Starting /dee2/code/volunteer_pipeline.sh SRR12671396 current disk space = 3052669898752 free memory = 1449653968 SRR12671396 SRAfilesize 3ccd94db0d36cba5296900074ae85c6c SRR12671396.sra SRR12671396.sra file validated SRR12671396 is paired end SRR12671396 is conventional basespace SRR12671396 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671396_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.576 37.0 37.0 37.0 37.0 37.0 2 36.3255 37.0 37.0 37.0 37.0 37.0 3 36.562 37.0 37.0 37.0 37.0 37.0 4 36.625 37.0 37.0 37.0 37.0 37.0 5 36.5795 37.0 37.0 37.0 37.0 37.0 6 36.5355 37.0 37.0 37.0 37.0 37.0 7 36.5845 37.0 37.0 37.0 37.0 37.0 8 36.587 37.0 37.0 37.0 37.0 37.0 9 36.6215 37.0 37.0 37.0 37.0 37.0 10-14 36.5929 37.0 37.0 37.0 37.0 37.0 15-19 36.61579999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.5623 37.0 37.0 37.0 37.0 37.0 25-29 36.587 37.0 37.0 37.0 37.0 37.0 30-34 36.5004 37.0 37.0 37.0 37.0 37.0 35-39 36.4771 37.0 37.0 37.0 37.0 37.0 40-44 36.508300000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.454299999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.445 37.0 37.0 37.0 37.0 37.0 55-59 36.41760000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.408300000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3919 37.0 37.0 37.0 37.0 37.0 70-74 36.348099999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.3535 37.0 37.0 37.0 37.0 37.0 80-84 36.3671 37.0 37.0 37.0 37.0 37.0 85-89 36.259699999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.2512 37.0 37.0 37.0 37.0 37.0 95-99 36.1854 37.0 37.0 37.0 37.0 37.0 100-104 36.232600000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.235600000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.1231 37.0 37.0 37.0 37.0 37.0 115-119 36.159499999999994 37.0 37.0 37.0 37.0 37.0 120-124 36.145599999999995 37.0 37.0 37.0 37.0 37.0 125-129 36.1111 37.0 37.0 37.0 37.0 37.0 130-134 36.061099999999996 37.0 37.0 37.0 37.0 37.0 135-139 36.0669 37.0 37.0 37.0 37.0 37.0 140-144 35.9224 37.0 37.0 37.0 37.0 37.0 145-149 35.9209 37.0 37.0 37.0 37.0 37.0 150-151 35.83675 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 2.0 24 2.0 25 0.0 26 3.0 27 8.0 28 6.0 29 8.0 30 26.0 31 36.0 32 29.0 33 68.0 34 131.0 35 283.0 36 2966.0 37 429.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.45 11.799999999999999 5.0 36.75 2 18.753129694541812 11.592388582874312 40.385578367551325 29.26890335503255 3 17.2 18.0 28.575 36.225 4 22.675 25.324999999999996 26.1 25.900000000000002 5 23.275000000000002 32.7 24.15 19.875 6 17.424999999999997 34.0 26.325 22.25 7 14.399999999999999 25.55 44.375 15.675 8 14.549999999999999 22.625 35.699999999999996 27.125 9 17.4 22.575 35.55 24.474999999999998 10-14 19.735 30.070000000000004 27.57 22.625 15-19 19.61 28.095 28.485 23.810000000000002 20-24 19.634999999999998 27.93 27.91 24.525 25-29 19.045 27.96 29.17 23.825 30-34 19.605 28.53 27.965 23.9 35-39 20.19 28.310000000000002 27.700000000000003 23.799999999999997 40-44 20.31 28.355000000000004 28.044999999999998 23.29 45-49 19.975 28.475 27.775 23.775 50-54 20.22 28.794999999999998 27.250000000000004 23.735 55-59 19.685 28.675 27.905 23.735 60-64 19.985 28.799999999999997 27.805000000000003 23.41 65-69 20.544999999999998 28.205000000000002 27.785 23.465 70-74 20.365 28.455000000000002 27.525 23.655 75-79 19.994999999999997 28.185 27.805000000000003 24.015 80-84 20.155 27.665 27.87 24.310000000000002 85-89 20.495 27.785 28.22 23.5 90-94 20.724999999999998 28.265 27.91 23.1 95-99 20.03 29.035 27.565 23.369999999999997 100-104 19.665 29.14 27.67 23.525 105-109 19.794999999999998 28.54 27.800000000000004 23.865 110-114 20.4 28.71 27.375 23.515 115-119 20.485 28.27 27.845 23.400000000000002 120-124 19.74 28.675 27.439999999999998 24.145 125-129 20.27 28.205000000000002 27.595 23.93 130-134 20.57 28.335 27.145000000000003 23.95 135-139 20.915 28.560000000000002 27.24 23.285 140-144 20.685000000000002 27.685 27.735 23.895 145-149 20.62 28.125 26.765 24.490000000000002 150-151 20.8125 28.3125 27.250000000000004 23.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.0 18 1.5 19 1.5 20 0.5 21 1.5 22 3.5 23 3.5 24 1.5 25 4.0 26 6.5 27 6.5 28 10.5 29 20.5 30 25.5 31 25.5 32 32.5 33 44.5 34 58.0 35 68.5 36 93.0 37 111.5 38 122.5 39 146.5 40 161.5 41 185.0 42 235.0 43 260.5 44 276.5 45 282.5 46 278.0 47 263.0 48 240.5 49 216.0 50 164.0 51 134.0 52 125.0 53 96.5 54 58.0 55 51.0 56 57.0 57 44.5 58 26.0 59 15.5 60 9.0 61 8.5 62 7.0 63 4.5 64 3.0 65 0.5 66 0.0 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.5 #Duplication Level Percentage of deduplicated Percentage of total 1 85.17751479289942 71.975 2 11.893491124260356 20.1 3 2.485207100591716 6.3 4 0.38461538461538464 1.3 5 0.0 0.0 6 0.02958579881656805 0.15 7 0.02958579881656805 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACC 7 0.17500000000000002 No Hit CTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 0.9875 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.25 0.0 0.0 0.0 0.0 118-119 1.35 0.0 0.0 0.0 0.0 120-121 1.4249999999999998 0.0 0.0 0.0 0.0 122-123 1.5625 0.0 0.0 0.0 0.0 124-125 1.775 0.0 0.0 0.0 0.0 126-127 1.8875000000000002 0.0 0.0 0.0 0.0 128-129 2.0375 0.0 0.0 0.0 0.0 130-131 2.2375 0.0 0.0 0.0 0.0 132-133 2.4 0.0 0.0 0.0 0.0 134-135 2.55 0.0 0.0 0.0 0.0 136-137 2.7375 0.0 0.0 0.0 0.0 138-139 2.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGGAAT 10 0.006830828 145.0 3 >>END_MODULE SRR12671396 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671396_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.234 37.0 37.0 37.0 37.0 37.0 2 36.021 37.0 37.0 37.0 37.0 37.0 3 36.0955 37.0 37.0 37.0 37.0 37.0 4 36.1275 37.0 37.0 37.0 37.0 37.0 5 36.2495 37.0 37.0 37.0 37.0 37.0 6 36.2175 37.0 37.0 37.0 37.0 37.0 7 36.206 37.0 37.0 37.0 37.0 37.0 8 36.142 37.0 37.0 37.0 37.0 37.0 9 36.2385 37.0 37.0 37.0 37.0 37.0 10-14 36.2516 37.0 37.0 37.0 37.0 37.0 15-19 36.276300000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.221199999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.1554 37.0 37.0 37.0 37.0 37.0 30-34 36.2003 37.0 37.0 37.0 37.0 37.0 35-39 36.14200000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.0779 37.0 37.0 37.0 37.0 37.0 45-49 36.1229 37.0 37.0 37.0 37.0 37.0 50-54 36.0566 37.0 37.0 37.0 37.0 37.0 55-59 36.0238 37.0 37.0 37.0 37.0 37.0 60-64 36.033100000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.0158 37.0 37.0 37.0 37.0 37.0 70-74 35.960100000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.9605 37.0 37.0 37.0 37.0 37.0 80-84 35.8902 37.0 37.0 37.0 37.0 37.0 85-89 35.9224 37.0 37.0 37.0 37.0 37.0 90-94 35.9428 37.0 37.0 37.0 37.0 37.0 95-99 35.8432 37.0 37.0 37.0 37.0 37.0 100-104 35.861000000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.7928 37.0 37.0 37.0 37.0 37.0 110-114 35.7401 37.0 37.0 37.0 37.0 37.0 115-119 35.805499999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.7467 37.0 37.0 37.0 37.0 37.0 125-129 35.7671 37.0 37.0 37.0 37.0 37.0 130-134 35.5805 37.0 37.0 37.0 37.0 37.0 135-139 35.5148 37.0 37.0 37.0 37.0 37.0 140-144 35.5896 37.0 37.0 37.0 37.0 37.0 145-149 35.5308 37.0 37.0 37.0 37.0 37.0 150-151 35.338750000000005 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 0.0 15 1.0 16 0.0 17 1.0 18 1.0 19 0.0 20 1.0 21 3.0 22 6.0 23 3.0 24 2.0 25 7.0 26 4.0 27 18.0 28 19.0 29 20.0 30 29.0 31 24.0 32 58.0 33 108.0 34 217.0 35 541.0 36 2664.0 37 270.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.75 22.85 8.15 24.25 2 25.224999999999998 25.1 35.025 14.649999999999999 3 19.6 26.625 36.025 17.75 4 24.55 34.0 22.175 19.275000000000002 5 24.525 39.225 20.4 15.85 6 19.8 42.25 20.875 17.075000000000003 7 20.375 22.0 37.974999999999994 19.650000000000002 8 19.075 25.8 30.4 24.725 9 20.075000000000003 24.474999999999998 31.474999999999998 23.974999999999998 10-14 22.900000000000002 29.59 27.32 20.19 15-19 22.81 28.13 28.04 21.02 20-24 22.325 28.720000000000002 27.82 21.135 25-29 22.13 27.99 28.34 21.54 30-34 22.27 28.78 27.894999999999996 21.055 35-39 22.75 28.525 27.82 20.905 40-44 23.075000000000003 28.185 28.105000000000004 20.635 45-49 22.759999999999998 28.005000000000003 28.32 20.915 50-54 22.97 27.334999999999997 28.68 21.015 55-59 22.425 28.305000000000003 28.205000000000002 21.065 60-64 22.575 28.560000000000002 27.505000000000003 21.36 65-69 22.615 27.389999999999997 28.625 21.37 70-74 23.375 27.92 27.339999999999996 21.365000000000002 75-79 23.330000000000002 27.74 27.575 21.355 80-84 23.064999999999998 27.755000000000003 27.735 21.445 85-89 23.330000000000002 28.62 27.255000000000003 20.794999999999998 90-94 22.805 28.535 27.605 21.055 95-99 23.735 27.295 27.925 21.044999999999998 100-104 23.369999999999997 27.900000000000002 27.224999999999998 21.505 105-109 23.405 28.134999999999998 27.884999999999998 20.575 110-114 23.7 27.860000000000003 27.939999999999998 20.5 115-119 23.59 28.794999999999998 27.04 20.575 120-124 23.845 28.15 27.55 20.455000000000002 125-129 23.73 28.075 27.860000000000003 20.335 130-134 24.095 27.97 27.54 20.395 135-139 23.775 27.33 28.084999999999997 20.810000000000002 140-144 24.01 27.99 27.55 20.45 145-149 24.39 28.299999999999997 27.045 20.265 150-151 24.775 27.675 27.224999999999998 20.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 0.5 23 2.0 24 3.0 25 3.0 26 2.5 27 7.0 28 12.0 29 21.0 30 27.0 31 23.5 32 30.0 33 44.0 34 65.0 35 81.0 36 84.5 37 108.0 38 136.0 39 157.0 40 172.5 41 203.0 42 254.0 43 289.5 44 286.0 45 265.5 46 263.5 47 258.0 48 237.0 49 202.5 50 159.5 51 123.0 52 99.0 53 82.0 54 71.5 55 62.0 56 47.5 57 30.5 58 19.5 59 16.5 60 11.0 61 9.0 62 11.0 63 4.5 64 1.0 65 1.0 66 0.5 67 1.5 68 1.0 69 0.0 70 0.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 85.27843601895735 71.975 2 12.05568720379147 20.349999999999998 3 2.251184834123223 5.7 4 0.32582938388625593 1.0999999999999999 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.08886255924170616 0.8750000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 13 0.325 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 11 0.27499999999999997 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 11 0.27499999999999997 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8375 0.0 0.0 0.0 0.0 110-111 0.9 0.0 0.0 0.0 0.0 112-113 1.0125000000000002 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.275 0.0 0.0 0.0 0.0 118-119 1.375 0.0 0.0 0.0 0.0 120-121 1.4500000000000002 0.0 0.0 0.0 0.0 122-123 1.5875 0.0 0.0 0.0 0.0 124-125 1.8 0.0 0.0 0.0 0.0 126-127 1.9125 0.0 0.0 0.0 0.0 128-129 2.0625 0.0 0.0 0.0 0.0 130-131 2.2625 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.575 0.0 0.0 0.0 0.0 136-137 2.7625 0.0 0.0 0.0 0.0 138-139 2.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTCCAT 10 0.006830828 145.0 5 >>END_MODULE Read 846994 spots for SRR12671396.sra Written 846994 spots for SRR12671396.sra Read 846994 spots for SRR12671396.sra Written 846994 spots for SRR12671396.sra Read 846994 spots for SRR12671396.sra Written 846994 spots for SRR12671396.sra Read 846994 spots for SRR12671396.sra Written 846994 spots for SRR12671396.sra Read 846994 spots for SRR12671396.sra Written 846994 spots for SRR12671396.sra Read 846994 spots for SRR12671396.sra Written 846994 spots for SRR12671396.sra Read 846994 spots for SRR12671396.sra Written 846994 spots for SRR12671396.sra Read 846994 spots for SRR12671396.sra Written 846994 spots for SRR12671396.sra Read 847005 spots for SRR12671396.sra Written 847005 spots for SRR12671396.sra Read 846994 spots for SRR12671396.sra Written 846994 spots for SRR12671396.sra Read 846994 spots for SRR12671396.sra Written 846994 spots for SRR12671396.sra Read 846994 spots for SRR12671396.sra Written 846994 spots for SRR12671396.sra Read 846994 spots for SRR12671396.sra Written 846994 spots for SRR12671396.sra Read 846994 spots for SRR12671396.sra Written 846994 spots for SRR12671396.sra Read 846994 spots for SRR12671396.sra Written 846994 spots for SRR12671396.sra Read 846994 spots for SRR12671396.sra Written 846994 spots for SRR12671396.sra Read 846994 spots for SRR12671396.sra Written 846994 spots for SRR12671396.sra Read 846994 spots for SRR12671396.sra Written 846994 spots for SRR12671396.sra Read 846994 spots for SRR12671396.sra Written 846994 spots for SRR12671396.sra Read 846994 spots for SRR12671396.sra Written 846994 spots for SRR12671396.sra SRR ids: ['SRR12671396.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ozchunvp SRR12671396.sra spots: 16939891 blocks: [[1, 846994], [846995, 1693988], [1693989, 2540982], [2540983, 3387976], [3387977, 4234970], [4234971, 5081964], [5081965, 5928958], [5928959, 6775952], [6775953, 7622946], [7622947, 8469940], [8469941, 9316934], [9316935, 10163928], [10163929, 11010922], [11010923, 11857916], [11857917, 12704910], [12704911, 13551904], [13551905, 14398898], [14398899, 15245892], [15245893, 16092886], [16092887, 16939891]] SRR12671396 file size 5735215 SRR12671396 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671396 SRR12671396_1.fastq SRR12671396_2.fastq Input file: SRR12671396_1.fastq Paired file: SRR12671396_2.fastq trimmed: SRR12671396-trimmed-pair1.fastq, SRR12671396-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 21:30:13 2025 >> started Tue Feb 11 21:30:32 2025 >> done (19.706s) 16939891 read pairs processed; of these: 98 ( 0.00%) short read pairs filtered out after trimming by size control 2202 ( 0.01%) empty read pairs filtered out after trimming by size control 16937591 (99.99%) read pairs available; of these: 745162 ( 4.40%) trimmed read pairs available after processing 16192429 (95.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 22 0.00% 19 7 0.00% 20 9 0.00% 21 13 0.00% 22 18 0.00% 23 19 0.00% 24 13 0.00% 25 16 0.00% 26 19 0.00% 27 29 0.00% 28 24 0.00% 29 37 0.00% 30 15 0.00% 31 25 0.00% 32 26 0.00% 33 26 0.00% 34 40 0.00% 35 22 0.00% 36 17 0.00% 37 30 0.00% 38 30 0.00% 39 42 0.00% 40 21 0.00% 41 22 0.00% 42 28 0.00% 43 44 0.00% 44 41 0.00% 45 28 0.00% 46 34 0.00% 47 47 0.00% 48 60 0.00% 49 62 0.00% 50 50 0.00% 51 69 0.00% 52 64 0.00% 53 71 0.00% 54 70 0.00% 55 88 0.00% 56 88 0.00% 57 99 0.00% 58 111 0.00% 59 135 0.00% 60 142 0.00% 61 169 0.00% 62 214 0.00% 63 228 0.00% 64 219 0.00% 65 310 0.00% 66 292 0.00% 67 338 0.00% 68 355 0.00% 69 430 0.00% 70 443 0.00% 71 560 0.00% 72 652 0.00% 73 709 0.00% 74 755 0.00% 75 867 0.01% 76 912 0.01% 77 996 0.01% 78 1051 0.01% 79 1192 0.01% 80 1268 0.01% 81 1409 0.01% 82 1642 0.01% 83 1748 0.01% 84 1977 0.01% 85 2124 0.01% 86 2225 0.01% 87 2349 0.01% 88 2605 0.02% 89 2636 0.02% 90 2938 0.02% 91 3066 0.02% 92 3355 0.02% 93 3585 0.02% 94 3846 0.02% 95 4071 0.02% 96 4362 0.03% 97 4682 0.03% 98 4749 0.03% 99 4972 0.03% 100 5145 0.03% 101 5338 0.03% 102 5795 0.03% 103 6095 0.04% 104 6229 0.04% 105 6313 0.04% 106 6766 0.04% 107 6932 0.04% 108 7283 0.04% 109 7461 0.04% 110 7528 0.04% 111 7821 0.05% 112 8392 0.05% 113 8508 0.05% 114 8863 0.05% 115 9180 0.05% 116 9650 0.06% 117 9973 0.06% 118 10219 0.06% 119 10390 0.06% 120 10911 0.06% 121 11424 0.07% 122 11386 0.07% 123 11986 0.07% 124 12173 0.07% 125 12512 0.07% 126 12945 0.08% 127 13548 0.08% 128 13847 0.08% 129 14191 0.08% 130 14547 0.09% 131 14720 0.09% 132 15084 0.09% 133 15386 0.09% 134 15893 0.09% 135 16072 0.09% 136 16783 0.10% 137 17459 0.10% 138 17806 0.11% 139 18629 0.11% 140 18675 0.11% 141 19389 0.11% 142 19508 0.12% 143 19802 0.12% 144 20333 0.12% 145 20962 0.12% 146 21448 0.13% 147 21661 0.13% 148 22785 0.13% 149 23119 0.14% 150 24123 0.14% 151 16192429 95.60% 16937591 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=21 prefix-density=0.44 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=26 fanout-score=12.11 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=4.6 sequence=TTTTTTGGAAAAACATATTCAAGAAATCTTGCTCGGCAAAGGGGGTTGGTGGGGTGATCTGCAGCCTCTCAAGAAGGCTCTCATAAGTCAAACGACTAGGCTCAAATACAAACATCCCAGCATTGAAGTACAGGGGAGGAGGAGAGCCCATCTCAGCAGGCCATGTTATCTTTTCCGGGCACTGCTGGCAGTAGCCGACGGAGTATTGAGGGGAGTGGCTCCATGTTTTCTCACAGAAGCAGTCCATCACGGCGTAGAAGTAGCCATCTTGGGTGTCAAATAGATGGTCTATATTCTCGAACACTTGGATATCAGCATCCAAATATATCATCTTGCTGTACTCCTCAAAATTCCAAATTCGGAGCTTGGAGTAGTTGATCACGTAGTAGGCCATGGCAAACTGAATCTGGTTCTCAGGTGGATAAATAGGCTCGATCTCACGAACAATGCAACCTTGAGACCTCAAAATGTCACGGTGTTCCTCGGGCACATCCGGCAAGATTGCTACGAC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=26 prefix-density=0.54 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=73.05 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=9.4 sequence=AAAAGAAAAGAAAA SRR12671396 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 21:31:27 Started mapping on | Feb 11 21:31:28 Finished on | Feb 11 21:33:30 Mapping speed, Million of reads per hour | 499.80 Number of input reads | 16937591 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 15432587 Uniquely mapped reads % | 91.11% Average mapped length | 298.06 Number of splices: Total | 15506577 Number of splices: Annotated (sjdb) | 15175088 Number of splices: GT/AG | 15195313 Number of splices: GC/AG | 247899 Number of splices: AT/AC | 9788 Number of splices: Non-canonical | 53577 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 406988 % of reads mapped to multiple loci | 2.40% Number of reads mapped to too many loci | 153337 % of reads mapped to too many loci | 0.91% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.33% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1098016 1098016 1098016 N_multimapping 406988 406988 406988 N_noFeature 620188 15148071 694092 N_ambiguous 313803 1144 102529 UnstrandedReadsAssigned:14498596 PositiveStrandReadsAssigned:283372 NegativeStrandReadsAssigned:14635966 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671396 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671396-trimmed-pair1.fastq SRR12671396-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,937,591 reads, 14,606,587 reads pseudoaligned [quant] estimated average fragment length: 306.927 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR12671396.ke.tsv 34699 SRR12671396.se.tsv 87100 total ==> SRR12671396.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1712.07 610 20.6799 Potri.005G024800.1.v4.1 1035 729.073 291 23.1666 Potri.004G059700.1.v4.1 961 655.535 2 0.177082 Potri.007G009000.2.v4.1 1416 1110.07 0 0 Potri.003G141000.2.v4.1 2943 2637.07 896.93 19.7414 Potri.016G087400.1.v4.1 270 71.0048 605 494.548 Potri.015G069301.1.v4.1 564 283.577 0 0 Potri.010G195200.1.v4.1 1773 1467.07 122 4.82668 Potri.012G127500.1.v4.1 977 671.376 48 4.14969 ==> SRR12671396.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 147 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 155 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12671396 completed mapping pipeline successfully