Starting /dee2/code/volunteer_pipeline.sh SRR12671402 current disk space = 3052226457600 free memory = 1447668120 SRR12671402 SRAfilesize 37a135d51faa59674f6d206f5d690d6b SRR12671402.sra SRR12671402.sra file validated SRR12671402 is paired end SRR12671402 is conventional basespace SRR12671402 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671402_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6625 37.0 37.0 37.0 37.0 37.0 2 36.16825 37.0 37.0 37.0 37.0 37.0 3 36.4155 37.0 37.0 37.0 37.0 37.0 4 36.5735 37.0 37.0 37.0 37.0 37.0 5 36.611 37.0 37.0 37.0 37.0 37.0 6 36.5295 37.0 37.0 37.0 37.0 37.0 7 36.468 37.0 37.0 37.0 37.0 37.0 8 36.5785 37.0 37.0 37.0 37.0 37.0 9 36.56 37.0 37.0 37.0 37.0 37.0 10-14 36.5286 37.0 37.0 37.0 37.0 37.0 15-19 36.5194 37.0 37.0 37.0 37.0 37.0 20-24 36.588300000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.5078 37.0 37.0 37.0 37.0 37.0 30-34 36.4724 37.0 37.0 37.0 37.0 37.0 35-39 36.426199999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.4359 37.0 37.0 37.0 37.0 37.0 45-49 36.3814 37.0 37.0 37.0 37.0 37.0 50-54 36.394800000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.433299999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.3544 37.0 37.0 37.0 37.0 37.0 65-69 36.3375 37.0 37.0 37.0 37.0 37.0 70-74 36.2856 37.0 37.0 37.0 37.0 37.0 75-79 36.322199999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.2453 37.0 37.0 37.0 37.0 37.0 85-89 36.2139 37.0 37.0 37.0 37.0 37.0 90-94 36.2503 37.0 37.0 37.0 37.0 37.0 95-99 36.186400000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.1688 37.0 37.0 37.0 37.0 37.0 105-109 36.180600000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.086200000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.0862 37.0 37.0 37.0 37.0 37.0 120-124 36.0758 37.0 37.0 37.0 37.0 37.0 125-129 36.0541 37.0 37.0 37.0 37.0 37.0 130-134 36.0627 37.0 37.0 37.0 37.0 37.0 135-139 35.9816 37.0 37.0 37.0 37.0 37.0 140-144 35.88 37.0 37.0 37.0 37.0 37.0 145-149 35.9125 37.0 37.0 37.0 37.0 37.0 150-151 35.83625000000001 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 1.0 24 2.0 25 1.0 26 4.0 27 2.0 28 13.0 29 16.0 30 26.0 31 45.0 32 48.0 33 70.0 34 134.0 35 287.0 36 2931.0 37 419.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 54.900000000000006 11.600000000000001 4.55 28.95 2 20.943064961123653 12.089290193127665 35.96689240030098 31.000752445447706 3 17.45 20.525 29.599999999999998 32.425 4 21.6 24.925 25.35 28.125 5 23.325000000000003 32.6 23.575 20.5 6 19.875 35.35 24.099999999999998 20.674999999999997 7 14.7 24.625 43.45 17.224999999999998 8 15.2 25.424999999999997 34.075 25.3 9 17.8 23.275000000000002 36.625 22.3 10-14 19.38 30.45 27.765 22.405 15-19 20.23 28.38 27.52 23.87 20-24 20.055 28.425 27.29 24.23 25-29 19.509999999999998 28.904999999999998 28.065 23.52 30-34 20.375 28.485 27.54 23.599999999999998 35-39 20.085 28.33 28.249999999999996 23.335 40-44 20.745 28.93 27.224999999999998 23.1 45-49 20.005 28.994999999999997 27.145000000000003 23.855 50-54 20.78 28.810000000000002 27.125 23.285 55-59 19.814999999999998 29.24 27.37 23.575 60-64 20.32 29.294999999999998 26.87 23.515 65-69 19.875 29.145 27.455000000000002 23.525 70-74 20.28 28.4 27.6 23.72 75-79 20.125 28.335 27.700000000000003 23.84 80-84 20.04 28.065 27.575 24.32 85-89 20.24 29.005 26.900000000000002 23.855 90-94 20.82 28.48 27.055 23.645 95-99 20.200000000000003 29.15 26.82 23.830000000000002 100-104 19.835 28.83 27.74 23.595 105-109 19.85 28.465 27.615000000000002 24.07 110-114 20.445 29.015 27.605 22.935 115-119 21.27 28.74 26.590000000000003 23.400000000000002 120-124 20.474999999999998 27.694999999999997 28.444999999999997 23.385 125-129 20.305 28.525 27.215 23.955000000000002 130-134 20.119999999999997 28.26 27.48 24.14 135-139 21.325 27.62 26.985 24.07 140-144 20.674999999999997 28.73 26.71 23.885 145-149 20.945 28.37 27.13 23.555 150-151 21.2875 28.0625 26.825 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 2.5 22 4.0 23 2.5 24 3.0 25 4.0 26 5.0 27 8.0 28 14.0 29 14.0 30 16.5 31 27.5 32 33.5 33 51.0 34 64.0 35 74.5 36 94.5 37 107.0 38 131.0 39 150.0 40 172.0 41 208.0 42 223.0 43 238.0 44 260.5 45 262.0 46 265.0 47 254.5 48 226.5 49 198.5 50 170.0 51 145.0 52 121.0 53 103.0 54 75.5 55 68.5 56 60.5 57 40.5 58 32.5 59 21.0 60 12.5 61 9.5 62 7.5 63 3.5 64 2.0 65 2.0 66 1.5 67 1.0 68 1.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.05 #Duplication Level Percentage of deduplicated Percentage of total 1 84.80071386079715 71.275 2 12.343842950624628 20.75 3 2.1415823914336705 5.4 4 0.5353955978584176 1.7999999999999998 5 0.148720999405116 0.625 6 0.0297441998810232 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCTCCTCAAAATGATTCTCCCGGAATGCCTTGTTTCCATTTTGCACAAG 6 0.15 No Hit TTTTTTTTTACACTAATTATAAGACTTCATTAAAACCACACCAGAGGCCA 5 0.125 No Hit CTTCAGCTTTGACAAACTTAGGAAGTCCATCTGATAAACCTCTAGCAAAC 5 0.125 No Hit GGCGGCAATAAAGCTGATGCACTGCACTTGACGCGTGTTGTCGAATCCGA 5 0.125 No Hit CCCAGGATCAACAGGCATCCAAAGGCCATCCTCCTTAATAACACCAATCT 5 0.125 No Hit ACAGCTCGTCTTTCCTACACCTCCCTTCCCACCAAGCATGTAATACTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0 0.0 0.0 116-117 1.1375000000000002 0.0 0.0 0.0 0.0 118-119 1.25 0.0 0.0 0.0 0.0 120-121 1.3 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.475 0.0 0.0 0.0 0.0 126-127 1.6375 0.0 0.0 0.0 0.0 128-129 1.7125 0.0 0.0 0.0 0.0 130-131 1.85 0.0 0.0 0.0 0.0 132-133 1.9375 0.0 0.0 0.0 0.0 134-135 2.175 0.0 0.0 0.0 0.0 136-137 2.4125 0.0 0.0 0.0 0.0 138-139 2.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671402 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671402_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1925 37.0 37.0 37.0 37.0 37.0 2 36.0685 37.0 37.0 37.0 37.0 37.0 3 36.1755 37.0 37.0 37.0 37.0 37.0 4 36.2825 37.0 37.0 37.0 37.0 37.0 5 36.1615 37.0 37.0 37.0 37.0 37.0 6 36.2305 37.0 37.0 37.0 37.0 37.0 7 36.1615 37.0 37.0 37.0 37.0 37.0 8 36.242 37.0 37.0 37.0 37.0 37.0 9 36.1195 37.0 37.0 37.0 37.0 37.0 10-14 36.153200000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.153800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.0655 37.0 37.0 37.0 37.0 37.0 25-29 36.0321 37.0 37.0 37.0 37.0 37.0 30-34 35.966699999999996 37.0 37.0 37.0 37.0 37.0 35-39 35.991600000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.0582 37.0 37.0 37.0 37.0 37.0 45-49 35.9843 37.0 37.0 37.0 37.0 37.0 50-54 35.9892 37.0 37.0 37.0 37.0 37.0 55-59 35.967400000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.9155 37.0 37.0 37.0 37.0 37.0 65-69 35.8498 37.0 37.0 37.0 37.0 37.0 70-74 35.8491 37.0 37.0 37.0 37.0 37.0 75-79 35.8705 37.0 37.0 37.0 37.0 37.0 80-84 35.7973 37.0 37.0 37.0 37.0 37.0 85-89 35.887899999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.749500000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.7964 37.0 37.0 37.0 37.0 37.0 100-104 35.7309 37.0 37.0 37.0 37.0 37.0 105-109 35.6537 37.0 37.0 37.0 37.0 37.0 110-114 35.7067 37.0 37.0 37.0 37.0 37.0 115-119 35.7601 37.0 37.0 37.0 37.0 37.0 120-124 35.677200000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.5751 37.0 37.0 37.0 37.0 37.0 130-134 35.4987 37.0 37.0 37.0 37.0 37.0 135-139 35.4562 37.0 37.0 37.0 37.0 37.0 140-144 35.4886 37.0 37.0 37.0 37.0 37.0 145-149 35.4222 37.0 37.0 37.0 37.0 37.0 150-151 35.1515 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 8.0 15 5.0 16 3.0 17 3.0 18 1.0 19 1.0 20 4.0 21 2.0 22 8.0 23 6.0 24 10.0 25 7.0 26 4.0 27 12.0 28 20.0 29 21.0 30 19.0 31 44.0 32 55.0 33 87.0 34 181.0 35 498.0 36 2705.0 37 292.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.925000000000004 25.75 7.074999999999999 19.25 2 28.65 24.925 31.225 15.2 3 20.1 27.150000000000002 35.0 17.75 4 26.0 32.875 22.875 18.25 5 24.6 40.699999999999996 18.95 15.75 6 20.474999999999998 40.275 22.0 17.25 7 21.8 21.85 38.35 18.0 8 19.525000000000002 25.124999999999996 29.025000000000002 26.325 9 21.5 25.124999999999996 29.475 23.9 10-14 23.880000000000003 29.494999999999997 25.95 20.674999999999997 15-19 23.395 28.360000000000003 27.334999999999997 20.91 20-24 22.795 28.610000000000003 27.965 20.630000000000003 25-29 23.29 28.285 27.83 20.595 30-34 23.015 28.625 28.02 20.34 35-39 22.795 27.905 28.494999999999997 20.805 40-44 22.845 28.925 27.49 20.74 45-49 22.814999999999998 28.325 27.85 21.01 50-54 22.220000000000002 28.405 27.96 21.415 55-59 23.419999999999998 27.41 28.625 20.544999999999998 60-64 22.975 27.76 28.375 20.89 65-69 23.16 28.235 27.485 21.12 70-74 22.78 27.48 27.860000000000003 21.88 75-79 22.945 27.465 27.894999999999996 21.695 80-84 22.564999999999998 28.055000000000003 27.595 21.785 85-89 23.165 27.694999999999997 27.744999999999997 21.395 90-94 23.44 27.91 27.855 20.794999999999998 95-99 23.595 27.43 27.975 21.0 100-104 23.895 27.415 27.57 21.12 105-109 23.705000000000002 28.1 27.87 20.325 110-114 23.169999999999998 28.499999999999996 27.35 20.979999999999997 115-119 23.985 27.755000000000003 27.694999999999997 20.565 120-124 23.855 28.34 27.860000000000003 19.945 125-129 23.57 28.33 27.55 20.549999999999997 130-134 24.125 28.084999999999997 27.565 20.225 135-139 23.455000000000002 27.55 28.065 20.93 140-144 24.285 27.250000000000004 27.98 20.485 145-149 24.925 27.755000000000003 27.375 19.945 150-151 24.212500000000002 26.9125 28.549999999999997 20.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 1.0 8 1.0 9 1.0 10 0.5 11 0.0 12 0.0 13 1.0 14 2.0 15 1.5 16 1.0 17 1.0 18 1.0 19 0.5 20 1.0 21 1.5 22 3.5 23 4.0 24 2.5 25 3.5 26 4.0 27 6.0 28 8.5 29 12.5 30 20.0 31 23.5 32 30.0 33 40.0 34 48.5 35 65.0 36 91.5 37 117.0 38 135.0 39 163.5 40 185.0 41 231.0 42 274.5 43 266.0 44 244.0 45 245.0 46 256.0 47 232.5 48 214.5 49 201.5 50 162.0 51 144.0 52 120.0 53 92.5 54 81.5 55 62.5 56 50.5 57 31.5 58 19.0 59 17.5 60 14.5 61 11.5 62 15.0 63 13.0 64 6.5 65 3.0 66 1.0 67 2.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.975 #Duplication Level Percentage of deduplicated Percentage of total 1 85.29324203632034 71.625 2 11.640369157487347 19.55 3 2.3221196784757367 5.8500000000000005 4 0.4465614766299494 1.5 5 0.14885382554331647 0.625 6 0.08931229532598987 0.44999999999999996 7 0.029770765108663295 0.17500000000000002 8 0.0 0.0 9 0.029770765108663295 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit GTCTGACATGTGTGCGAGTCAACGGGCGAGTAAACCCGTAAGGCGCAAGG 7 0.17500000000000002 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 6 0.15 No Hit GAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCA 6 0.15 No Hit AGAATTGATTGCTAAACAAATGTCAGGTGAAGCGGCGTCGTCGTCTTCTG 6 0.15 No Hit GCCAGAAGCACTAACCATGGGTTTGCTCTCTTTTGCACCAAAAACTTCAA 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit GAAATATCATTGACTGAACTAGAAGAGAGAGCCGCTGCGGCTGGCATAGA 5 0.125 No Hit GCAAATTTGGTTTCTATGAGTTTTTCAAGAAGTACTACTCTGATCTTGCC 5 0.125 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0125 0.0 0.0 88-89 0.0625 0.0 0.025 0.0 0.0 90-91 0.125 0.0 0.025 0.0 0.0 92-93 0.1875 0.0 0.025 0.0 0.0 94-95 0.2 0.0 0.025 0.0 0.0 96-97 0.225 0.0 0.025 0.0 0.0 98-99 0.275 0.0 0.025 0.0 0.0 100-101 0.42500000000000004 0.0 0.025 0.0 0.0 102-103 0.475 0.0 0.025 0.0 0.0 104-105 0.55 0.0 0.025 0.0 0.0 106-107 0.6125 0.0 0.025 0.0 0.0 108-109 0.6875 0.0 0.025 0.0 0.0 110-111 0.8375 0.0 0.025 0.0 0.0 112-113 0.9375 0.0 0.025 0.0 0.0 114-115 1.0625 0.0 0.025 0.0 0.0 116-117 1.1625 0.0 0.025 0.0 0.0 118-119 1.275 0.0 0.025 0.0 0.0 120-121 1.325 0.0 0.025 0.0 0.0 122-123 1.4 0.0 0.025 0.0 0.0 124-125 1.5 0.0 0.025 0.0 0.0 126-127 1.6625 0.0 0.025 0.0 0.0 128-129 1.7375 0.0 0.025 0.0 0.0 130-131 1.875 0.0 0.025 0.0 0.0 132-133 1.9625 0.0 0.025 0.0 0.0 134-135 2.2249999999999996 0.0 0.025 0.0 0.0 136-137 2.4625 0.0 0.025 0.0 0.0 138-139 2.6625 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTCT 10 0.006830828 145.0 3 >>END_MODULE Read 926777 spots for SRR12671402.sra Written 926777 spots for SRR12671402.sra Read 926777 spots for SRR12671402.sra Written 926777 spots for SRR12671402.sra Read 926777 spots for SRR12671402.sra Written 926777 spots for SRR12671402.sra Read 926777 spots for SRR12671402.sra Written 926777 spots for SRR12671402.sra Read 926777 spots for SRR12671402.sra Written 926777 spots for SRR12671402.sra Read 926777 spots for SRR12671402.sra Written 926777 spots for SRR12671402.sra Read 926777 spots for SRR12671402.sra Written 926777 spots for SRR12671402.sra Read 926777 spots for SRR12671402.sra Written 926777 spots for SRR12671402.sra Read 926777 spots for SRR12671402.sra Written 926777 spots for SRR12671402.sra Read 926795 spots for SRR12671402.sra Written 926795 spots for SRR12671402.sra Read 926777 spots for SRR12671402.sra Written 926777 spots for SRR12671402.sra Read 926777 spots for SRR12671402.sra Written 926777 spots for SRR12671402.sra Read 926777 spots for SRR12671402.sra Written 926777 spots for SRR12671402.sra Read 926777 spots for SRR12671402.sra Written 926777 spots for SRR12671402.sra Read 926777 spots for SRR12671402.sra Written 926777 spots for SRR12671402.sra Read 926777 spots for SRR12671402.sra Written 926777 spots for SRR12671402.sra Read 926777 spots for SRR12671402.sra Written 926777 spots for SRR12671402.sra Read 926777 spots for SRR12671402.sra Written 926777 spots for SRR12671402.sra Read 926777 spots for SRR12671402.sra Written 926777 spots for SRR12671402.sra Read 926777 spots for SRR12671402.sra Written 926777 spots for SRR12671402.sra SRR ids: ['SRR12671402.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zadt5mei SRR12671402.sra spots: 18535558 blocks: [[1, 926777], [926778, 1853554], [1853555, 2780331], [2780332, 3707108], [3707109, 4633885], [4633886, 5560662], [5560663, 6487439], [6487440, 7414216], [7414217, 8340993], [8340994, 9267770], [9267771, 10194547], [10194548, 11121324], [11121325, 12048101], [12048102, 12974878], [12974879, 13901655], [13901656, 14828432], [14828433, 15755209], [15755210, 16681986], [16681987, 17608763], [17608764, 18535558]] SRR12671402 file size 6277493 SRR12671402 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671402 SRR12671402_1.fastq SRR12671402_2.fastq Input file: SRR12671402_1.fastq Paired file: SRR12671402_2.fastq trimmed: SRR12671402-trimmed-pair1.fastq, SRR12671402-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:21:32 2025 >> started Tue Feb 11 22:22:02 2025 >> done (30.003s) 18535558 read pairs processed; of these: 71 ( 0.00%) short read pairs filtered out after trimming by size control 2271 ( 0.01%) empty read pairs filtered out after trimming by size control 18533216 (99.99%) read pairs available; of these: 790597 ( 4.27%) trimmed read pairs available after processing 17742619 (95.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 6 0.00% 20 12 0.00% 21 7 0.00% 22 17 0.00% 23 18 0.00% 24 22 0.00% 25 16 0.00% 26 19 0.00% 27 22 0.00% 28 25 0.00% 29 26 0.00% 30 25 0.00% 31 30 0.00% 32 24 0.00% 33 19 0.00% 34 15 0.00% 35 27 0.00% 36 25 0.00% 37 32 0.00% 38 39 0.00% 39 36 0.00% 40 25 0.00% 41 33 0.00% 42 38 0.00% 43 34 0.00% 44 40 0.00% 45 41 0.00% 46 48 0.00% 47 47 0.00% 48 43 0.00% 49 48 0.00% 50 69 0.00% 51 60 0.00% 52 84 0.00% 53 90 0.00% 54 85 0.00% 55 94 0.00% 56 113 0.00% 57 124 0.00% 58 125 0.00% 59 166 0.00% 60 201 0.00% 61 230 0.00% 62 246 0.00% 63 264 0.00% 64 280 0.00% 65 313 0.00% 66 349 0.00% 67 353 0.00% 68 456 0.00% 69 487 0.00% 70 567 0.00% 71 599 0.00% 72 651 0.00% 73 802 0.00% 74 874 0.00% 75 961 0.01% 76 1050 0.01% 77 1128 0.01% 78 1222 0.01% 79 1433 0.01% 80 1466 0.01% 81 1682 0.01% 82 1800 0.01% 83 2068 0.01% 84 2266 0.01% 85 2301 0.01% 86 2635 0.01% 87 2711 0.01% 88 2863 0.02% 89 2964 0.02% 90 3362 0.02% 91 3487 0.02% 92 3660 0.02% 93 4042 0.02% 94 4148 0.02% 95 4620 0.02% 96 4684 0.03% 97 4895 0.03% 98 4908 0.03% 99 5229 0.03% 100 5389 0.03% 101 5700 0.03% 102 5986 0.03% 103 6503 0.04% 104 6673 0.04% 105 6951 0.04% 106 7325 0.04% 107 7389 0.04% 108 7687 0.04% 109 7664 0.04% 110 8127 0.04% 111 8382 0.05% 112 8715 0.05% 113 8757 0.05% 114 9522 0.05% 115 9789 0.05% 116 10033 0.05% 117 10671 0.06% 118 10875 0.06% 119 11136 0.06% 120 11608 0.06% 121 11975 0.06% 122 12001 0.06% 123 12427 0.07% 124 12968 0.07% 125 13310 0.07% 126 13856 0.07% 127 14194 0.08% 128 14345 0.08% 129 14840 0.08% 130 15406 0.08% 131 15335 0.08% 132 15799 0.09% 133 16186 0.09% 134 16573 0.09% 135 17449 0.09% 136 18079 0.10% 137 18181 0.10% 138 18911 0.10% 139 19664 0.11% 140 19441 0.10% 141 19957 0.11% 142 20879 0.11% 143 20822 0.11% 144 21539 0.12% 145 21996 0.12% 146 22573 0.12% 147 23477 0.13% 148 24125 0.13% 149 24312 0.13% 150 24954 0.13% 151 17742619 95.73% 18533216 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=20 prefix-density=0.51 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=49.94 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.7 sequence=AAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.72 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=32 prefix-density=0.72 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=25.36 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.8 sequence=AAAGGATGGTAGAGTAGCATCCTTAGCGTTGCTGGTTTACTTTCCTAACAATCCTCAAAACCATTCTTCTTAGACTCTCTATACATTCCAAATAACCTAATTTGTACTGTATAGATATATAGTCTACGTCAAGCTTAAATAAATCCTCATTAACATGGCCCCAGGAGTGCCTATAGATGGGAATATTTTGGGTACCGGGAAGGTTTCCACAGTTAACACTGGCTATTCTAAGAGGGCCTACGTGACATTTTTAGCCGGCAACGGGGATTATGTTAAAGGGGTAGTTGGGTTGGCTAAGGGTTTGCGCAAGGTGAAGAGTGCATACCCTCTTGTCGTAGCAATCTTGCCGGATGTGCCCGAGGAACACCGTGACATTTTGAGGTCTCAAGGTTGCATTGTTCGTGAGATCGAGCCTATTTATCCACCTGAGAACCAGATTCAGTTTGCCATGGCCTACTACGTGATCAACTACTCCAAGCTCCGAATTTGGAATTTTGAGGAGTACAGCAAG SRR12671402 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:22:48 Started mapping on | Feb 11 22:22:48 Finished on | Feb 11 22:24:51 Mapping speed, Million of reads per hour | 542.44 Number of input reads | 18533216 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 17100216 Uniquely mapped reads % | 92.27% Average mapped length | 298.21 Number of splices: Total | 16698124 Number of splices: Annotated (sjdb) | 16355423 Number of splices: GT/AG | 16369685 Number of splices: GC/AG | 265094 Number of splices: AT/AC | 10974 Number of splices: Non-canonical | 52371 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.83 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 437822 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 104447 % of reads mapped to too many loci | 0.56% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.61% % of reads unmapped: other | 0.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 995178 995178 995178 N_multimapping 437822 437822 437822 N_noFeature 717470 16762645 825662 N_ambiguous 351779 1323 121575 UnstrandedReadsAssigned:16030967 PositiveStrandReadsAssigned:336248 NegativeStrandReadsAssigned:16152979 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671402 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671402-trimmed-pair1.fastq SRR12671402-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,533,216 reads, 16,137,229 reads pseudoaligned [quant] estimated average fragment length: 302.253 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR12671402.ke.tsv 34699 SRR12671402.se.tsv 87100 total ==> SRR12671402.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1716.75 653 19.7745 Potri.005G024800.1.v4.1 1035 733.747 279 19.7677 Potri.004G059700.1.v4.1 961 659.997 8 0.630152 Potri.007G009000.2.v4.1 1416 1114.75 0 0 Potri.003G141000.2.v4.1 2943 2641.75 723 14.228 Potri.016G087400.1.v4.1 270 69.6191 724 540.64 Potri.015G069301.1.v4.1 564 283.602 0 0 Potri.010G195200.1.v4.1 1773 1471.75 67.7518 2.39323 Potri.012G127500.1.v4.1 977 675.859 241 18.5378 ==> SRR12671402.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 255 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 253 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 2 SRR12671402 completed mapping pipeline successfully