0 37.0 37.0 37.0 37.0 30-34 36.531099999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.504 37.0 37.0 37.0 37.0 37.0 40-44 36.436800000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.400999999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.356700000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.3666 37.0 37.0 37.0 37.0 37.0 60-64 36.3251 37.0 37.0 37.0 37.0 37.0 65-69 36.2551 37.0 37.0 37.0 37.0 37.0 70-74 36.30030000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.231500000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.231100000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.2462 37.0 37.0 37.0 37.0 37.0 90-94 36.2515 37.0 37.0 37.0 37.0 37.0 95-99 36.1832 37.0 37.0 37.0 37.0 37.0 100-104 36.1232 37.0 37.0 37.0 37.0 37.0 105-109 36.2467 37.0 37.0 37.0 37.0 37.0 110-114 36.086499999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.103300000000004 37.0 37.0 37.0 37.0 37.0 120-124 36.0251 37.0 37.0 37.0 37.0 37.0 125-129 36.0296 37.0 37.0 37.0 37.0 37.0 130-134 35.9659 37.0 37.0 37.0 37.0 37.0 135-139 35.8973 37.0 37.0 37.0 37.0 37.0 140-144 35.8246 37.0 37.0 37.0 37.0 37.0 145-149 35.7613 37.0 37.0 37.0 37.0 37.0 150-151 35.6195 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 3.0 21 2.0 22 3.0 23 7.0 24 2.0 25 7.0 26 2.0 27 4.0 28 3.0 29 14.0 30 19.0 31 31.0 32 58.0 33 65.0 34 116.0 35 293.0 36 2951.0 37 419.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.125 12.425 5.1 36.35 2 19.613259668508288 11.953792064289303 40.532395781014564 27.900552486187845 3 17.875 17.0 29.675 35.449999999999996 4 21.8 24.2 26.125 27.875 5 22.45 30.7 25.4 21.45 6 18.775 34.5 25.15 21.575 7 15.45 25.1 43.175000000000004 16.275000000000002 8 15.775 25.474999999999998 33.725 25.025 9 16.7 23.35 36.025 23.925 10-14 19.885 29.56 28.735 21.82 15-19 20.169999999999998 28.03 28.194999999999997 23.605 20-24 19.814999999999998 27.800000000000004 28.720000000000002 23.665 25-29 19.575 28.610000000000003 28.599999999999998 23.215 30-34 19.255 28.345 28.435 23.965 35-39 19.919999999999998 28.48 27.725 23.875 40-44 20.755000000000003 28.71 27.67 22.865 45-49 20.285 27.985 27.725 24.005000000000003 50-54 20.125 28.360000000000003 27.575 23.94 55-59 20.04 28.050000000000004 28.205000000000002 23.705000000000002 60-64 20.205000000000002 28.754999999999995 27.544999999999998 23.494999999999997 65-69 19.93 28.73 27.74 23.599999999999998 70-74 20.05 28.725 27.534999999999997 23.69 75-79 20.39 27.860000000000003 28.415000000000003 23.335 80-84 20.294999999999998 27.91 27.944999999999997 23.849999999999998 85-89 20.630000000000003 28.465 27.925 22.98 90-94 20.495 28.57 27.74 23.195 95-99 19.805 28.065 27.96 24.169999999999998 100-104 20.105 28.465 28.205000000000002 23.225 105-109 20.54 28.32 27.88 23.26 110-114 20.080000000000002 28.904999999999998 27.500000000000004 23.515 115-119 20.72 28.625 27.685 22.97 120-124 20.745 28.310000000000002 27.515 23.43 125-129 20.62 28.194999999999997 27.325 23.86 130-134 21.315 28.285 26.905 23.494999999999997 135-139 21.48 27.839999999999996 27.250000000000004 23.43 140-144 21.19 28.675 26.77 23.365 145-149 20.575 28.29 27.07 24.065 150-151 20.549999999999997 28.4 27.5625 23.4875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 2.5 2 2.5 3 1.0 4 1.5 5 0.5 6 1.0 7 1.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.5 13 1.0 14 1.0 15 2.5 16 2.0 17 1.5 18 1.5 19 0.5 20 1.5 21 3.0 22 3.5 23 2.0 24 2.5 25 5.5 26 8.5 27 14.5 28 13.5 29 12.5 30 21.5 31 26.5 32 30.0 33 42.5 34 46.0 35 61.5 36 92.5 37 98.0 38 118.5 39 157.5 40 183.5 41 207.0 42 228.5 43 254.5 44 267.5 45 268.5 46 275.0 47 257.0 48 236.0 49 215.5 50 173.5 51 138.5 52 114.5 53 97.0 54 75.5 55 55.0 56 46.5 57 34.0 58 20.0 59 18.0 60 15.5 61 8.5 62 6.0 63 5.0 64 4.5 65 2.5 66 0.5 67 1.0 68 1.0 69 0.0 70 1.5 71 2.5 72 1.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.325 #Duplication Level Percentage of deduplicated Percentage of total 1 84.93922324340349 71.625 2 12.333234509338869 20.8 3 2.0753038837829823 5.25 4 0.5040023717758673 1.7000000000000002 5 0.14823599169878449 0.625 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGGCTAGTTTTGAGAGGTGAGTTTAAATTCAGCAAGTCTTCTTTCAAGC 5 0.125 No Hit CTCCATTCAGCTAATTCATTTGTTCATGCCAGTTGCCTTCTTAACTCCTT 5 0.125 No Hit ATCCCGCTTCACCAGCAATTGCCTTGGCCAGAAGAGTTTTCCCAGTACCT 5 0.125 No Hit ATTGTCTCCGACATCTTCTGCAAATTACCAGTAGCGAGAGTAGACTCGAG 5 0.125 No Hit GGCCACCATAAGACGGAGGGTACGATGTGGGTCCACCAGTATAGCTTGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.025 0.0 70-71 0.05 0.0 0.0 0.05 0.0 72-73 0.07500000000000001 0.0 0.0 0.05 0.0 74-75 0.1375 0.0 0.0 0.05 0.0 76-77 0.175 0.0 0.0 0.05 0.0 78-79 0.175 0.0 0.0 0.05 0.0 80-81 0.175 0.0 0.0 0.05 0.0 82-83 0.1875 0.0 0.0 0.05 0.0 84-85 0.2 0.0 0.0 0.05 0.0 86-87 0.2 0.0 0.0 0.05 0.0 88-89 0.21250000000000002 0.0 0.0 0.05 0.0 90-91 0.3 0.0 0.0 0.05 0.0 92-93 0.3375 0.0 0.0 0.05 0.0 94-95 0.3625 0.0 0.0 0.05 0.0 96-97 0.425 0.0 0.0 0.05 0.0 98-99 0.5125 0.0 0.0 0.05 0.0 100-101 0.6499999999999999 0.0 0.0 0.05 0.0 102-103 0.825 0.0 0.0 0.05 0.0 104-105 1.0125 0.0 0.0 0.05 0.0 106-107 1.125 0.0 0.0 0.05 0.0 108-109 1.325 0.0 0.0 0.05 0.0 110-111 1.4249999999999998 0.0 0.0 0.05 0.0 112-113 1.5125 0.0 0.0 0.05 0.0 114-115 1.7000000000000002 0.0 0.0 0.05 0.0 116-117 1.8375 0.0 0.0 0.05 0.0 118-119 1.9125 0.0 0.0 0.05 0.0 120-121 2.2125 0.0 0.0 0.05 0.0 122-123 2.4125 0.0 0.0 0.05 0.0 124-125 2.6 0.0 0.0 0.05 0.0 126-127 2.7249999999999996 0.0 0.0 0.05 0.0 128-129 2.9875 0.0 0.0 0.05 0.0 130-131 3.2 0.0 0.0 0.05 0.0 132-133 3.4000000000000004 0.0 0.0 0.05 0.0 134-135 3.6375 0.0 0.0 0.05 0.0 136-137 4.0 0.0 0.0 0.05 0.0 138-139 4.225 0.0 0.0 0.05 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTTCT 10 0.006830828 145.0 6 TGACAGG 10 0.006830828 145.0 7 CACTGCT 10 0.006830828 145.0 6 ATCAATA 10 0.006830828 145.0 4 TCTCTTC 25 8.7132835E-4 87.0 5 >>END_MODULE SRR12671395 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671395_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.11 37.0 37.0 37.0 37.0 37.0 2 35.9895 37.0 37.0 37.0 37.0 37.0 3 36.144 37.0 37.0 37.0 37.0 37.0 4 36.2135 37.0 37.0 37.0 37.0 37.0 5 36.3015 37.0 37.0 37.0 37.0 37.0 6 36.2455 37.0 37.0 37.0 37.0 37.0 7 36.3245 37.0 37.0 37.0 37.0 37.0 8 36.2985 37.0 37.0 37.0 37.0 37.0 9 36.264 37.0 37.0 37.0 37.0 37.0 10-14 36.2608 37.0 37.0 37.0 37.0 37.0 15-19 36.2347 37.0 37.0 37.0 37.0 37.0 20-24 36.1298 37.0 37.0 37.0 37.0 37.0 25-29 36.1562 37.0 37.0 37.0 37.0 37.0 30-34 36.071600000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.0677 37.0 37.0 37.0 37.0 37.0 40-44 36.0503 37.0 37.0 37.0 37.0 37.0 45-49 36.025800000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.996500000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.9081 37.0 37.0 37.0 37.0 37.0 60-64 35.90410000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.914500000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.8786 37.0 37.0 37.0 37.0 37.0 75-79 35.8859 37.0 37.0 37.0 37.0 37.0 80-84 35.8156 37.0 37.0 37.0 37.0 37.0 85-89 35.885400000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.8641 37.0 37.0 37.0 37.0 37.0 95-99 35.7566 37.0 37.0 37.0 37.0 37.0 100-104 35.790800000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.702000000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.6288 37.0 37.0 37.0 37.0 37.0 115-119 35.7235 37.0 37.0 37.0 37.0 37.0 120-124 35.6457 37.0 37.0 37.0 37.0 37.0 125-129 35.684900000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.5542 37.0 37.0 37.0 37.0 37.0 135-139 35.5158 37.0 37.0 37.0 37.0 37.0 140-144 35.5116 37.0 37.0 37.0 37.0 37.0 145-149 35.390299999999996 37.0 37.0 37.0 34.6 37.0 150-151 35.21925 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 2.0 15 3.0 16 2.0 17 1.0 18 1.0 19 1.0 20 0.0 21 0.0 22 4.0 23 5.0 24 9.0 25 18.0 26 14.0 27 7.0 28 22.0 29 20.0 30 27.0 31 32.0 32 61.0 33 100.0 34 182.0 35 540.0 36 2689.0 37 257.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.9 24.25 7.775 23.075000000000003 2 25.174999999999997 25.224999999999998 34.699999999999996 14.899999999999999 3 19.650000000000002 26.200000000000003 35.475 18.675 4 24.325 34.125 24.075 17.474999999999998 5 25.124999999999996 38.15 20.4 16.325 6 19.375 38.525 23.625 18.475 7 18.9 22.7 39.574999999999996 18.825 8 19.1 24.55 30.55 25.8 9 21.625 23.525 31.1 23.75 10-14 22.43 29.14 27.52 20.91 15-19 23.395 28.175 27.375 21.055 20-24 22.305 29.005 27.67 21.02 25-29 22.725 28.57 28.04 20.665 30-34 22.830000000000002 27.705000000000002 28.610000000000003 20.855 35-39 22.245 28.27 27.74 21.745 40-44 22.61 28.294999999999998 27.794999999999998 21.3 45-49 22.63 28.735 27.57 21.065 50-54 22.245 28.775000000000002 27.500000000000004 21.48 55-59 22.805 28.349999999999998 28.065 20.78 60-64 22.725 27.544999999999998 27.950000000000003 21.78 65-69 23.07 27.534999999999997 28.04 21.355 70-74 22.994999999999997 27.91 27.715 21.38 75-79 23.055 28.685 27.615000000000002 20.645 80-84 23.465 28.205000000000002 26.99 21.34 85-89 23.04 28.825 27.450000000000003 20.685000000000002 90-94 22.925 28.49 27.615000000000002 20.97 95-99 23.635 28.185 27.29 20.89 100-104 23.13 28.505000000000003 27.46 20.905 105-109 23.595 27.650000000000002 27.74 21.015 110-114 23.875 27.79 28.13 20.205000000000002 115-119 23.925 27.889999999999997 28.07 20.115 120-124 24.310000000000002 28.299999999999997 26.895000000000003 20.495 125-129 23.919999999999998 27.98 27.195000000000004 20.905 130-134 23.595 27.725 27.639999999999997 21.04 135-139 23.669999999999998 27.395000000000003 28.044999999999998 20.89 140-144 23.71 27.99 27.465 20.835 145-149 24.402440244024405 28.277827782778274 27.23272327232723 20.087008700870086 150-151 24.474999999999998 27.8375 27.787499999999998 19.900000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.5 13 1.5 14 1.0 15 0.0 16 1.0 17 1.5 18 1.0 19 0.5 20 0.5 21 1.5 22 1.5 23 1.5 24 3.5 25 6.0 26 9.0 27 8.0 28 8.0 29 12.0 30 14.0 31 23.5 32 37.5 33 50.0 34 62.5 35 76.0 36 94.0 37 123.0 38 147.0 39 167.5 40 193.0 41 222.5 42 250.5 43 241.5 44 234.0 45 270.0 46 290.0 47 264.5 48 223.0 49 179.5 50 159.0 51 137.5 52 106.5 53 91.0 54 71.5 55 47.5 56 37.5 57 31.0 58 21.0 59 14.0 60 9.0 61 6.5 62 4.0 63 5.0 64 6.0 65 4.5 66 2.0 67 1.0 68 1.5 69 2.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 1.0 94 1.0 95 0.5 96 0.5 97 0.5 98 0.0 99 0.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.625 #Duplication Level Percentage of deduplicated Percentage of total 1 85.87887740029542 72.675 2 11.314623338257016 19.15 3 2.0384047267355982 5.175 4 0.5022156573116691 1.7000000000000002 5 0.14771048744460857 0.625 6 0.059084194977843424 0.3 7 0.029542097488921712 0.17500000000000002 8 0.029542097488921712 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 8 0.2 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit GCAGAAGCTAAGTCAGCAATGGCAGCCTCAGTAATGGCTTCATTGAGCCT 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit ATTTGGATAAGGATAGGGTGAAAAAGGTAGACTTGTTTGAGAATGGAACC 5 0.125 No Hit GGAGAGGTGGTGGTAGTTATGACGGTAATAGAAGTAGCAATTCTAATGAT 5 0.125 No Hit AGAGCCCTTACGTGAAGTACTCTCAAAGATATCTCTCGACCTGACTTCAA 5 0.125 No Hit GAGAAATTGAAAGTGAAGAAGGCGATCGAGAAAGGAAACATGGACGGTGC 5 0.125 No Hit CTCTTAAAGAAATCAGAAACCAAAGATGGCTGACAATACCAATAAGATGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 1.8875000000000002 0.0 0.0 0.0 0.0 118-119 1.9625 0.0 0.0 0.0 0.0 120-121 2.2625 0.0 0.0 0.0 0.0 122-123 2.4625 0.0 0.0 0.0 0.0 124-125 2.65 0.0 0.0 0.0 0.0 126-127 2.7750000000000004 0.0 0.0 0.0 0.0 128-129 3.0375 0.0 0.0 0.0 0.0 130-131 3.2750000000000004 0.0 0.0 0.0 0.0 132-133 3.4749999999999996 0.0 0.0 0.0 0.0 134-135 3.7125 0.0 0.0 0.0 0.0 136-137 4.0875 0.0 0.0 0.0 0.0 138-139 4.3375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGCAAA 10 0.006830828 145.0 1 >>END_MODULE Read 1013983 spots for SRR12671395.sra Written 1013983 spots for SRR12671395.sra Read 1013983 spots for SRR12671395.sra Written 1013983 spots for SRR12671395.sra Read 1013983 spots for SRR12671395.sra Written 1013983 spots for SRR12671395.sra Read 1013983 spots for SRR12671395.sra Written 1013983 spots for SRR12671395.sra Read 1013983 spots for SRR12671395.sra Written 1013983 spots for SRR12671395.sra Read 1013983 spots for SRR12671395.sra Written 1013983 spots for SRR12671395.sra Read 1013983 spots for SRR12671395.sra Written 1013983 spots for SRR12671395.sra Read 1013983 spots for SRR12671395.sra Written 1013983 spots for SRR12671395.sra Read 1013983 spots for SRR12671395.sra Written 1013983 spots for SRR12671395.sra Read 1013983 spots for SRR12671395.sra Written 1013983 spots for SRR12671395.sra Read 1013983 spots for SRR12671395.sra Written 1013983 spots for SRR12671395.sra Read 1013983 spots for SRR12671395.sra Written 1013983 spots for SRR12671395.sra Read 1013983 spots for SRR12671395.sra Written 1013983 spots for SRR12671395.sra Read 1013983 spots for SRR12671395.sra Written 1013983 spots for SRR12671395.sra Read 1013983 spots for SRR12671395.sra Written 1013983 spots for SRR12671395.sra Read 1013986 spots for SRR12671395.sra Written 1013986 spots for SRR12671395.sra Read 1013983 spots for SRR12671395.sra Written 1013983 spots for SRR12671395.sra Read 1013983 spots for SRR12671395.sra Written 1013983 spots for SRR12671395.sra Read 1013983 spots for SRR12671395.sra Written 1013983 spots for SRR12671395.sra Read 1013983 spots for SRR12671395.sra Written 1013983 spots for SRR12671395.sra SRR ids: ['SRR12671395.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r330wiko SRR12671395.sra spots: 20279663 blocks: [[1, 1013983], [1013984, 2027966], [2027967, 3041949], [3041950, 4055932], [4055933, 5069915], [5069916, 6083898], [6083899, 7097881], [7097882, 8111864], [8111865, 9125847], [9125848, 10139830], [10139831, 11153813], [11153814, 12167796], [12167797, 13181779], [13181780, 14195762], [14195763, 15209745], [15209746, 16223728], [16223729, 17237711], [17237712, 18251694], [18251695, 19265677], [19265678, 20279663]] SRR12671395 file size 6870216 SRR12671395 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671395 SRR12671395_1.fastq SRR12671395_2.fastq Input file: SRR12671395_1.fastq Paired file: SRR12671395_2.fastq trimmed: SRR12671395-trimmed-pair1.fastq, SRR12671395-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:50:01 2025 >> started Tue Feb 11 21:50:25 2025 >> done (23.382s) 20279663 read pairs processed; of these: 199 ( 0.00%) short read pairs filtered out after trimming by size control 11335 ( 0.06%) empty read pairs filtered out after trimming by size control 20268129 (99.94%) read pairs available; of these: 1099357 ( 5.42%) trimmed read pairs available after processing 19168772 (94.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 14 0.00% 20 15 0.00% 21 28 0.00% 22 34 0.00% 23 45 0.00% 24 34 0.00% 25 45 0.00% 26 56 0.00% 27 30 0.00% 28 46 0.00% 29 66 0.00% 30 39 0.00% 31 59 0.00% 32 58 0.00% 33 41 0.00% 34 51 0.00% 35 45 0.00% 36 43 0.00% 37 54 0.00% 38 44 0.00% 39 54 0.00% 40 49 0.00% 41 49 0.00% 42 51 0.00% 43 57 0.00% 44 48 0.00% 45 73 0.00% 46 71 0.00% 47 68 0.00% 48 84 0.00% 49 95 0.00% 50 102 0.00% 51 116 0.00% 52 115 0.00% 53 124 0.00% 54 120 0.00% 55 162 0.00% 56 191 0.00% 57 142 0.00% 58 200 0.00% 59 253 0.00% 60 258 0.00% 61 319 0.00% 62 353 0.00% 63 404 0.00% 64 433 0.00% 65 502 0.00% 66 529 0.00% 67 530 0.00% 68 658 0.00% 69 809 0.00% 70 875 0.00% 71 895 0.00% 72 1092 0.01% 73 1249 0.01% 74 1255 0.01% 75 1469 0.01% 76 1589 0.01% 77 1762 0.01% 78 1873 0.01% 79 1995 0.01% 80 2316 0.01% 81 2504 0.01% 82 2937 0.01% 83 3054 0.02% 84 3553 0.02% 85 3807 0.02% 86 4104 0.02% 87 4271 0.02% 88 4557 0.02% 89 4791 0.02% 90 4917 0.02% 91 5378 0.03% 92 5686 0.03% 93 6273 0.03% 94 6619 0.03% 95 7252 0.04% 96 7407 0.04% 97 7735 0.04% 98 7705 0.04% 99 8270 0.04% 100 8609 0.04% 101 8857 0.04% 102 9195 0.05% 103 9784 0.05% 104 10155 0.05% 105 10549 0.05% 106 10991 0.05% 107 11386 0.06% 108 11463 0.06% 109 12126 0.06% 110 12265 0.06% 111 12839 0.06% 112 13105 0.06% 113 13400 0.07% 114 13949 0.07% 115 14552 0.07% 116 15057 0.07% 117 15697 0.08% 118 15837 0.08% 119 16029 0.08% 120 16773 0.08% 121 17087 0.08% 122 17384 0.09% 123 17870 0.09% 124 18423 0.09% 125 18350 0.09% 126 19362 0.10% 127 19385 0.10% 128 19897 0.10% 129 20374 0.10% 130 20872 0.10% 131 21362 0.11% 132 21646 0.11% 133 22328 0.11% 134 22567 0.11% 135 23413 0.12% 136 23614 0.12% 137 24424 0.12% 138 24664 0.12% 139 25771 0.13% 140 25760 0.13% 141 26335 0.13% 142 26450 0.13% 143 27208 0.13% 144 28131 0.14% 145 28332 0.14% 146 28872 0.14% 147 29505 0.15% 148 30364 0.15% 149 30146 0.15% 150 31769 0.16% 151 19168772 94.58% 20268129 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=32 prefix-density=0.54 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=15.20 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.1 sequence=GACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=36 prefix-density=0.65 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=32 fanout-score=60.54 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=7.9 sequence=AAAAGAAAAGAAAA SRR12671395 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:51:10 Started mapping on | Feb 11 21:51:11 Finished on | Feb 11 21:53:40 Mapping speed, Million of reads per hour | 489.70 Number of input reads | 20268129 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 18612252 Uniquely mapped reads % | 91.83% Average mapped length | 297.57 Number of splices: Total | 18829401 Number of splices: Annotated (sjdb) | 18442965 Number of splices: GT/AG | 18458714 Number of splices: GC/AG | 307511 Number of splices: AT/AC | 11797 Number of splices: Non-canonical | 51379 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.04 Insertion rate per base | 0.03% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 499919 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 86601 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.10% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1155958 1155958 1155958 N_multimapping 499919 499919 499919 N_noFeature 678517 18336228 769705 N_ambiguous 310315 1211 124866 UnstrandedReadsAssigned:17623420 PositiveStrandReadsAssigned:274813 NegativeStrandReadsAssigned:17717681 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671395 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671395-trimmed-pair1.fastq SRR12671395-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,268,129 reads, 17,746,691 reads pseudoaligned [quant] estimated average fragment length: 297 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52401 SRR12671395.ke.tsv 34699 SRR12671395.se.tsv 87100 total ==> SRR12671395.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1722 970 28.1768 Potri.005G024800.1.v4.1 1035 739 394 26.6689 Potri.004G059700.1.v4.1 961 665.312 3 0.225553 Potri.007G009000.2.v4.1 1416 1120 0 0 Potri.003G141000.2.v4.1 2943 2647 1096.92 20.7289 Potri.016G087400.1.v4.1 270 73.4513 758 516.206 Potri.015G069301.1.v4.1 564 287.985 0 0 Potri.010G195200.1.v4.1 1773 1477 102 3.4544 Potri.012G127500.1.v4.1 977 681.14 65 4.77343 ==> SRR12671395.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 310 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 296 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 2 SRR12671395 completed mapping pipeline successfully