Starting /dee2/code/volunteer_pipeline.sh SRR12671403 current disk space = 3052368478208 free memory = 1459253004 SRR12671403 SRAfilesize a184a891d28b6613802003cb2d6edb6a SRR12671403.sra SRR12671403.sra file validated SRR12671403 is paired end SRR12671403 is conventional basespace SRR12671403 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671403_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6045 37.0 37.0 37.0 37.0 37.0 2 36.2155 37.0 37.0 37.0 37.0 37.0 3 36.4965 37.0 37.0 37.0 37.0 37.0 4 36.6355 37.0 37.0 37.0 37.0 37.0 5 36.585 37.0 37.0 37.0 37.0 37.0 6 36.628 37.0 37.0 37.0 37.0 37.0 7 36.455 37.0 37.0 37.0 37.0 37.0 8 36.693 37.0 37.0 37.0 37.0 37.0 9 36.525 37.0 37.0 37.0 37.0 37.0 10-14 36.580600000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.5621 37.0 37.0 37.0 37.0 37.0 20-24 36.6019 37.0 37.0 37.0 37.0 37.0 25-29 36.5084 37.0 37.0 37.0 37.0 37.0 30-34 36.517399999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.5005 37.0 37.0 37.0 37.0 37.0 40-44 36.4625 37.0 37.0 37.0 37.0 37.0 45-49 36.459 37.0 37.0 37.0 37.0 37.0 50-54 36.4482 37.0 37.0 37.0 37.0 37.0 55-59 36.3938 37.0 37.0 37.0 37.0 37.0 60-64 36.3677 37.0 37.0 37.0 37.0 37.0 65-69 36.349199999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.3448 37.0 37.0 37.0 37.0 37.0 75-79 36.3472 37.0 37.0 37.0 37.0 37.0 80-84 36.322199999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2916 37.0 37.0 37.0 37.0 37.0 90-94 36.273399999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.271100000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.2089 37.0 37.0 37.0 37.0 37.0 105-109 36.2836 37.0 37.0 37.0 37.0 37.0 110-114 36.1222 37.0 37.0 37.0 37.0 37.0 115-119 36.1495 37.0 37.0 37.0 37.0 37.0 120-124 36.1378 37.0 37.0 37.0 37.0 37.0 125-129 36.1322 37.0 37.0 37.0 37.0 37.0 130-134 36.0375 37.0 37.0 37.0 37.0 37.0 135-139 36.0912 37.0 37.0 37.0 37.0 37.0 140-144 35.9676 37.0 37.0 37.0 37.0 37.0 145-149 35.9738 37.0 37.0 37.0 37.0 37.0 150-151 35.913 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 0.0 22 1.0 23 3.0 24 1.0 25 3.0 26 3.0 27 7.0 28 9.0 29 11.0 30 24.0 31 22.0 32 39.0 33 75.0 34 101.0 35 304.0 36 2956.0 37 439.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.875 11.1 5.25 37.775 2 18.966382338183642 12.794781736076267 38.35925740090316 29.87957852483693 3 18.15 19.575 28.875 33.4 4 24.85 24.65 23.175 27.325 5 24.15 33.25 23.45 19.15 6 18.099999999999998 35.725 23.925 22.25 7 14.05 24.95 44.675 16.325 8 15.6 25.025 34.925 24.45 9 17.150000000000002 22.875 35.449999999999996 24.525 10-14 18.515 30.735 27.99 22.759999999999998 15-19 19.53 27.415 28.73 24.325 20-24 20.07 27.725 28.660000000000004 23.544999999999998 25-29 20.185 27.96 28.244999999999997 23.61 30-34 18.945 29.37 27.650000000000002 24.035 35-39 19.715 28.345 28.15 23.79 40-44 20.34 29.505 27.169999999999998 22.985 45-49 19.939999999999998 28.645 27.665 23.75 50-54 19.575 28.410000000000004 28.475 23.54 55-59 19.52 28.595 27.775 24.11 60-64 20.015 28.49 27.42 24.075 65-69 19.72 28.205000000000002 28.235 23.84 70-74 20.095 28.360000000000003 27.79 23.755000000000003 75-79 19.045 28.465 28.475 24.015 80-84 20.43 28.285 27.894999999999996 23.39 85-89 19.98 28.33 27.79 23.9 90-94 20.73 28.044999999999998 27.694999999999997 23.53 95-99 20.495 28.025 27.794999999999998 23.685000000000002 100-104 20.155 28.689999999999998 27.55 23.605 105-109 20.72 27.800000000000004 28.15 23.330000000000002 110-114 20.96 28.444999999999997 27.6 22.994999999999997 115-119 20.455000000000002 27.529999999999998 28.470000000000002 23.544999999999998 120-124 20.61 27.994999999999997 28.005000000000003 23.39 125-129 20.085 28.365000000000002 27.83 23.72 130-134 20.48 28.51 27.075 23.935000000000002 135-139 20.595 28.09 27.939999999999998 23.375 140-144 20.625 28.205000000000002 27.465 23.705000000000002 145-149 20.68 28.065 27.57 23.685000000000002 150-151 21.675 27.6375 27.175 23.5125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 1.5 17 1.0 18 0.5 19 0.5 20 0.0 21 1.0 22 3.0 23 3.0 24 2.5 25 5.5 26 8.5 27 8.0 28 11.0 29 15.5 30 17.0 31 18.5 32 33.0 33 47.0 34 54.5 35 78.5 36 97.0 37 103.0 38 122.0 39 151.0 40 182.0 41 207.5 42 232.5 43 257.0 44 272.0 45 284.0 46 293.5 47 273.0 48 231.5 49 197.5 50 166.5 51 137.5 52 114.0 53 96.0 54 71.5 55 50.0 56 36.5 57 31.5 58 31.0 59 19.5 60 8.5 61 5.5 62 3.0 63 3.0 64 3.5 65 2.0 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.28741800834824 70.675 2 12.969588550983898 21.75 3 2.176505664877758 5.475 4 0.3279666070363745 1.0999999999999999 5 0.2385211687537269 1.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCTCTGTTAATTCATGACCTTCATCCAGGACATTTGGCATAGCAGAAT 5 0.125 No Hit GGACAAGGAACTATATTCCAGATGTGATTATCTTGAAGAGATTGAATCTC 5 0.125 No Hit CTCACCACCAACCAAATCTGCTCCTGCATTTTTTGCTTCATCGAACTTTT 5 0.125 No Hit GTCGGCCTTGTCATGTTTCTCCAAATGAGTCTCTCTTGGAAAGACTTCGA 5 0.125 No Hit GCACTGCACTTGACGCGTGTTGTCGAATCCGATTATACGGATAAAGGCGT 5 0.125 No Hit GTCGGAATTGGCTCGCCAGCAGGAGTATAAGCGTCACATATGACGAGGAT 5 0.125 No Hit ACTGTACATCCAGTCATAGACAGTGGGTGTGTTAGGCTGTGGCTTGTCAA 5 0.125 No Hit GTGGGGAAGCTTCAAGTGCCTTTTGATTGAATCTCTTAAAGCCATCACGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 0.9625 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.1749999999999998 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.375 0.0 0.0 0.0 0.0 124-125 1.5625 0.0 0.0 0.0 0.0 126-127 1.6875 0.0 0.0 0.0 0.0 128-129 1.9625 0.0 0.0 0.0 0.0 130-131 2.1625 0.0 0.0 0.0 0.0 132-133 2.375 0.0 0.0 0.0 0.0 134-135 2.5375 0.0 0.0 0.0 0.0 136-137 2.8 0.0 0.0 0.0 0.0 138-139 3.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCCAT 10 0.006830828 145.0 1 ACAGGTG 10 0.006830828 145.0 145 GCCAAAA 10 0.006830828 145.0 1 >>END_MODULE SRR12671403 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671403_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.244 37.0 37.0 37.0 37.0 37.0 2 35.893 37.0 37.0 37.0 37.0 37.0 3 36.0665 37.0 37.0 37.0 37.0 37.0 4 36.0875 37.0 37.0 37.0 37.0 37.0 5 36.1775 37.0 37.0 37.0 37.0 37.0 6 36.1685 37.0 37.0 37.0 37.0 37.0 7 36.128 37.0 37.0 37.0 37.0 37.0 8 36.2185 37.0 37.0 37.0 37.0 37.0 9 36.2195 37.0 37.0 37.0 37.0 37.0 10-14 36.26199999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.175599999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.173 37.0 37.0 37.0 37.0 37.0 25-29 36.1074 37.0 37.0 37.0 37.0 37.0 30-34 36.0656 37.0 37.0 37.0 37.0 37.0 35-39 36.0594 37.0 37.0 37.0 37.0 37.0 40-44 36.064 37.0 37.0 37.0 37.0 37.0 45-49 35.99229999999999 37.0 37.0 37.0 37.0 37.0 50-54 36.0192 37.0 37.0 37.0 37.0 37.0 55-59 35.9332 37.0 37.0 37.0 37.0 37.0 60-64 35.919799999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.938300000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.839800000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.829699999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.77819999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.8838 37.0 37.0 37.0 37.0 37.0 90-94 35.8291 37.0 37.0 37.0 37.0 37.0 95-99 35.7712 37.0 37.0 37.0 37.0 37.0 100-104 35.76899999999999 37.0 37.0 37.0 37.0 37.0 105-109 35.655199999999994 37.0 37.0 37.0 37.0 37.0 110-114 35.641400000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.8313 37.0 37.0 37.0 37.0 37.0 120-124 35.6611 37.0 37.0 37.0 37.0 37.0 125-129 35.667699999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.58 37.0 37.0 37.0 37.0 37.0 135-139 35.5073 37.0 37.0 37.0 37.0 37.0 140-144 35.5511 37.0 37.0 37.0 37.0 37.0 145-149 35.453 37.0 37.0 37.0 37.0 37.0 150-151 35.345 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 2.0 15 4.0 16 0.0 17 0.0 18 1.0 19 0.0 20 3.0 21 5.0 22 9.0 23 4.0 24 11.0 25 4.0 26 10.0 27 8.0 28 15.0 29 26.0 30 28.0 31 31.0 32 51.0 33 99.0 34 207.0 35 569.0 36 2662.0 37 248.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.25 21.825 8.9 24.025 2 26.875 25.174999999999997 33.7 14.249999999999998 3 20.45 27.55 33.75 18.25 4 23.974999999999998 34.35 22.8 18.875 5 24.375 38.175 21.75 15.7 6 20.75 40.300000000000004 21.875 17.075000000000003 7 20.549999999999997 22.425 39.625 17.4 8 19.75 25.525 29.075 25.650000000000002 9 22.025 24.125 30.049999999999997 23.799999999999997 10-14 22.375 29.995 26.775 20.855 15-19 23.01 28.73 27.884999999999998 20.375 20-24 23.04 28.645 28.310000000000002 20.005 25-29 22.235 28.410000000000004 28.505000000000003 20.849999999999998 30-34 22.545 28.384999999999998 27.93 21.14 35-39 22.725 28.325 27.985 20.965 40-44 22.855 28.435 28.125 20.585 45-49 22.865 28.035 28.860000000000003 20.24 50-54 22.79 28.68 27.99 20.54 55-59 22.705000000000002 28.335 28.095 20.865000000000002 60-64 22.525000000000002 28.09 28.144999999999996 21.240000000000002 65-69 23.925 27.605 27.83 20.64 70-74 22.945 28.035 28.060000000000002 20.96 75-79 23.24 27.750000000000004 28.49 20.52 80-84 23.02 28.189999999999998 28.1 20.69 85-89 23.39 28.28 27.49 20.84 90-94 23.425 27.944999999999997 28.18 20.45 95-99 23.41 28.044999999999998 27.705000000000002 20.84 100-104 23.549999999999997 28.084999999999997 27.875 20.49 105-109 23.26 28.060000000000002 27.700000000000003 20.979999999999997 110-114 23.724999999999998 28.23 27.944999999999997 20.1 115-119 23.51 28.499999999999996 27.675 20.315 120-124 23.13 28.37 27.884999999999998 20.615 125-129 23.375 28.499999999999996 27.305 20.82 130-134 23.425 27.905 27.800000000000004 20.87 135-139 24.185000000000002 28.425 27.255000000000003 20.135 140-144 24.335 28.03 27.405 20.23 145-149 23.985 28.444999999999997 27.134999999999998 20.435 150-151 25.112499999999997 26.987499999999997 27.575 20.325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.5 19 2.5 20 2.5 21 1.5 22 2.5 23 3.0 24 5.5 25 5.0 26 2.5 27 8.0 28 13.5 29 12.0 30 15.0 31 21.0 32 25.0 33 32.0 34 49.5 35 72.0 36 91.5 37 115.5 38 142.0 39 178.0 40 219.5 41 249.0 42 270.0 43 280.5 44 290.5 45 274.5 46 268.5 47 245.0 48 194.5 49 191.5 50 162.5 51 109.5 52 84.5 53 74.0 54 64.5 55 51.5 56 39.5 57 33.0 58 26.0 59 16.0 60 10.5 61 8.5 62 8.0 63 5.5 64 0.5 65 0.0 66 0.0 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 1.0 81 1.0 82 0.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.5 88 1.0 89 1.0 90 0.5 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.92500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 84.6589216562407 71.05 2 12.600536193029491 21.15 3 1.9958296097706285 5.025 4 0.44682752457551383 1.5 5 0.2680965147453083 1.125 6 0.02978850163836759 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit AACAAGGTCTAAGAGATTCTTGGAAATTCAAAAATTGAGGGAAACAAAAA 5 0.125 No Hit GCTAGGCAAGATGGTTTTACTAGACAAGATGTGGGATGATGTTGTTGCTG 5 0.125 No Hit TTATGATCAATTTCATCCAGTTTTTCTAATTTTCTTCAATTAAACCCCAA 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit AAACAATCTCAAAACACAGAGAAGTTTCTTTGGGTTTTTTTATCATGTCG 5 0.125 No Hit ATTGAGGATTCTGGTTTCCAAGGGCATCACTGGGTCGCAGAATGAAGCTA 5 0.125 No Hit GAAAATCAGAAAGCAAGGCAATCCGAGGAGTCACTGAGGCAGGTCATGTA 5 0.125 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit GTTGAGGTCATGGACGGTAGAATGTACTGGCTGCTTTTGTAGGTGTGGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.025 0.0 110-111 0.7875 0.0 0.0 0.05 0.0 112-113 0.9625 0.0 0.0 0.05 0.0 114-115 1.025 0.0 0.0 0.05 0.0 116-117 1.1 0.0 0.0 0.05 0.0 118-119 1.1749999999999998 0.0 0.0 0.05 0.0 120-121 1.2875 0.0 0.0 0.05 0.0 122-123 1.375 0.0 0.0 0.05 0.0 124-125 1.5625 0.0 0.0 0.05 0.0 126-127 1.6875 0.0 0.0 0.05 0.0 128-129 1.9625 0.0 0.0 0.05 0.0 130-131 2.1625 0.0 0.0 0.05 0.0 132-133 2.4000000000000004 0.0 0.0 0.05 0.0 134-135 2.5625 0.0 0.0 0.05 0.0 136-137 2.825 0.0 0.0 0.05 0.0 138-139 3.0375 0.0 0.0 0.05 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1180280 spots for SRR12671403.sra Written 1180280 spots for SRR12671403.sra Read 1180280 spots for SRR12671403.sra Written 1180280 spots for SRR12671403.sra Read 1180280 spots for SRR12671403.sra Written 1180280 spots for SRR12671403.sra Read 1180280 spots for SRR12671403.sra Written 1180280 spots for SRR12671403.sra Read 1180280 spots for SRR12671403.sra Written 1180280 spots for SRR12671403.sra Read 1180280 spots for SRR12671403.sra Written 1180280 spots for SRR12671403.sra Read 1180280 spots for SRR12671403.sra Written 1180280 spots for SRR12671403.sra Read 1180280 spots for SRR12671403.sra Written 1180280 spots for SRR12671403.sra Read 1180280 spots for SRR12671403.sra Written 1180280 spots for SRR12671403.sra Read 1180280 spots for SRR12671403.sra Written 1180280 spots for SRR12671403.sra Read 1180280 spots for SRR12671403.sra Written 1180280 spots for SRR12671403.sra Read 1180280 spots for SRR12671403.sra Written 1180280 spots for SRR12671403.sra Read 1180280 spots for SRR12671403.sra Written 1180280 spots for SRR12671403.sra Read 1180280 spots for SRR12671403.sra Written 1180280 spots for SRR12671403.sra Read 1180280 spots for SRR12671403.sra Written 1180280 spots for SRR12671403.sra Read 1180280 spots for SRR12671403.sra Written 1180280 spots for SRR12671403.sra Read 1180280 spots for SRR12671403.sra Written 1180280 spots for SRR12671403.sra Read 1180285 spots for SRR12671403.sra Written 1180285 spots for SRR12671403.sra Read 1180280 spots for SRR12671403.sra Written 1180280 spots for SRR12671403.sra Read 1180280 spots for SRR12671403.sra Written 1180280 spots for SRR12671403.sra SRR ids: ['SRR12671403.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_61mhnv0h SRR12671403.sra spots: 23605605 blocks: [[1, 1180280], [1180281, 2360560], [2360561, 3540840], [3540841, 4721120], [4721121, 5901400], [5901401, 7081680], [7081681, 8261960], [8261961, 9442240], [9442241, 10622520], [10622521, 11802800], [11802801, 12983080], [12983081, 14163360], [14163361, 15343640], [15343641, 16523920], [16523921, 17704200], [17704201, 18884480], [18884481, 20064760], [20064761, 21245040], [21245041, 22425320], [22425321, 23605605]] SRR12671403 file size 8000516 SRR12671403 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671403 SRR12671403_1.fastq SRR12671403_2.fastq Input file: SRR12671403_1.fastq Paired file: SRR12671403_2.fastq trimmed: SRR12671403-trimmed-pair1.fastq, SRR12671403-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:18:43 2025 >> started Tue Feb 11 22:19:11 2025 >> done (27.138s) 23605605 read pairs processed; of these: 125 ( 0.00%) short read pairs filtered out after trimming by size control 15179 ( 0.06%) empty read pairs filtered out after trimming by size control 23590301 (99.94%) read pairs available; of these: 1132613 ( 4.80%) trimmed read pairs available after processing 22457688 (95.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 12 0.00% 21 7 0.00% 22 26 0.00% 23 11 0.00% 24 24 0.00% 25 17 0.00% 26 28 0.00% 27 20 0.00% 28 20 0.00% 29 27 0.00% 30 24 0.00% 31 24 0.00% 32 20 0.00% 33 30 0.00% 34 49 0.00% 35 36 0.00% 36 35 0.00% 37 36 0.00% 38 34 0.00% 39 36 0.00% 40 34 0.00% 41 33 0.00% 42 51 0.00% 43 39 0.00% 44 37 0.00% 45 60 0.00% 46 51 0.00% 47 56 0.00% 48 72 0.00% 49 79 0.00% 50 99 0.00% 51 82 0.00% 52 99 0.00% 53 124 0.00% 54 105 0.00% 55 127 0.00% 56 145 0.00% 57 125 0.00% 58 134 0.00% 59 171 0.00% 60 240 0.00% 61 218 0.00% 62 296 0.00% 63 307 0.00% 64 369 0.00% 65 426 0.00% 66 418 0.00% 67 472 0.00% 68 474 0.00% 69 597 0.00% 70 745 0.00% 71 751 0.00% 72 812 0.00% 73 966 0.00% 74 1023 0.00% 75 1194 0.01% 76 1312 0.01% 77 1445 0.01% 78 1602 0.01% 79 1900 0.01% 80 2005 0.01% 81 2191 0.01% 82 2431 0.01% 83 2707 0.01% 84 2903 0.01% 85 3213 0.01% 86 3560 0.02% 87 3632 0.02% 88 4020 0.02% 89 4123 0.02% 90 4499 0.02% 91 4680 0.02% 92 5187 0.02% 93 5432 0.02% 94 6006 0.03% 95 6455 0.03% 96 6625 0.03% 97 6780 0.03% 98 7176 0.03% 99 7738 0.03% 100 7959 0.03% 101 8273 0.04% 102 8814 0.04% 103 9132 0.04% 104 9459 0.04% 105 9964 0.04% 106 10403 0.04% 107 10777 0.05% 108 11005 0.05% 109 11532 0.05% 110 11771 0.05% 111 12239 0.05% 112 12813 0.05% 113 13166 0.06% 114 13713 0.06% 115 14117 0.06% 116 14866 0.06% 117 15430 0.07% 118 15813 0.07% 119 16445 0.07% 120 16500 0.07% 121 17157 0.07% 122 17397 0.07% 123 18109 0.08% 124 18827 0.08% 125 19280 0.08% 126 20188 0.09% 127 20500 0.09% 128 20991 0.09% 129 22100 0.09% 130 22083 0.09% 131 22392 0.09% 132 22757 0.10% 133 23384 0.10% 134 24234 0.10% 135 24820 0.11% 136 25631 0.11% 137 26058 0.11% 138 26766 0.11% 139 27593 0.12% 140 28328 0.12% 141 28823 0.12% 142 29637 0.13% 143 30116 0.13% 144 30979 0.13% 145 31428 0.13% 146 32450 0.14% 147 33061 0.14% 148 34141 0.14% 149 34410 0.15% 150 35603 0.15% 151 22457688 95.20% 23590301 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=17 prefix-density=0.51 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=14.08 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=2.2 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=23 prefix-density=0.64 prefix-fanout=2.3 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=52.67 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.4 sequence=AAAGGATGGTAGAGTAGCATCCTTAGCGTTGCTGGTTTACTTTCCTAACAATCCTCAAAACCATTCTTCTTAGACTCTCTATACATTCCAAATAACCTAATTTGTACTGTATAGATATATAGTCTACGTCAAGCTTAAATAAATCCTCATTAACATGGCCCCAGGAGTGCCTATAGATGGGAATATTTTGGGTACCGGGAAGGTTTCCACAGTTAACACTGGCTATTCTAAGAGGGCCTACGTGACATTTTTAGCCGGCAACGGGGATTATGTTAAAGGGGTAGTTGGGTTGGCTAAGGGTTTGCGCAAGGTGAAGAGTGCATACCCTCTTGTCGTAGCAATCTTGCCGGATGTGCCCGAGGAACACCGTGACATTTTGAGGTCTCAAGGTTGCATTGTTCGTGAGATCGAGCCTATTTATCCACCTGAGAACCAGATTCAGTTTGCCATGGCCTACTACGTGATCAACTACTCCAAGCTCCGAATTTGGAATTTTGAGGAGTACAGCAAG SRR12671403 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:20:21 Started mapping on | Feb 11 22:20:21 Finished on | Feb 11 22:22:49 Mapping speed, Million of reads per hour | 573.82 Number of input reads | 23590301 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 20894517 Uniquely mapped reads % | 88.57% Average mapped length | 290.80 Number of splices: Total | 20994249 Number of splices: Annotated (sjdb) | 20555691 Number of splices: GT/AG | 20573210 Number of splices: GC/AG | 345573 Number of splices: AT/AC | 12346 Number of splices: Non-canonical | 63120 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 522332 % of reads mapped to multiple loci | 2.21% Number of reads mapped to too many loci | 87524 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.72% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2173452 2173452 2173452 N_multimapping 522332 522332 522332 N_noFeature 801904 20594657 904508 N_ambiguous 381676 1923 183202 UnstrandedReadsAssigned:19710937 PositiveStrandReadsAssigned:297937 NegativeStrandReadsAssigned:19806807 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671403 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671403-trimmed-pair1.fastq SRR12671403-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,590,301 reads, 20,584,246 reads pseudoaligned [quant] estimated average fragment length: 288.886 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,096 rounds 52401 SRR12671403.ke.tsv 34699 SRR12671403.se.tsv 87100 total ==> SRR12671403.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1730.11 1063 29.4028 Potri.005G024800.1.v4.1 1035 747.114 268 17.1663 Potri.004G059700.1.v4.1 961 673.387 0 0 Potri.007G009000.2.v4.1 1416 1128.11 0 0 Potri.003G141000.2.v4.1 2943 2655.11 1272 22.9263 Potri.016G087400.1.v4.1 270 76.3884 803 503.058 Potri.015G069301.1.v4.1 564 296.002 0 0 Potri.010G195200.1.v4.1 1773 1485.11 168 5.41352 Potri.012G127500.1.v4.1 977 689.255 43 2.98551 ==> SRR12671403.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 112 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 344 Potri.001G212900.v4.1 18 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671403 completed mapping pipeline successfully