Starting /dee2/code/volunteer_pipeline.sh SRR12671400 current disk space = 3052319907840 free memory = 1497717028 SRR12671400 SRAfilesize 2f5aa3aef2a241cc30bb112c4c524121 SRR12671400.sra SRR12671400.sra file validated SRR12671400 is paired end SRR12671400 is conventional basespace SRR12671400 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671400_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5595 37.0 37.0 37.0 37.0 37.0 2 36.4215 37.0 37.0 37.0 37.0 37.0 3 36.544 37.0 37.0 37.0 37.0 37.0 4 36.541 37.0 37.0 37.0 37.0 37.0 5 36.5785 37.0 37.0 37.0 37.0 37.0 6 36.5345 37.0 37.0 37.0 37.0 37.0 7 36.513 37.0 37.0 37.0 37.0 37.0 8 36.621 37.0 37.0 37.0 37.0 37.0 9 36.583 37.0 37.0 37.0 37.0 37.0 10-14 36.593999999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.579600000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.5619 37.0 37.0 37.0 37.0 37.0 25-29 36.5194 37.0 37.0 37.0 37.0 37.0 30-34 36.52460000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.4723 37.0 37.0 37.0 37.0 37.0 40-44 36.4539 37.0 37.0 37.0 37.0 37.0 45-49 36.429 37.0 37.0 37.0 37.0 37.0 50-54 36.4322 37.0 37.0 37.0 37.0 37.0 55-59 36.380900000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.3824 37.0 37.0 37.0 37.0 37.0 65-69 36.3741 37.0 37.0 37.0 37.0 37.0 70-74 36.3254 37.0 37.0 37.0 37.0 37.0 75-79 36.319900000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.3418 37.0 37.0 37.0 37.0 37.0 85-89 36.2825 37.0 37.0 37.0 37.0 37.0 90-94 36.2657 37.0 37.0 37.0 37.0 37.0 95-99 36.212599999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.2183 37.0 37.0 37.0 37.0 37.0 105-109 36.245400000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.1137 37.0 37.0 37.0 37.0 37.0 115-119 36.194100000000006 37.0 37.0 37.0 37.0 37.0 120-124 36.125299999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.1121 37.0 37.0 37.0 37.0 37.0 130-134 36.037000000000006 37.0 37.0 37.0 37.0 37.0 135-139 36.0375 37.0 37.0 37.0 37.0 37.0 140-144 35.9767 37.0 37.0 37.0 37.0 37.0 145-149 35.9874 37.0 37.0 37.0 37.0 37.0 150-151 35.92475 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 4.0 26 2.0 27 10.0 28 15.0 29 22.0 30 17.0 31 33.0 32 35.0 33 75.0 34 90.0 35 268.0 36 3002.0 37 425.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.875 10.5 5.025 38.6 2 18.377566349524287 11.942914371557336 39.03355032548823 30.64596895343015 3 16.925 18.875 29.4 34.8 4 22.55 25.074999999999996 22.975 29.4 5 23.150000000000002 31.85 23.7 21.3 6 18.6 35.125 23.9 22.375 7 14.2 25.674999999999997 44.4 15.725 8 16.650000000000002 25.374999999999996 33.525 24.45 9 17.974999999999998 22.15 35.8 24.075 10-14 20.0 29.9 27.0 23.1 15-19 20.330000000000002 27.565 28.1 24.005000000000003 20-24 20.32 27.884999999999998 28.58 23.215 25-29 19.085 28.634999999999998 28.189999999999998 24.09 30-34 19.52 28.544999999999998 28.035 23.9 35-39 19.535 28.43 28.134999999999998 23.9 40-44 19.865 28.854999999999997 27.735 23.544999999999998 45-49 20.18 28.27 27.750000000000004 23.799999999999997 50-54 19.470000000000002 28.384999999999998 28.505000000000003 23.64 55-59 19.495 28.194999999999997 28.525 23.785 60-64 20.380000000000003 28.21 27.500000000000004 23.91 65-69 20.395 28.54 27.639999999999997 23.425 70-74 20.195 28.425 27.794999999999998 23.585 75-79 19.73 28.43 28.244999999999997 23.595 80-84 20.365 28.000000000000004 27.534999999999997 24.099999999999998 85-89 19.68 28.63 27.915 23.775 90-94 19.615 27.98 28.075 24.33 95-99 19.805 28.705000000000002 27.82 23.669999999999998 100-104 20.145 27.965 28.139999999999997 23.75 105-109 20.925 27.79 27.785 23.5 110-114 20.145 27.925 28.110000000000003 23.82 115-119 20.424999999999997 28.685 27.93 22.96 120-124 20.87 27.839999999999996 27.195000000000004 24.095 125-129 20.724999999999998 28.549999999999997 26.979999999999997 23.745 130-134 20.085 28.904999999999998 27.24 23.77 135-139 20.560000000000002 27.935 27.884999999999998 23.62 140-144 20.53 27.87 27.785 23.815 145-149 20.28 28.384999999999998 27.47 23.865 150-151 20.4625 27.287499999999998 27.625 24.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 1.0 16 1.0 17 0.5 18 0.5 19 1.0 20 2.0 21 2.0 22 1.5 23 2.0 24 2.5 25 4.5 26 5.0 27 7.5 28 12.5 29 17.0 30 28.0 31 34.0 32 40.5 33 39.0 34 41.0 35 59.5 36 83.0 37 112.0 38 130.5 39 142.5 40 175.0 41 214.0 42 236.5 43 256.5 44 275.5 45 284.5 46 278.5 47 251.0 48 215.0 49 206.5 50 182.0 51 137.5 52 113.0 53 92.0 54 70.0 55 57.0 56 47.0 57 35.0 58 34.5 59 28.0 60 18.0 61 10.5 62 4.0 63 3.0 64 1.0 65 0.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.55 #Duplication Level Percentage of deduplicated Percentage of total 1 83.82798304058147 69.19999999999999 2 12.41671714112659 20.5 3 2.8467595396729255 7.049999999999999 4 0.6965475469412478 2.3 5 0.12113870381586916 0.5 6 0.09085402786190189 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCATTCTCTGAAGGAACAGAAATTTCAAATCCATCTTCACCAGTGTAC 6 0.15 No Hit GTCGAGATGACAGCCTTAGCATCACGGCTAAAAGAAAGACCCGAGGCAAC 6 0.15 No Hit GGATGCGGGTTGCGGCTTCAGAGAGGGAATCAGGTCGGGCAATGTAATTG 6 0.15 No Hit CCAACTTGTCTCAAAAATCCCATTCAGTTCCTCTGCCATTTTATGGACAT 5 0.125 No Hit GGCGGTTTTGGGGCTGGACAGGAGGAGGGGGGAGTGTAGGGAGGCTCACA 5 0.125 No Hit CACCATAGTAGATTGACGAACTAAAATAGCATGGTTCTGGCGTTTCGTTC 5 0.125 No Hit CTCATATTAGTCGCTGAAAGACCCCGATTAACAATGAACTGTATTCTGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.38749999999999996 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.7124999999999999 0.0 0.0 0.0 0.0 116-117 0.7875000000000001 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.8625 0.0 0.0 0.0 0.0 122-123 0.95 0.0 0.0 0.0 0.0 124-125 1.0625 0.0 0.0 0.0 0.0 126-127 1.15 0.0 0.0 0.0 0.0 128-129 1.25 0.0 0.0 0.0 0.0 130-131 1.35 0.0 0.0 0.0 0.0 132-133 1.4625 0.0 0.0 0.0 0.0 134-135 1.6875 0.0 0.0 0.0 0.0 136-137 1.85 0.0 0.0 0.0 0.0 138-139 2.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTCCA 10 0.006830828 145.0 145 AAAAGGG 10 0.006830828 145.0 7 AGAAAAG 10 0.006830828 145.0 5 CCATCCA 10 0.006830828 145.0 4 CTCCATT 25 8.7132835E-4 87.0 1 >>END_MODULE SRR12671400 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671400_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.199 37.0 37.0 37.0 37.0 37.0 2 35.5825 37.0 37.0 37.0 37.0 37.0 3 36.0065 37.0 37.0 37.0 37.0 37.0 4 36.1 37.0 37.0 37.0 37.0 37.0 5 36.064 37.0 37.0 37.0 37.0 37.0 6 36.0435 37.0 37.0 37.0 37.0 37.0 7 36.032 37.0 37.0 37.0 37.0 37.0 8 36.018 37.0 37.0 37.0 37.0 37.0 9 36.1245 37.0 37.0 37.0 37.0 37.0 10-14 36.1024 37.0 37.0 37.0 37.0 37.0 15-19 36.1606 37.0 37.0 37.0 37.0 37.0 20-24 36.028200000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.0492 37.0 37.0 37.0 37.0 37.0 30-34 36.00940000000001 37.0 37.0 37.0 37.0 37.0 35-39 35.9899 37.0 37.0 37.0 37.0 37.0 40-44 36.0313 37.0 37.0 37.0 37.0 37.0 45-49 36.000899999999994 37.0 37.0 37.0 37.0 37.0 50-54 35.88099999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.879 37.0 37.0 37.0 37.0 37.0 60-64 35.830600000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.8519 37.0 37.0 37.0 37.0 37.0 70-74 35.8312 37.0 37.0 37.0 37.0 37.0 75-79 35.769099999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.7213 37.0 37.0 37.0 37.0 37.0 85-89 35.7229 37.0 37.0 37.0 37.0 37.0 90-94 35.671200000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.6904 37.0 37.0 37.0 37.0 37.0 100-104 35.6557 37.0 37.0 37.0 37.0 37.0 105-109 35.624199999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.5459 37.0 37.0 37.0 37.0 37.0 115-119 35.6556 37.0 37.0 37.0 37.0 37.0 120-124 35.6095 37.0 37.0 37.0 37.0 37.0 125-129 35.543000000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.423300000000005 37.0 37.0 37.0 34.6 37.0 135-139 35.3906 37.0 37.0 37.0 34.6 37.0 140-144 35.4489 37.0 37.0 37.0 37.0 37.0 145-149 35.381899999999995 37.0 37.0 37.0 32.2 37.0 150-151 35.20125 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 0.0 15 2.0 16 0.0 17 5.0 18 2.0 19 1.0 20 0.0 21 5.0 22 2.0 23 3.0 24 6.0 25 8.0 26 18.0 27 11.0 28 20.0 29 16.0 30 36.0 31 47.0 32 66.0 33 115.0 34 246.0 35 604.0 36 2566.0 37 218.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.875 22.725 8.575000000000001 25.825 2 25.15 25.474999999999998 34.55 14.825 3 20.549999999999997 25.2 34.325 19.925 4 24.6 35.099999999999994 21.725 18.575 5 24.975 37.2 21.95 15.875 6 19.275000000000002 38.925 22.725 19.075 7 20.95 20.150000000000002 38.475 20.424999999999997 8 19.0 24.925 29.65 26.424999999999997 9 21.075 25.95 30.0 22.975 10-14 23.305 29.134999999999998 26.400000000000002 21.16 15-19 22.97 28.355000000000004 27.62 21.055 20-24 23.02 28.575 27.57 20.835 25-29 23.145 28.33 28.24 20.285 30-34 22.74 28.299999999999997 27.785 21.175 35-39 23.23 28.7 27.33 20.74 40-44 22.795 28.46 27.575 21.17 45-49 23.255 28.355000000000004 26.955000000000002 21.435000000000002 50-54 23.419999999999998 28.235 27.83 20.515 55-59 23.225 28.294999999999998 27.525 20.955 60-64 24.12 27.505000000000003 27.744999999999997 20.630000000000003 65-69 23.21 27.57 27.860000000000003 21.36 70-74 23.74 28.03 27.365000000000002 20.865000000000002 75-79 23.0 28.294999999999998 27.250000000000004 21.455 80-84 23.655 28.660000000000004 26.834999999999997 20.849999999999998 85-89 23.21 28.505000000000003 28.04 20.244999999999997 90-94 23.59 28.470000000000002 26.895000000000003 21.044999999999998 95-99 23.925 27.785 27.58 20.71 100-104 22.745 28.105000000000004 28.105000000000004 21.044999999999998 105-109 23.075000000000003 27.955000000000002 27.705000000000002 21.265 110-114 23.01 28.67 27.544999999999998 20.775 115-119 23.27 28.07 28.139999999999997 20.52 120-124 23.595 29.020000000000003 26.919999999999998 20.465 125-129 23.25 28.144999999999996 27.810000000000002 20.794999999999998 130-134 24.185000000000002 27.72 26.965 21.13 135-139 23.555 28.310000000000002 27.98 20.155 140-144 23.705000000000002 27.91 27.72 20.665 145-149 23.56971394278856 28.72574514902981 27.015403080616124 20.689137827565514 150-151 24.1875 27.825 27.437499999999996 20.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.5 14 1.0 15 0.5 16 1.0 17 1.0 18 0.5 19 1.0 20 1.0 21 1.5 22 2.5 23 3.0 24 4.5 25 4.5 26 4.5 27 4.5 28 7.5 29 11.0 30 15.0 31 21.5 32 25.5 33 34.0 34 50.0 35 67.0 36 88.0 37 109.5 38 137.0 39 162.5 40 180.0 41 214.0 42 258.0 43 272.0 44 260.5 45 263.0 46 270.0 47 243.0 48 220.0 49 211.0 50 172.5 51 134.5 52 114.5 53 95.5 54 76.0 55 69.0 56 58.5 57 36.5 58 20.5 59 14.5 60 14.5 61 10.5 62 6.5 63 5.5 64 3.5 65 2.5 66 1.0 67 1.0 68 0.5 69 1.0 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.675 #Duplication Level Percentage of deduplicated Percentage of total 1 83.97338977925612 69.425 2 12.33746598125189 20.4 3 2.902933172059268 7.199999999999999 4 0.4535833081342607 1.5 5 0.21167221046265497 0.8750000000000001 6 0.12095554883580284 0.6 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCATGGCACATCCACGATGAGAGATCTCTTCTTGCCCTCCAGGGTCCTC 6 0.15 No Hit CTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATCA 6 0.15 No Hit GTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGC 6 0.15 No Hit GGTCCTCTACTGCATCCTCTCTTGGAGTAAAGATCTCCCAGCCACCTCCA 6 0.15 No Hit GTGCTGTTTTTTGGGCTCAGTTAGGTTTTTGCTCCCTCTTCAATTTGTTT 5 0.125 No Hit CATTTCCGCGTTTGCTCTCCCTAGTAGAATTCTCGCGGGACAAACAGTAC 5 0.125 No Hit AAACGTAGTTGCAGTGTTTCTGTGAGTGAGAATCCTGGTTCTCAGACAAG 5 0.125 No Hit CATGGCCAAGGAATTACAGGTTCTCAATGCGCTTGATGTGGCAAAAACAC 5 0.125 No Hit GTGGACTCTCTTTTCCAAGCCCCCCAGGGAACTGGAACTCACAACCCCGT 5 0.125 No Hit CACAATACCAGCAAAAACCAGAACAAAAAACCTCTAGAATGGCCACTGTC 5 0.125 No Hit AGAGGATAGTGAGGTTGATGGAGAAGAAGAGGAAGAGGAGGAAGAAGACG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.38749999999999996 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.7124999999999999 0.0 0.0 0.0 0.0 116-117 0.7875000000000001 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.8625 0.0 0.0 0.0 0.0 122-123 0.95 0.0 0.0 0.0 0.0 124-125 1.0625 0.0 0.0 0.0 0.0 126-127 1.15 0.0 0.0 0.0 0.0 128-129 1.25 0.0 0.0 0.0 0.0 130-131 1.35 0.0 0.0 0.0 0.0 132-133 1.4625 0.0 0.0 0.0 0.0 134-135 1.6875 0.0 0.0 0.0 0.0 136-137 1.8625 0.0 0.0 0.0 0.0 138-139 2.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra Read 956148 spots for SRR12671400.sra Written 956148 spots for SRR12671400.sra SRR ids: ['SRR12671400.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lmcxs8qr SRR12671400.sra spots: 19122960 blocks: [[1, 956148], [956149, 1912296], [1912297, 2868444], [2868445, 3824592], [3824593, 4780740], [4780741, 5736888], [5736889, 6693036], [6693037, 7649184], [7649185, 8605332], [8605333, 9561480], [9561481, 10517628], [10517629, 11473776], [11473777, 12429924], [12429925, 13386072], [13386073, 14342220], [14342221, 15298368], [15298369, 16254516], [16254517, 17210664], [17210665, 18166812], [18166813, 19122960]] SRR12671400 file size 6477118 SRR12671400 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671400 SRR12671400_1.fastq SRR12671400_2.fastq Input file: SRR12671400_1.fastq Paired file: SRR12671400_2.fastq trimmed: SRR12671400-trimmed-pair1.fastq, SRR12671400-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:25:34 2025 >> started Tue Feb 11 22:25:58 2025 >> done (23.278s) 19122960 read pairs processed; of these: 95 ( 0.00%) short read pairs filtered out after trimming by size control 1916 ( 0.01%) empty read pairs filtered out after trimming by size control 19120949 (99.99%) read pairs available; of these: 603949 ( 3.16%) trimmed read pairs available after processing 18517000 (96.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 12 0.00% 20 6 0.00% 21 2 0.00% 22 13 0.00% 23 8 0.00% 24 10 0.00% 25 9 0.00% 26 9 0.00% 27 13 0.00% 28 17 0.00% 29 11 0.00% 30 21 0.00% 31 15 0.00% 32 16 0.00% 33 18 0.00% 34 24 0.00% 35 18 0.00% 36 13 0.00% 37 22 0.00% 38 21 0.00% 39 19 0.00% 40 18 0.00% 41 21 0.00% 42 30 0.00% 43 15 0.00% 44 24 0.00% 45 27 0.00% 46 27 0.00% 47 26 0.00% 48 39 0.00% 49 33 0.00% 50 39 0.00% 51 57 0.00% 52 61 0.00% 53 50 0.00% 54 56 0.00% 55 66 0.00% 56 75 0.00% 57 59 0.00% 58 72 0.00% 59 78 0.00% 60 95 0.00% 61 107 0.00% 62 144 0.00% 63 141 0.00% 64 134 0.00% 65 167 0.00% 66 189 0.00% 67 202 0.00% 68 236 0.00% 69 298 0.00% 70 271 0.00% 71 334 0.00% 72 395 0.00% 73 475 0.00% 74 439 0.00% 75 527 0.00% 76 570 0.00% 77 604 0.00% 78 677 0.00% 79 799 0.00% 80 882 0.00% 81 958 0.01% 82 1083 0.01% 83 1123 0.01% 84 1243 0.01% 85 1442 0.01% 86 1424 0.01% 87 1737 0.01% 88 1746 0.01% 89 1797 0.01% 90 2036 0.01% 91 2158 0.01% 92 2375 0.01% 93 2602 0.01% 94 2700 0.01% 95 3100 0.02% 96 3170 0.02% 97 3274 0.02% 98 3286 0.02% 99 3725 0.02% 100 3863 0.02% 101 4012 0.02% 102 4288 0.02% 103 4409 0.02% 104 4631 0.02% 105 4803 0.03% 106 5100 0.03% 107 5300 0.03% 108 5595 0.03% 109 5785 0.03% 110 6007 0.03% 111 6305 0.03% 112 6525 0.03% 113 6655 0.03% 114 7003 0.04% 115 7241 0.04% 116 7563 0.04% 117 7970 0.04% 118 8175 0.04% 119 8173 0.04% 120 8701 0.05% 121 8975 0.05% 122 9144 0.05% 123 9391 0.05% 124 9899 0.05% 125 10054 0.05% 126 10752 0.06% 127 10947 0.06% 128 11141 0.06% 129 11780 0.06% 130 11948 0.06% 131 12165 0.06% 132 12743 0.07% 133 12721 0.07% 134 13227 0.07% 135 13660 0.07% 136 13899 0.07% 137 14654 0.08% 138 14972 0.08% 139 15693 0.08% 140 15835 0.08% 141 16192 0.08% 142 16578 0.09% 143 17060 0.09% 144 17661 0.09% 145 18043 0.09% 146 18459 0.10% 147 18931 0.10% 148 19365 0.10% 149 19767 0.10% 150 20346 0.11% 151 18517000 96.84% 19120949 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=35 prefix-density=0.45 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=178.82 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=16.3 sequence=CTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTA criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=37 prefix-density=0.66 prefix-fanout=1.9 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.15 sequence-density-rank=10 fanout-score=33.36 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=12.2 sequence=AAAGAAAAGAAAA SRR12671400 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:26:41 Started mapping on | Feb 11 22:26:41 Finished on | Feb 11 22:28:51 Mapping speed, Million of reads per hour | 529.50 Number of input reads | 19120949 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 17729243 Uniquely mapped reads % | 92.72% Average mapped length | 298.89 Number of splices: Total | 18065004 Number of splices: Annotated (sjdb) | 17674287 Number of splices: GT/AG | 17710539 Number of splices: GC/AG | 291420 Number of splices: AT/AC | 10642 Number of splices: Non-canonical | 52403 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 454326 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 64731 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.41% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 937380 937380 937380 N_multimapping 454326 454326 454326 N_noFeature 624861 17501063 699690 N_ambiguous 274110 1233 119983 UnstrandedReadsAssigned:16830272 PositiveStrandReadsAssigned:226947 NegativeStrandReadsAssigned:16909570 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671400 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671400-trimmed-pair1.fastq SRR12671400-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,120,949 reads, 16,912,701 reads pseudoaligned [quant] estimated average fragment length: 316.899 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52401 SRR12671400.ke.tsv 34699 SRR12671400.se.tsv 87100 total ==> SRR12671400.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1702.1 740 24.0997 Potri.005G024800.1.v4.1 1035 719.101 366 28.2134 Potri.004G059700.1.v4.1 961 645.456 0 0 Potri.007G009000.2.v4.1 1416 1100.1 0 0 Potri.003G141000.2.v4.1 2943 2627.1 944 19.9186 Potri.016G087400.1.v4.1 270 66.3149 747 624.415 Potri.015G069301.1.v4.1 564 273.103 0 0 Potri.010G195200.1.v4.1 1773 1457.1 110.856 4.2173 Potri.012G127500.1.v4.1 977 661.332 170 14.2493 ==> SRR12671400.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 197 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 184 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 19 SRR12671400 completed mapping pipeline successfully