Starting /dee2/code/volunteer_pipeline.sh SRR12671397 current disk space = 3052618092544 free memory = 1464288660 SRR12671397 SRAfilesize d1002b90402c7741b1d2900d74b3b3aa SRR12671397.sra SRR12671397.sra file validated SRR12671397 is paired end SRR12671397 is conventional basespace SRR12671397 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671397_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5445 37.0 37.0 37.0 37.0 37.0 2 36.32775 37.0 37.0 37.0 37.0 37.0 3 36.548 37.0 37.0 37.0 37.0 37.0 4 36.549 37.0 37.0 37.0 37.0 37.0 5 36.616 37.0 37.0 37.0 37.0 37.0 6 36.6415 37.0 37.0 37.0 37.0 37.0 7 36.561 37.0 37.0 37.0 37.0 37.0 8 36.5405 37.0 37.0 37.0 37.0 37.0 9 36.6445 37.0 37.0 37.0 37.0 37.0 10-14 36.586 37.0 37.0 37.0 37.0 37.0 15-19 36.5537 37.0 37.0 37.0 37.0 37.0 20-24 36.5458 37.0 37.0 37.0 37.0 37.0 25-29 36.539699999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.53750000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.440200000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.4846 37.0 37.0 37.0 37.0 37.0 45-49 36.452099999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.4095 37.0 37.0 37.0 37.0 37.0 55-59 36.3846 37.0 37.0 37.0 37.0 37.0 60-64 36.3632 37.0 37.0 37.0 37.0 37.0 65-69 36.3221 37.0 37.0 37.0 37.0 37.0 70-74 36.3291 37.0 37.0 37.0 37.0 37.0 75-79 36.312200000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.269400000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.264399999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.2173 37.0 37.0 37.0 37.0 37.0 95-99 36.213899999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.1713 37.0 37.0 37.0 37.0 37.0 105-109 36.1611 37.0 37.0 37.0 37.0 37.0 110-114 36.103500000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.0584 37.0 37.0 37.0 37.0 37.0 120-124 36.0778 37.0 37.0 37.0 37.0 37.0 125-129 36.0689 37.0 37.0 37.0 37.0 37.0 130-134 36.047200000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.950900000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.9587 37.0 37.0 37.0 37.0 37.0 145-149 35.924099999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.74925 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 3.0 21 0.0 22 1.0 23 5.0 24 1.0 25 4.0 26 8.0 27 10.0 28 3.0 29 17.0 30 16.0 31 39.0 32 40.0 33 71.0 34 112.0 35 281.0 36 2931.0 37 458.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.0 10.35 5.800000000000001 35.85 2 21.308598646277265 10.453747806467787 38.48082226121835 29.7568312860366 3 18.725 19.3 27.175 34.8 4 23.799999999999997 24.725 23.175 28.299999999999997 5 23.7 31.3 25.025 19.975 6 20.599999999999998 35.15 23.05 21.2 7 14.45 26.900000000000002 43.4 15.25 8 16.475 25.15 34.2 24.175 9 18.075 22.15 34.949999999999996 24.825 10-14 19.395 30.570000000000004 27.865000000000002 22.17 15-19 20.445 27.67 28.389999999999997 23.494999999999997 20-24 19.88 28.29 27.750000000000004 24.08 25-29 20.474999999999998 27.73 28.1 23.695 30-34 19.685 29.304999999999996 27.55 23.46 35-39 20.34 27.950000000000003 28.01 23.7 40-44 20.235 28.999999999999996 27.779999999999998 22.985 45-49 20.43 28.02 27.725 23.825 50-54 20.87 28.244999999999997 27.595 23.29 55-59 19.830000000000002 29.065 27.339999999999996 23.765 60-64 20.06 28.185 27.985 23.77 65-69 20.46 28.21 27.605 23.724999999999998 70-74 20.615 28.055000000000003 27.92 23.41 75-79 19.689999999999998 28.43 28.49 23.39 80-84 20.43 28.32 27.48 23.77 85-89 19.955000000000002 28.7 27.24 24.104999999999997 90-94 19.545 27.860000000000003 28.215 24.38 95-99 20.535 28.410000000000004 27.334999999999997 23.72 100-104 20.01 28.655 27.715 23.62 105-109 20.835 28.115000000000002 27.860000000000003 23.189999999999998 110-114 20.785 27.79 27.975 23.45 115-119 21.14 27.495000000000005 27.1 24.265 120-124 20.599999999999998 28.53 27.16 23.71 125-129 20.724999999999998 27.639999999999997 28.15 23.485 130-134 20.615 27.905 27.715 23.765 135-139 20.635 27.725 27.315 24.325 140-144 20.974999999999998 27.43 27.615000000000002 23.98 145-149 20.794999999999998 28.33 27.325 23.549999999999997 150-151 20.6125 28.549999999999997 28.375 22.4625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 2.0 22 5.0 23 4.5 24 4.5 25 6.0 26 9.0 27 11.0 28 10.0 29 15.0 30 22.0 31 27.0 32 35.0 33 38.0 34 47.0 35 66.0 36 83.0 37 110.5 38 133.0 39 151.0 40 168.5 41 197.5 42 231.5 43 236.5 44 239.5 45 253.5 46 263.0 47 252.5 48 246.5 49 220.5 50 183.0 51 162.5 52 125.5 53 102.5 54 93.0 55 78.0 56 53.0 57 29.0 58 20.0 59 20.0 60 14.5 61 7.0 62 6.5 63 3.5 64 1.0 65 0.0 66 0.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.0 #Duplication Level Percentage of deduplicated Percentage of total 1 84.76190476190476 71.2 2 12.380952380952381 20.8 3 2.142857142857143 5.4 4 0.5654761904761905 1.9 5 0.08928571428571429 0.375 6 0.029761904761904764 0.15 7 0.029761904761904764 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGCCTGGTACCTTTTGCTTTTCTGATTCTCTTACAACCCATAGAAAGTGA 7 0.17500000000000002 No Hit GGGAGTTTCAGTTGACAAAAATTAGAGGCTTGTAATTGGCTTTTCTTCCT 6 0.15 No Hit GCGGTGTGTACAAGGCCCGGGAACGAATTCACCGCCGTATGGCTGACCGG 5 0.125 No Hit GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 5 0.125 No Hit GAAACCTAGAACAATAGCTATCGATGGCTGTAAATACTCCAAATCTGCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.30000000000000004 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.5875 0.0 0.0 0.0 0.0 110-111 0.6625 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 0.925 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.2 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.5 0.0 0.0 0.0 0.0 128-129 1.6 0.0 0.0 0.0 0.0 130-131 1.75 0.0 0.0 0.0 0.0 132-133 1.9875 0.0 0.0 0.0 0.0 134-135 2.1875 0.0 0.0 0.0 0.0 136-137 2.2750000000000004 0.0 0.0 0.0 0.0 138-139 2.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAGAT 10 0.006830828 145.0 2 >>END_MODULE SRR12671397 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671397_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.061 37.0 37.0 37.0 37.0 37.0 2 35.9925 37.0 37.0 37.0 37.0 37.0 3 36.031 37.0 37.0 37.0 37.0 37.0 4 36.0055 37.0 37.0 37.0 37.0 37.0 5 36.142 37.0 37.0 37.0 37.0 37.0 6 36.082 37.0 37.0 37.0 37.0 37.0 7 36.023 37.0 37.0 37.0 37.0 37.0 8 36.158 37.0 37.0 37.0 37.0 37.0 9 36.1075 37.0 37.0 37.0 37.0 37.0 10-14 36.0524 37.0 37.0 37.0 37.0 37.0 15-19 36.0681 37.0 37.0 37.0 37.0 37.0 20-24 36.0491 37.0 37.0 37.0 37.0 37.0 25-29 36.045100000000005 37.0 37.0 37.0 37.0 37.0 30-34 35.974599999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.9344 37.0 37.0 37.0 37.0 37.0 40-44 35.8945 37.0 37.0 37.0 37.0 37.0 45-49 35.935100000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.9007 37.0 37.0 37.0 37.0 37.0 55-59 35.8245 37.0 37.0 37.0 37.0 37.0 60-64 35.8386 37.0 37.0 37.0 37.0 37.0 65-69 35.788799999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.849199999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.7181 37.0 37.0 37.0 37.0 37.0 80-84 35.6782 37.0 37.0 37.0 37.0 37.0 85-89 35.7288 37.0 37.0 37.0 37.0 37.0 90-94 35.7566 37.0 37.0 37.0 37.0 37.0 95-99 35.7187 37.0 37.0 37.0 37.0 37.0 100-104 35.6099 37.0 37.0 37.0 37.0 37.0 105-109 35.57039999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.506 37.0 37.0 37.0 37.0 37.0 115-119 35.5749 37.0 37.0 37.0 37.0 37.0 120-124 35.6084 37.0 37.0 37.0 37.0 37.0 125-129 35.4922 37.0 37.0 37.0 37.0 37.0 130-134 35.48140000000001 37.0 37.0 37.0 34.6 37.0 135-139 35.3859 37.0 37.0 37.0 37.0 37.0 140-144 35.436499999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.400999999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.2465 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 7.0 14 6.0 15 2.0 16 2.0 17 1.0 18 1.0 19 0.0 20 6.0 21 6.0 22 6.0 23 11.0 24 10.0 25 8.0 26 10.0 27 7.0 28 14.0 29 19.0 30 38.0 31 52.0 32 46.0 33 105.0 34 208.0 35 543.0 36 2671.0 37 220.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.875 22.35 10.225 23.549999999999997 2 27.975 23.775 32.65 15.6 3 21.325 26.650000000000002 34.675 17.349999999999998 4 23.849999999999998 33.275 22.7 20.175 5 25.85 35.775 22.650000000000002 15.725 6 19.925 40.075 21.0 19.0 7 21.275 22.1 37.8 18.825 8 19.875 25.45 30.3 24.375 9 22.625 25.374999999999996 28.599999999999998 23.400000000000002 10-14 23.355 28.74 26.985 20.919999999999998 15-19 23.345 27.685 27.525 21.445 20-24 22.900000000000002 28.505000000000003 27.625 20.97 25-29 22.509999999999998 28.244999999999997 28.285 20.96 30-34 22.56 28.235 28.21 20.995 35-39 22.655 27.68 28.555000000000003 21.11 40-44 22.675 28.965000000000003 27.560000000000002 20.8 45-49 22.21 27.815 28.34 21.634999999999998 50-54 23.035 28.065 27.85 21.05 55-59 23.150000000000002 27.925 28.349999999999998 20.575 60-64 22.675 27.400000000000002 27.935 21.990000000000002 65-69 22.615 28.435 27.41 21.54 70-74 23.015 28.03 27.485 21.47 75-79 22.805 28.12 27.985 21.09 80-84 23.13 28.439999999999998 27.439999999999998 20.990000000000002 85-89 23.665 28.139999999999997 27.305 20.89 90-94 23.189999999999998 27.944999999999997 27.85 21.015 95-99 23.77 28.155 27.685 20.39 100-104 23.895 27.83 27.54 20.735 105-109 23.65 27.855 27.63 20.865000000000002 110-114 23.595 28.634999999999998 27.279999999999998 20.49 115-119 24.335 28.494999999999997 26.8 20.369999999999997 120-124 23.59 28.38 27.415 20.615 125-129 23.785 28.23 27.18 20.805 130-134 23.26 27.689999999999998 27.584999999999997 21.465 135-139 24.025 27.415 27.93 20.630000000000003 140-144 24.3 28.235 27.334999999999997 20.13 145-149 24.255 27.755000000000003 27.42 20.57 150-151 24.0375 28.6375 26.987499999999997 20.3375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 1.5 13 3.5 14 2.0 15 0.5 16 3.5 17 4.0 18 1.0 19 1.5 20 2.0 21 0.5 22 2.5 23 3.0 24 3.0 25 6.0 26 7.5 27 9.0 28 13.5 29 14.0 30 14.5 31 21.0 32 25.0 33 33.5 34 53.0 35 71.5 36 78.5 37 87.5 38 122.5 39 163.0 40 202.5 41 231.0 42 244.0 43 282.0 44 296.0 45 250.5 46 239.0 47 240.0 48 209.5 49 195.0 50 176.5 51 140.5 52 114.0 53 96.0 54 80.5 55 63.0 56 49.0 57 40.0 58 25.5 59 18.0 60 15.0 61 10.5 62 6.0 63 4.5 64 3.0 65 1.5 66 1.5 67 2.0 68 1.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.65 #Duplication Level Percentage of deduplicated Percentage of total 1 85.49911399881867 72.375 2 11.872415829887775 20.1 3 1.9492025989367987 4.95 4 0.5020673360897815 1.7000000000000002 5 0.05906674542232723 0.25 6 0.08860011813349085 0.44999999999999996 7 0.029533372711163616 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TGTCGACTGGATGGCGAGCAAGTGGCCAGTCAAGCCAATAGGACCAACAA 7 0.17500000000000002 No Hit GAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCA 6 0.15 No Hit GAGCTAACTCCAAAAACCCGTCCTCAGTTCGGATTGCAGGCTGTAACTCG 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit GAGGCAGTCAACCTATTCCTGGCTACAATACTCCTTTACTCATCTTTCAA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.6625000000000001 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.7875000000000001 0.0 0.0 0.0 0.0 116-117 0.85 0.0 0.0 0.0 0.0 118-119 0.9 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.175 0.0 0.0 0.0 0.0 124-125 1.35 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.575 0.0 0.0 0.0 0.0 130-131 1.725 0.0 0.0 0.0 0.0 132-133 1.9625 0.0 0.0 0.0 0.0 134-135 2.1625 0.0 0.0 0.0 0.0 136-137 2.25 0.0 0.0 0.0 0.0 138-139 2.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCCCT 10 0.006830828 145.0 7 >>END_MODULE Read 1052477 spots for SRR12671397.sra Written 1052477 spots for SRR12671397.sra Read 1052477 spots for SRR12671397.sra Written 1052477 spots for SRR12671397.sra Read 1052477 spots for SRR12671397.sra Written 1052477 spots for SRR12671397.sra Read 1052477 spots for SRR12671397.sra Written 1052477 spots for SRR12671397.sra Read 1052477 spots for SRR12671397.sra Written 1052477 spots for SRR12671397.sra Read 1052477 spots for SRR12671397.sra Written 1052477 spots for SRR12671397.sra Read 1052477 spots for SRR12671397.sra Written 1052477 spots for SRR12671397.sra Read 1052477 spots for SRR12671397.sra Written 1052477 spots for SRR12671397.sra Read 1052477 spots for SRR12671397.sra Written 1052477 spots for SRR12671397.sra Read 1052477 spots for SRR12671397.sra Written 1052477 spots for SRR12671397.sra Read 1052477 spots for SRR12671397.sra Written 1052477 spots for SRR12671397.sra Read 1052477 spots for SRR12671397.sra Written 1052477 spots for SRR12671397.sra Read 1052477 spots for SRR12671397.sra Written 1052477 spots for SRR12671397.sra Read 1052477 spots for SRR12671397.sra Written 1052477 spots for SRR12671397.sra Read 1052477 spots for SRR12671397.sra Written 1052477 spots for SRR12671397.sra Read 1052477 spots for SRR12671397.sra Written 1052477 spots for SRR12671397.sra Read 1052477 spots for SRR12671397.sra Written 1052477 spots for SRR12671397.sra Read 1052477 spots for SRR12671397.sra Written 1052477 spots for SRR12671397.sra Read 1052477 spots for SRR12671397.sra Written 1052477 spots for SRR12671397.sra Read 1052490 spots for SRR12671397.sra Written 1052490 spots for SRR12671397.sra SRR ids: ['SRR12671397.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dtv04m99 SRR12671397.sra spots: 21049553 blocks: [[1, 1052477], [1052478, 2104954], [2104955, 3157431], [3157432, 4209908], [4209909, 5262385], [5262386, 6314862], [6314863, 7367339], [7367340, 8419816], [8419817, 9472293], [9472294, 10524770], [10524771, 11577247], [11577248, 12629724], [12629725, 13682201], [13682202, 14734678], [14734679, 15787155], [15787156, 16839632], [16839633, 17892109], [17892110, 18944586], [18944587, 19997063], [19997064, 21049553]] SRR12671397 file size 7131858 SRR12671397 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671397 SRR12671397_1.fastq SRR12671397_2.fastq Input file: SRR12671397_1.fastq Paired file: SRR12671397_2.fastq trimmed: SRR12671397-trimmed-pair1.fastq, SRR12671397-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:02:29 2025 >> started Tue Feb 11 22:02:52 2025 >> done (23.222s) 21049553 read pairs processed; of these: 98 ( 0.00%) short read pairs filtered out after trimming by size control 4042 ( 0.02%) empty read pairs filtered out after trimming by size control 21045413 (99.98%) read pairs available; of these: 750930 ( 3.57%) trimmed read pairs available after processing 20294483 (96.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 5 0.00% 20 7 0.00% 21 10 0.00% 22 13 0.00% 23 14 0.00% 24 9 0.00% 25 19 0.00% 26 10 0.00% 27 15 0.00% 28 15 0.00% 29 23 0.00% 30 21 0.00% 31 17 0.00% 32 17 0.00% 33 19 0.00% 34 18 0.00% 35 21 0.00% 36 13 0.00% 37 25 0.00% 38 17 0.00% 39 17 0.00% 40 22 0.00% 41 25 0.00% 42 29 0.00% 43 25 0.00% 44 25 0.00% 45 28 0.00% 46 37 0.00% 47 36 0.00% 48 40 0.00% 49 39 0.00% 50 71 0.00% 51 58 0.00% 52 58 0.00% 53 86 0.00% 54 72 0.00% 55 89 0.00% 56 106 0.00% 57 99 0.00% 58 96 0.00% 59 127 0.00% 60 138 0.00% 61 181 0.00% 62 191 0.00% 63 210 0.00% 64 236 0.00% 65 231 0.00% 66 289 0.00% 67 315 0.00% 68 398 0.00% 69 407 0.00% 70 465 0.00% 71 502 0.00% 72 650 0.00% 73 690 0.00% 74 719 0.00% 75 827 0.00% 76 919 0.00% 77 986 0.00% 78 1042 0.00% 79 1178 0.01% 80 1192 0.01% 81 1465 0.01% 82 1557 0.01% 83 1740 0.01% 84 1926 0.01% 85 2085 0.01% 86 2268 0.01% 87 2341 0.01% 88 2497 0.01% 89 2691 0.01% 90 2784 0.01% 91 2978 0.01% 92 3300 0.02% 93 3628 0.02% 94 3753 0.02% 95 4003 0.02% 96 4262 0.02% 97 4509 0.02% 98 4597 0.02% 99 4893 0.02% 100 4974 0.02% 101 5113 0.02% 102 5604 0.03% 103 5909 0.03% 104 6095 0.03% 105 6349 0.03% 106 6644 0.03% 107 6946 0.03% 108 7375 0.04% 109 7450 0.04% 110 7464 0.04% 111 7672 0.04% 112 8166 0.04% 113 8341 0.04% 114 8843 0.04% 115 9163 0.04% 116 9326 0.04% 117 9931 0.05% 118 10350 0.05% 119 10359 0.05% 120 10685 0.05% 121 11234 0.05% 122 11191 0.05% 123 11737 0.06% 124 12097 0.06% 125 12594 0.06% 126 13309 0.06% 127 13333 0.06% 128 14120 0.07% 129 14313 0.07% 130 14514 0.07% 131 14927 0.07% 132 15086 0.07% 133 15928 0.08% 134 15836 0.08% 135 16810 0.08% 136 17165 0.08% 137 18041 0.09% 138 18190 0.09% 139 19056 0.09% 140 19241 0.09% 141 19525 0.09% 142 19745 0.09% 143 20491 0.10% 144 20902 0.10% 145 21657 0.10% 146 21936 0.10% 147 22768 0.11% 148 23635 0.11% 149 23434 0.11% 150 24806 0.12% 151 20294483 96.43% 21045413 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=35 prefix-density=0.69 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=33 fanout-score=125.62 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=16.2 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTA criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=26 prefix-density=0.79 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=25 fanout-score=22.98 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=6.4 sequence=GCAATGGCAGCCTCAGTTATGGCTTCATT SRR12671397 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:04:04 Started mapping on | Feb 11 22:04:05 Finished on | Feb 11 22:06:37 Mapping speed, Million of reads per hour | 498.44 Number of input reads | 21045413 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 19345578 Uniquely mapped reads % | 91.92% Average mapped length | 298.68 Number of splices: Total | 20045317 Number of splices: Annotated (sjdb) | 19659829 Number of splices: GT/AG | 19635253 Number of splices: GC/AG | 345489 Number of splices: AT/AC | 11204 Number of splices: Non-canonical | 53371 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 457952 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 80015 % of reads mapped to too many loci | 0.38% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.37% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1241883 1241883 1241883 N_multimapping 457952 457952 457952 N_noFeature 728238 19031260 828628 N_ambiguous 347582 1434 132793 UnstrandedReadsAssigned:18269758 PositiveStrandReadsAssigned:312884 NegativeStrandReadsAssigned:18384157 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671397 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671397-trimmed-pair1.fastq SRR12671397-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,045,413 reads, 18,371,233 reads pseudoaligned [quant] estimated average fragment length: 308.371 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52401 SRR12671397.ke.tsv 34699 SRR12671397.se.tsv 87100 total ==> SRR12671397.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1710.63 669 18.8016 Potri.005G024800.1.v4.1 1035 727.629 252 16.6501 Potri.004G059700.1.v4.1 961 653.932 13 0.955733 Potri.007G009000.2.v4.1 1416 1108.63 0 0 Potri.003G141000.2.v4.1 2943 2635.63 1072 19.554 Potri.016G087400.1.v4.1 270 66.8806 563 404.7 Potri.015G069301.1.v4.1 564 277.34 0 0 Potri.010G195200.1.v4.1 1773 1465.63 68 2.23054 Potri.012G127500.1.v4.1 977 669.813 45 3.22987 ==> SRR12671397.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 326 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 264 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12671397 completed mapping pipeline successfully