Starting /dee2/code/volunteer_pipeline.sh SRR12671401 current disk space = 3052637724672 free memory = 1289289868 SRR12671401 SRAfilesize 2b4369f78c5ee4fa2c628deca375da6d SRR12671401.sra SRR12671401.sra file validated SRR12671401 is paired end SRR12671401 is conventional basespace SRR12671401 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671401_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.584 37.0 37.0 37.0 37.0 37.0 2 36.3565 37.0 37.0 37.0 37.0 37.0 3 36.6395 37.0 37.0 37.0 37.0 37.0 4 36.6575 37.0 37.0 37.0 37.0 37.0 5 36.5275 37.0 37.0 37.0 37.0 37.0 6 36.611 37.0 37.0 37.0 37.0 37.0 7 36.5645 37.0 37.0 37.0 37.0 37.0 8 36.5765 37.0 37.0 37.0 37.0 37.0 9 36.6465 37.0 37.0 37.0 37.0 37.0 10-14 36.6351 37.0 37.0 37.0 37.0 37.0 15-19 36.611599999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.5937 37.0 37.0 37.0 37.0 37.0 25-29 36.587199999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.542 37.0 37.0 37.0 37.0 37.0 35-39 36.5277 37.0 37.0 37.0 37.0 37.0 40-44 36.5196 37.0 37.0 37.0 37.0 37.0 45-49 36.4771 37.0 37.0 37.0 37.0 37.0 50-54 36.4979 37.0 37.0 37.0 37.0 37.0 55-59 36.4002 37.0 37.0 37.0 37.0 37.0 60-64 36.3918 37.0 37.0 37.0 37.0 37.0 65-69 36.3633 37.0 37.0 37.0 37.0 37.0 70-74 36.373599999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.3228 37.0 37.0 37.0 37.0 37.0 80-84 36.3929 37.0 37.0 37.0 37.0 37.0 85-89 36.2457 37.0 37.0 37.0 37.0 37.0 90-94 36.299 37.0 37.0 37.0 37.0 37.0 95-99 36.214999999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.2457 37.0 37.0 37.0 37.0 37.0 105-109 36.267100000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.1317 37.0 37.0 37.0 37.0 37.0 115-119 36.187 37.0 37.0 37.0 37.0 37.0 120-124 36.1177 37.0 37.0 37.0 37.0 37.0 125-129 36.1297 37.0 37.0 37.0 37.0 37.0 130-134 36.054899999999996 37.0 37.0 37.0 37.0 37.0 135-139 36.0974 37.0 37.0 37.0 37.0 37.0 140-144 36.00449999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.9779 37.0 37.0 37.0 37.0 37.0 150-151 35.84375 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 2.0 23 4.0 24 1.0 25 2.0 26 5.0 27 6.0 28 10.0 29 15.0 30 15.0 31 26.0 32 46.0 33 58.0 34 87.0 35 271.0 36 3006.0 37 444.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.675 11.774999999999999 6.0 41.55 2 17.08542713567839 12.63819095477387 40.552763819095475 29.723618090452263 3 16.675 17.65 28.7 36.975 4 23.549999999999997 26.1 23.1 27.250000000000004 5 23.674999999999997 33.475 23.9 18.95 6 18.575 34.475 26.150000000000002 20.8 7 14.825 24.775 43.824999999999996 16.575 8 15.2 24.925 35.875 24.0 9 17.05 22.475 35.4 25.074999999999996 10-14 19.81 30.395 27.889999999999997 21.905 15-19 19.744999999999997 27.834999999999997 28.025 24.395 20-24 19.88 28.005000000000003 28.18 23.935000000000002 25-29 19.064999999999998 28.315 28.26 24.36 30-34 19.41 28.515 28.155 23.919999999999998 35-39 19.28 28.95 27.82 23.95 40-44 20.064999999999998 28.9 27.93 23.105 45-49 19.71 28.645 27.725 23.919999999999998 50-54 19.61 28.59 28.105000000000004 23.695 55-59 19.81 28.82 28.115000000000002 23.255 60-64 20.055 28.52 27.76 23.665 65-69 20.145 28.46 28.09 23.305 70-74 20.135 28.825 27.700000000000003 23.34 75-79 20.1 28.68 27.67 23.549999999999997 80-84 19.650000000000002 29.12 27.485 23.745 85-89 20.064999999999998 28.87 27.825 23.24 90-94 19.925 28.499999999999996 27.105 24.47 95-99 19.835 28.625 27.825 23.715 100-104 19.885 28.51 27.765 23.84 105-109 19.665 28.705000000000002 27.775 23.855 110-114 20.125 28.144999999999996 28.415000000000003 23.315 115-119 20.115 28.65 27.889999999999997 23.345 120-124 19.845 28.854999999999997 27.839999999999996 23.46 125-129 20.325 28.494999999999997 27.785 23.395 130-134 20.465 28.22 28.08 23.235 135-139 19.98 28.215 27.975 23.830000000000002 140-144 20.765 27.560000000000002 28.215 23.46 145-149 20.7 28.744999999999997 27.18 23.375 150-151 20.8 28.287499999999998 27.375 23.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.0 4 0.0 5 1.5 6 1.5 7 0.0 8 0.0 9 0.0 10 1.0 11 1.5 12 1.0 13 0.5 14 0.5 15 1.5 16 1.0 17 1.0 18 1.5 19 0.5 20 1.0 21 3.0 22 3.5 23 4.5 24 6.5 25 5.0 26 3.5 27 8.0 28 13.5 29 19.0 30 25.5 31 30.0 32 44.5 33 57.0 34 58.5 35 69.0 36 81.5 37 97.0 38 124.0 39 161.0 40 187.5 41 205.5 42 226.0 43 256.0 44 269.0 45 260.0 46 257.0 47 249.0 48 237.0 49 211.5 50 171.0 51 135.5 52 118.5 53 94.0 54 73.0 55 53.0 56 36.0 57 34.5 58 30.0 59 23.0 60 15.5 61 12.0 62 7.0 63 2.5 64 1.0 65 1.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.75 #Duplication Level Percentage of deduplicated Percentage of total 1 84.74626865671641 70.975 2 12.298507462686567 20.599999999999998 3 2.1194029850746268 5.325 4 0.5970149253731344 2.0 5 0.1492537313432836 0.625 6 0.05970149253731343 0.3 7 0.029850746268656716 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCGAACACAGCTATCTTTCTTGCTCCTGAGCAATACAGTTTCTCCAGC 7 0.17500000000000002 No Hit CCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCA 6 0.15 No Hit GGCCTCATAAGGAAAAACATTCCCAATGACTTCTCATGGTCTTGCTTGAT 6 0.15 No Hit CACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACAC 5 0.125 No Hit CTTCAGTGCATATTGCCTTTATATCTGCTCCAGAGAACTCATCCTTGGTC 5 0.125 No Hit CTGTGATGGAGTCGGTGCACCAGCAGCAGGTTGCGTTGCAGCAATAAGCT 5 0.125 No Hit GTCCAGGTGTCCTGCTTCCCCACTGGCGGAAACTCTTCAAGTCTTCTTCC 5 0.125 No Hit CAGCCATAGAGAGAATGTTACTAGGAGCACTAAGCCGAGAGGCTTTTAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.6499999999999999 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 0.9624999999999999 0.0 0.0 0.0 0.0 116-117 1.0499999999999998 0.0 0.0 0.0 0.0 118-119 1.1625 0.0 0.0 0.0 0.0 120-121 1.3250000000000002 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.4500000000000002 0.0 0.0 0.0 0.0 126-127 1.525 0.0 0.0 0.0 0.0 128-129 1.6 0.0 0.0 0.0 0.0 130-131 1.775 0.0 0.0 0.0 0.0 132-133 1.9 0.0 0.0 0.0 0.0 134-135 2.0875000000000004 0.0 0.0 0.0 0.0 136-137 2.2875 0.0 0.0 0.0 0.0 138-139 2.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACAACT 10 0.006830828 145.0 7 CATCTCC 10 0.006830828 145.0 5 ACACTGA 10 0.006830828 145.0 145 CAACATC 10 0.006830828 145.0 2 TCTCCAG 10 0.006830828 145.0 7 >>END_MODULE SRR12671401 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671401_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.223 37.0 37.0 37.0 37.0 37.0 2 35.947 37.0 37.0 37.0 37.0 37.0 3 36.084 37.0 37.0 37.0 37.0 37.0 4 36.131 37.0 37.0 37.0 37.0 37.0 5 36.224 37.0 37.0 37.0 37.0 37.0 6 36.159 37.0 37.0 37.0 37.0 37.0 7 36.2065 37.0 37.0 37.0 37.0 37.0 8 36.2315 37.0 37.0 37.0 37.0 37.0 9 36.1735 37.0 37.0 37.0 37.0 37.0 10-14 36.2567 37.0 37.0 37.0 37.0 37.0 15-19 36.21130000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.1585 37.0 37.0 37.0 37.0 37.0 25-29 36.1525 37.0 37.0 37.0 37.0 37.0 30-34 36.118399999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.1274 37.0 37.0 37.0 37.0 37.0 40-44 36.1409 37.0 37.0 37.0 37.0 37.0 45-49 36.064099999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.0158 37.0 37.0 37.0 37.0 37.0 55-59 35.963499999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.9769 37.0 37.0 37.0 37.0 37.0 65-69 36.002599999999994 37.0 37.0 37.0 37.0 37.0 70-74 35.90310000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.889700000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.8934 37.0 37.0 37.0 37.0 37.0 85-89 35.895799999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.8243 37.0 37.0 37.0 37.0 37.0 95-99 35.8073 37.0 37.0 37.0 37.0 37.0 100-104 35.7428 37.0 37.0 37.0 37.0 37.0 105-109 35.679199999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.6232 37.0 37.0 37.0 37.0 37.0 115-119 35.759100000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.6873 37.0 37.0 37.0 37.0 37.0 125-129 35.691500000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.5552 37.0 37.0 37.0 37.0 37.0 135-139 35.521499999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.5295 37.0 37.0 37.0 37.0 37.0 145-149 35.4918 37.0 37.0 37.0 37.0 37.0 150-151 35.277249999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 1.0 15 1.0 16 3.0 17 1.0 18 1.0 19 0.0 20 2.0 21 1.0 22 2.0 23 2.0 24 5.0 25 10.0 26 13.0 27 13.0 28 13.0 29 16.0 30 13.0 31 45.0 32 60.0 33 103.0 34 203.0 35 631.0 36 2618.0 37 240.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.9 21.575 9.925 25.6 2 24.349999999999998 24.474999999999998 35.425000000000004 15.75 3 19.975 27.275 33.675 19.075 4 23.549999999999997 36.075 21.975 18.4 5 23.525 37.4 23.075000000000003 16.0 6 19.175 40.375 23.95 16.5 7 19.825 21.725 39.0 19.45 8 17.925 24.099999999999998 30.9 27.075 9 20.724999999999998 24.8 30.225 24.25 10-14 23.02 29.630000000000003 26.795 20.555 15-19 22.33 28.715000000000003 28.035 20.919999999999998 20-24 23.01 28.03 27.93 21.029999999999998 25-29 22.225 28.215 28.560000000000002 21.0 30-34 22.165000000000003 28.884999999999998 28.23 20.72 35-39 22.770000000000003 28.59 27.439999999999998 21.2 40-44 22.465 27.79 27.944999999999997 21.8 45-49 22.040000000000003 27.725 29.075 21.16 50-54 22.689999999999998 27.665 28.549999999999997 21.095 55-59 22.31 27.68 28.46 21.55 60-64 22.795 27.034999999999997 28.854999999999997 21.315 65-69 22.53 27.755000000000003 27.700000000000003 22.015 70-74 22.605 28.065 28.060000000000002 21.27 75-79 22.255 28.37 27.875 21.5 80-84 22.75 28.51 27.1 21.64 85-89 22.74 27.91 27.284999999999997 22.065 90-94 22.79 27.93 27.73 21.55 95-99 22.88 27.82 28.04 21.26 100-104 23.055 28.244999999999997 27.76 20.94 105-109 22.695 28.12 28.360000000000003 20.825 110-114 23.200000000000003 27.744999999999997 28.155 20.9 115-119 23.799999999999997 28.34 27.465 20.395 120-124 23.09 27.715 27.994999999999997 21.2 125-129 23.735 28.000000000000004 27.47 20.794999999999998 130-134 23.915 28.005000000000003 27.565 20.515 135-139 23.65 27.91 27.73 20.71 140-144 23.630000000000003 28.025 27.295 21.05 145-149 24.18 28.544999999999998 27.065 20.21 150-151 24.2 28.1875 26.787499999999998 20.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 0.5 22 2.5 23 4.5 24 3.0 25 3.5 26 6.0 27 7.5 28 7.5 29 8.5 30 18.5 31 30.0 32 40.5 33 47.0 34 58.0 35 78.0 36 98.5 37 120.5 38 135.0 39 160.5 40 193.5 41 219.0 42 238.5 43 254.0 44 266.0 45 262.5 46 263.5 47 248.0 48 227.5 49 207.5 50 160.0 51 133.5 52 119.5 53 78.0 54 66.0 55 58.5 56 37.0 57 38.5 58 28.0 59 17.5 60 15.5 61 13.0 62 8.5 63 4.5 64 2.5 65 1.0 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.1 #Duplication Level Percentage of deduplicated Percentage of total 1 85.19619500594531 71.65 2 11.86087990487515 19.950000000000003 3 2.140309155766944 5.4 4 0.535077288941736 1.7999999999999998 5 0.23781212841854932 1.0 6 0.0 0.0 7 0.0 0.0 8 0.029726516052318665 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGAGCACTGCATAGCTTATAAGCTTGTAAGATATGGCTTCCTCCTCTAT 8 0.2 No Hit CTTAAGCCAATGCATCTATGTGTCTGATATGGGTCATAACGACTACCTCA 5 0.125 No Hit GAAATGGTCACGGCCGGATGTCAGTGTTTACACGTCATTAGTTCAAGGTC 5 0.125 No Hit GTTTCTCCAAAGGTCCCTACAGGCAGCTATAACATTGCTCAGGTTACATA 5 0.125 No Hit CTCGTCGGTGTTCTGACTACATCCCACCGTGTAATCCATCTGGCTGTGCT 5 0.125 No Hit AGAGAGACTGAGAGTGTTTCAGAATTCAGGAATGGCTTCCACTTCTTCTC 5 0.125 No Hit GTTAAAGTGATTCTTGCAACCAACCGAATTGAAAGCCTTGATCCTGCTTT 5 0.125 No Hit AAAAAAATCTTGCAGTCTGCTGTAAAAGTTGTTGCTAGTGAGCCTCTACT 5 0.125 No Hit CAAAGAACAACTTCGTATTTAGTTCATCCATTTGCTTCATCAATCAATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.6499999999999999 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.875 0.0 0.0 0.0 0.0 114-115 0.9624999999999999 0.0 0.0 0.0 0.0 116-117 1.0499999999999998 0.0 0.0 0.0 0.0 118-119 1.1625 0.0 0.0 0.0 0.0 120-121 1.3250000000000002 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.4500000000000002 0.0 0.0 0.0 0.0 126-127 1.5125000000000002 0.0 0.0 0.0 0.0 128-129 1.575 0.0 0.0 0.0 0.0 130-131 1.75 0.0 0.0 0.0 0.0 132-133 1.85 0.0 0.0 0.0 0.0 134-135 2.0375 0.0 0.0 0.0 0.0 136-137 2.2375 0.0 0.0 0.0 0.0 138-139 2.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACCTG 10 0.006830828 145.0 7 >>END_MODULE Read 1043111 spots for SRR12671401.sra Written 1043111 spots for SRR12671401.sra Read 1043111 spots for SRR12671401.sra Written 1043111 spots for SRR12671401.sra Read 1043111 spots for SRR12671401.sra Written 1043111 spots for SRR12671401.sra Read 1043111 spots for SRR12671401.sra Written 1043111 spots for SRR12671401.sra Read 1043111 spots for SRR12671401.sra Written 1043111 spots for SRR12671401.sra Read 1043111 spots for SRR12671401.sra Written 1043111 spots for SRR12671401.sra Read 1043111 spots for SRR12671401.sra Written 1043111 spots for SRR12671401.sra Read 1043111 spots for SRR12671401.sra Written 1043111 spots for SRR12671401.sra Read 1043111 spots for SRR12671401.sra Written 1043111 spots for SRR12671401.sra Read 1043111 spots for SRR12671401.sra Written 1043111 spots for SRR12671401.sra Read 1043111 spots for SRR12671401.sra Read 1043111 spots for SRR12671401.sra Written 1043111 spots for SRR12671401.sra Written 1043111 spots for SRR12671401.sra Read 1043111 spots for SRR12671401.sra Written 1043111 spots for SRR12671401.sra Read 1043111 spots for SRR12671401.sra Written 1043111 spots for SRR12671401.sra Read 1043111 spots for SRR12671401.sra Written 1043111 spots for SRR12671401.sra Read 1043120 spots for SRR12671401.sra Written 1043120 spots for SRR12671401.sra Read 1043111 spots for SRR12671401.sra Written 1043111 spots for SRR12671401.sra Read 1043111 spots for SRR12671401.sra Written 1043111 spots for SRR12671401.sra Read 1043111 spots for SRR12671401.sra Written 1043111 spots for SRR12671401.sra Read 1043111 spots for SRR12671401.sra Written 1043111 spots for SRR12671401.sra SRR ids: ['SRR12671401.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_envgz1qc SRR12671401.sra spots: 20862229 blocks: [[1, 1043111], [1043112, 2086222], [2086223, 3129333], [3129334, 4172444], [4172445, 5215555], [5215556, 6258666], [6258667, 7301777], [7301778, 8344888], [8344889, 9387999], [9388000, 10431110], [10431111, 11474221], [11474222, 12517332], [12517333, 13560443], [13560444, 14603554], [14603555, 15646665], [15646666, 16689776], [16689777, 17732887], [17732888, 18775998], [18775999, 19819109], [19819110, 20862229]] SRR12671401 file size 7068197 SRR12671401 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671401 SRR12671401_1.fastq SRR12671401_2.fastq Input file: SRR12671401_1.fastq Paired file: SRR12671401_2.fastq trimmed: SRR12671401-trimmed-pair1.fastq, SRR12671401-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:03:20 2025 >> started Tue Feb 11 22:03:43 2025 >> done (23.208s) 20862229 read pairs processed; of these: 74 ( 0.00%) short read pairs filtered out after trimming by size control 839 ( 0.00%) empty read pairs filtered out after trimming by size control 20861316 (100.00%) read pairs available; of these: 816142 ( 3.91%) trimmed read pairs available after processing 20045174 (96.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 7 0.00% 21 6 0.00% 22 7 0.00% 23 5 0.00% 24 2 0.00% 25 13 0.00% 26 14 0.00% 27 16 0.00% 28 9 0.00% 29 11 0.00% 30 16 0.00% 31 11 0.00% 32 15 0.00% 33 9 0.00% 34 20 0.00% 35 25 0.00% 36 16 0.00% 37 33 0.00% 38 18 0.00% 39 23 0.00% 40 27 0.00% 41 26 0.00% 42 38 0.00% 43 29 0.00% 44 43 0.00% 45 26 0.00% 46 26 0.00% 47 38 0.00% 48 40 0.00% 49 40 0.00% 50 42 0.00% 51 62 0.00% 52 53 0.00% 53 74 0.00% 54 82 0.00% 55 82 0.00% 56 90 0.00% 57 90 0.00% 58 107 0.00% 59 131 0.00% 60 122 0.00% 61 138 0.00% 62 153 0.00% 63 225 0.00% 64 209 0.00% 65 240 0.00% 66 252 0.00% 67 264 0.00% 68 333 0.00% 69 382 0.00% 70 438 0.00% 71 465 0.00% 72 542 0.00% 73 645 0.00% 74 679 0.00% 75 745 0.00% 76 840 0.00% 77 968 0.00% 78 1071 0.01% 79 1265 0.01% 80 1289 0.01% 81 1470 0.01% 82 1595 0.01% 83 1802 0.01% 84 1900 0.01% 85 1958 0.01% 86 2250 0.01% 87 2441 0.01% 88 2597 0.01% 89 2728 0.01% 90 2952 0.01% 91 3203 0.02% 92 3387 0.02% 93 3744 0.02% 94 3987 0.02% 95 4163 0.02% 96 4434 0.02% 97 4755 0.02% 98 4768 0.02% 99 5196 0.02% 100 5422 0.03% 101 5560 0.03% 102 5764 0.03% 103 6046 0.03% 104 6390 0.03% 105 6638 0.03% 106 7088 0.03% 107 7303 0.04% 108 7666 0.04% 109 7986 0.04% 110 8194 0.04% 111 8443 0.04% 112 8869 0.04% 113 9030 0.04% 114 9433 0.05% 115 9935 0.05% 116 10388 0.05% 117 10733 0.05% 118 11153 0.05% 119 11114 0.05% 120 11739 0.06% 121 12226 0.06% 122 12680 0.06% 123 12995 0.06% 124 13315 0.06% 125 13665 0.07% 126 14235 0.07% 127 14856 0.07% 128 15291 0.07% 129 15897 0.08% 130 16073 0.08% 131 16288 0.08% 132 16869 0.08% 133 17311 0.08% 134 17567 0.08% 135 18191 0.09% 136 18743 0.09% 137 19277 0.09% 138 20027 0.10% 139 20806 0.10% 140 21026 0.10% 141 21506 0.10% 142 22181 0.11% 143 22722 0.11% 144 23126 0.11% 145 23887 0.11% 146 24420 0.12% 147 25110 0.12% 148 25732 0.12% 149 26065 0.12% 150 27130 0.13% 151 20045174 96.09% 20861316 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=25 prefix-density=0.52 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.19 sequence-density-rank=12 fanout-score=8.60 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=4.3 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=26 prefix-density=0.75 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATC criterion=fanout-score sequence-density=0.17 sequence-density-rank=17 fanout-score=13.83 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=6.7 sequence=AAGAAAGCTTACCCTAAC SRR12671401 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:04:28 Started mapping on | Feb 11 22:04:29 Finished on | Feb 11 22:06:37 Mapping speed, Million of reads per hour | 586.72 Number of input reads | 20861316 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 19406191 Uniquely mapped reads % | 93.02% Average mapped length | 298.53 Number of splices: Total | 19503682 Number of splices: Annotated (sjdb) | 19098434 Number of splices: GT/AG | 19114328 Number of splices: GC/AG | 319313 Number of splices: AT/AC | 11616 Number of splices: Non-canonical | 58425 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 491910 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 110562 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.94% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 963215 963215 963215 N_multimapping 491910 491910 491910 N_noFeature 796619 19127966 883232 N_ambiguous 324596 1280 132384 UnstrandedReadsAssigned:18284976 PositiveStrandReadsAssigned:276945 NegativeStrandReadsAssigned:18390575 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671401 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671401-trimmed-pair1.fastq SRR12671401-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,861,316 reads, 18,410,829 reads pseudoaligned [quant] estimated average fragment length: 308.37 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,058 rounds 52401 SRR12671401.ke.tsv 34699 SRR12671401.se.tsv 87100 total ==> SRR12671401.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1710.63 685 20.0804 Potri.005G024800.1.v4.1 1035 727.63 318 21.9156 Potri.004G059700.1.v4.1 961 653.927 0 0 Potri.007G009000.2.v4.1 1416 1108.63 0 0 Potri.003G141000.2.v4.1 2943 2635.63 1307.57 24.8782 Potri.016G087400.1.v4.1 270 69.3131 897 648.954 Potri.015G069301.1.v4.1 564 281.281 0 0 Potri.010G195200.1.v4.1 1773 1465.63 68 2.3266 Potri.012G127500.1.v4.1 977 669.778 82 6.13932 ==> SRR12671401.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 82 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 225 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR12671401 completed mapping pipeline successfully