Starting /dee2/code/volunteer_pipeline.sh SRR12671404 current disk space = 3052618342400 free memory = 1414583948 SRR12671404 SRAfilesize 2eb3da1e538d4a21a1653f7d12140279 SRR12671404.sra SRR12671404.sra file validated SRR12671404 is paired end SRR12671404 is conventional basespace SRR12671404 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671404_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 42 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.618 37.0 37.0 37.0 37.0 37.0 2 36.2585 37.0 37.0 37.0 37.0 37.0 3 36.5495 37.0 37.0 37.0 37.0 37.0 4 36.6045 37.0 37.0 37.0 37.0 37.0 5 36.6185 37.0 37.0 37.0 37.0 37.0 6 36.5915 37.0 37.0 37.0 37.0 37.0 7 36.5345 37.0 37.0 37.0 37.0 37.0 8 36.5585 37.0 37.0 37.0 37.0 37.0 9 36.559 37.0 37.0 37.0 37.0 37.0 10-14 36.5311 37.0 37.0 37.0 37.0 37.0 15-19 36.3951 37.0 37.0 37.0 37.0 37.0 20-24 36.33219999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.1788 37.0 37.0 37.0 37.0 37.0 30-34 35.97959999999999 37.0 37.0 37.0 37.0 37.0 35-39 35.785900000000005 37.0 37.0 37.0 37.0 37.0 40-44 35.687 37.0 37.0 37.0 37.0 37.0 45-49 35.486599999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.4328 37.0 37.0 37.0 37.0 37.0 55-59 35.3065 37.0 37.0 37.0 37.0 37.0 60-64 35.203 37.0 37.0 37.0 37.0 37.0 65-69 35.1753 37.0 37.0 37.0 37.0 37.0 70-74 35.1703 37.0 37.0 37.0 37.0 37.0 75-79 35.25509999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.2567 37.0 37.0 37.0 37.0 37.0 85-89 35.2347 37.0 37.0 37.0 37.0 37.0 90-94 35.2474 37.0 37.0 37.0 37.0 37.0 95-99 35.2081 37.0 37.0 37.0 37.0 37.0 100-104 35.197500000000005 37.0 37.0 37.0 34.6 37.0 105-109 35.178799999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.1072 37.0 37.0 37.0 34.6 37.0 115-119 35.0834 37.0 37.0 37.0 29.8 37.0 120-124 35.072900000000004 37.0 37.0 37.0 34.6 37.0 125-129 34.9918 37.0 37.0 37.0 27.4 37.0 130-134 35.0119 37.0 37.0 37.0 27.4 37.0 135-139 34.937400000000004 37.0 37.0 37.0 25.0 37.0 140-144 34.8199 37.0 37.0 37.0 25.0 37.0 145-149 34.788500000000006 37.0 37.0 37.0 25.0 37.0 150-151 34.6125 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 6.0 19 8.0 20 14.0 21 16.0 22 30.0 23 34.0 24 34.0 25 35.0 26 18.0 27 20.0 28 21.0 29 23.0 30 47.0 31 44.0 32 69.0 33 133.0 34 143.0 35 311.0 36 2644.0 37 348.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 54.775 9.725 15.425 20.075000000000003 2 19.00702106318957 9.854563691073219 39.81945837512538 31.318956870611835 3 16.075 17.7 40.25 25.974999999999998 4 17.875 23.05 35.275 23.799999999999997 5 21.099999999999998 29.599999999999998 32.5 16.8 6 18.224999999999998 30.675 32.45 18.65 7 13.175 25.8 46.875 14.149999999999999 8 13.425 23.625 41.349999999999994 21.6 9 15.75 20.474999999999998 41.775 22.0 10-14 18.459999999999997 28.48 32.23 20.830000000000002 15-19 19.05 28.76 30.59 21.6 20-24 18.995 28.970000000000002 29.935000000000002 22.1 25-29 19.235 28.42 30.514999999999997 21.83 30-34 18.725 28.754999999999995 30.39 22.13 35-39 19.395 29.445 28.744999999999997 22.415 40-44 18.455 29.45 29.15 22.945 45-49 19.314999999999998 30.0 28.134999999999998 22.55 50-54 18.834999999999997 30.365 28.22 22.58 55-59 19.125 29.315 28.515 23.044999999999998 60-64 19.49 30.54 27.439999999999998 22.53 65-69 19.595000000000002 30.535 27.900000000000002 21.97 70-74 20.09 30.915 26.625 22.37 75-79 20.53 29.86 26.47 23.14 80-84 20.65 31.0 26.47 21.88 85-89 19.86 30.79 26.900000000000002 22.45 90-94 20.79 29.99 26.69 22.53 95-99 20.87 30.615 25.895000000000003 22.62 100-104 20.45 30.37 26.224999999999998 22.955000000000002 105-109 20.595 30.175 26.865 22.365 110-114 20.22 29.815 26.865 23.1 115-119 21.485000000000003 29.909999999999997 26.445 22.16 120-124 20.73 30.044999999999998 26.615 22.61 125-129 20.615 29.915000000000003 26.11 23.36 130-134 21.375 30.03 26.169999999999998 22.425 135-139 21.365000000000002 29.785 26.02 22.830000000000002 140-144 21.32 30.055 25.69 22.935 145-149 21.310000000000002 29.525000000000002 25.835 23.330000000000002 150-151 22.162499999999998 29.075 25.3 23.4625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 13.0 1 10.5 2 6.5 3 6.0 4 8.5 5 9.5 6 11.0 7 10.0 8 6.0 9 5.5 10 8.0 11 10.5 12 7.5 13 7.5 14 8.0 15 6.0 16 5.5 17 4.5 18 5.5 19 6.0 20 8.0 21 13.0 22 16.0 23 13.0 24 16.5 25 21.0 26 23.0 27 26.0 28 34.0 29 38.5 30 37.0 31 49.5 32 68.0 33 81.5 34 84.0 35 86.0 36 106.5 37 124.5 38 127.5 39 132.0 40 146.5 41 162.0 42 166.0 43 181.5 44 187.0 45 199.0 46 209.0 47 204.5 48 206.5 49 185.5 50 167.0 51 146.5 52 111.0 53 90.5 54 81.0 55 68.5 56 54.5 57 41.5 58 29.5 59 22.0 60 14.0 61 6.5 62 6.0 63 4.0 64 5.5 65 14.0 66 17.5 67 11.0 68 4.5 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.775 #Duplication Level Percentage of deduplicated Percentage of total 1 84.95922681969193 70.325 2 11.869525823014195 19.650000000000002 3 2.476593174267593 6.15 4 0.3926306251887647 1.3 5 0.0906070673512534 0.375 6 0.06040471156750227 0.3 7 0.030202355783751134 0.17500000000000002 8 0.06040471156750227 0.4 9 0.0 0.0 >10 0.06040471156750227 1.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCATACTATCTCGTAT 28 0.7000000000000001 TruSeq Adapter, Index 6 (97% over 37bp) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 25 0.625 No Hit GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCATACTATCTCGTTT 8 0.2 TruSeq Adapter, Index 6 (97% over 37bp) GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCATACTATCGCGTAT 8 0.2 TruSeq Adapter, Index 6 (97% over 37bp) GCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGC 7 0.17500000000000002 No Hit CCTGGCCACTTGTTGGCTACAAGATGTGCTAAATCAACGACCCTTTGGCT 6 0.15 No Hit AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 6 0.15 No Hit GTTCTGGTAAGGCAAGAGTTGCTGGTAACTCTTCAAACATTACAATACGA 5 0.125 No Hit AGGCACCATTACATTACAAAACCACGATCATATCAGAATGCAGTGATGCC 5 0.125 No Hit GCTACAGTATGGTACAACATTGATTGGTTTTCTTCGCCTGCTTGTAGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5874999999999999 0.0 0.0 0.0 0.0 92-93 0.7124999999999999 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 1.1125 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.475 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 1.8375 0.0 0.0 0.0 0.0 108-109 2.05 0.0 0.0 0.0 0.0 110-111 2.2249999999999996 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.7249999999999996 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.075 0.0 0.0 0.0 0.0 120-121 3.2249999999999996 0.0 0.0 0.0 0.0 122-123 3.5125 0.0 0.0 0.0 0.0 124-125 4.0 0.0 0.0 0.0 0.0 126-127 4.2625 0.0 0.0 0.0 0.0 128-129 4.6375 0.0 0.0 0.0 0.0 130-131 5.0375 0.0 0.0 0.0 0.0 132-133 5.425000000000001 0.0 0.0 0.0 0.0 134-135 5.7 0.0 0.0 0.0 0.0 136-137 6.1875 0.0 0.0 0.0 0.0 138-139 6.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCACA 35 0.0033124194 62.14286 9 GAAGAGC 40 0.005621335 54.375 6 TCGGAAG 40 0.005621335 54.375 3 CGGAAGA 40 0.005621335 54.375 4 AGAGCAC 40 0.005621335 54.375 8 GGAAGAG 40 0.005621335 54.375 5 AAAAAAA 170 7.2465907E-4 8.529411 70-74 >>END_MODULE SRR12671404 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671404_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7015 37.0 37.0 37.0 37.0 37.0 2 34.843 37.0 37.0 37.0 25.0 37.0 3 35.0745 37.0 37.0 37.0 25.0 37.0 4 35.4295 37.0 37.0 37.0 37.0 37.0 5 35.4235 37.0 37.0 37.0 37.0 37.0 6 35.305 37.0 37.0 37.0 37.0 37.0 7 35.3445 37.0 37.0 37.0 37.0 37.0 8 35.438 37.0 37.0 37.0 37.0 37.0 9 35.3935 37.0 37.0 37.0 37.0 37.0 10-14 35.38590000000001 37.0 37.0 37.0 37.0 37.0 15-19 35.2578 37.0 37.0 37.0 34.6 37.0 20-24 35.1514 37.0 37.0 37.0 27.4 37.0 25-29 35.045199999999994 37.0 37.0 37.0 25.0 37.0 30-34 34.9265 37.0 37.0 37.0 25.0 37.0 35-39 34.8714 37.0 37.0 37.0 25.0 37.0 40-44 34.849000000000004 37.0 37.0 37.0 25.0 37.0 45-49 34.834500000000006 37.0 37.0 37.0 25.0 37.0 50-54 34.738099999999996 37.0 37.0 37.0 25.0 37.0 55-59 34.7429 37.0 37.0 37.0 25.0 37.0 60-64 34.698 37.0 37.0 37.0 25.0 37.0 65-69 34.7554 37.0 37.0 37.0 25.0 37.0 70-74 34.587700000000005 37.0 37.0 37.0 25.0 37.0 75-79 34.5792 37.0 37.0 37.0 25.0 37.0 80-84 34.545300000000005 37.0 37.0 37.0 25.0 37.0 85-89 34.7615 37.0 37.0 37.0 25.0 37.0 90-94 34.7066 37.0 37.0 37.0 25.0 37.0 95-99 34.714600000000004 37.0 37.0 37.0 25.0 37.0 100-104 34.6974 37.0 37.0 37.0 25.0 37.0 105-109 34.688 37.0 37.0 37.0 25.0 37.0 110-114 34.520799999999994 37.0 37.0 37.0 25.0 37.0 115-119 34.707100000000004 37.0 37.0 37.0 25.0 37.0 120-124 34.625 37.0 37.0 37.0 25.0 37.0 125-129 34.5383 37.0 37.0 37.0 25.0 37.0 130-134 34.3949 37.0 37.0 37.0 25.0 37.0 135-139 34.259499999999996 37.0 37.0 37.0 25.0 37.0 140-144 34.375800000000005 37.0 37.0 37.0 25.0 37.0 145-149 34.1765 37.0 37.0 37.0 25.0 37.0 150-151 34.049 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 6.0 13 11.0 14 19.0 15 17.0 16 9.0 17 9.0 18 12.0 19 9.0 20 4.0 21 12.0 22 15.0 23 25.0 24 22.0 25 20.0 26 31.0 27 27.0 28 26.0 29 40.0 30 42.0 31 71.0 32 87.0 33 162.0 34 362.0 35 798.0 36 2085.0 37 79.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 62.1 20.3 4.925 12.675 2 32.225 17.75 29.925 20.1 3 25.15 22.55 35.075 17.224999999999998 4 28.575 31.0 23.474999999999998 16.950000000000003 5 27.425 35.825 20.599999999999998 16.150000000000002 6 24.099999999999998 37.475 21.425 17.0 7 23.525 24.125 34.525 17.825 8 21.975 23.875 29.15 25.0 9 25.525 20.775 28.549999999999997 25.15 10-14 27.500000000000004 26.669999999999998 25.69 20.14 15-19 27.084999999999997 26.889999999999997 26.540000000000003 19.485 20-24 26.1 27.37 26.63 19.900000000000002 25-29 26.825 26.93 26.68 19.564999999999998 30-34 26.245 27.07 26.634999999999998 20.05 35-39 25.77 27.245 27.38 19.605 40-44 26.125 26.745 27.215 19.915 45-49 24.81 27.169999999999998 28.37 19.650000000000002 50-54 25.124999999999996 26.72 28.315 19.84 55-59 25.165 26.85 27.810000000000002 20.175 60-64 26.68 26.525 27.145000000000003 19.650000000000002 65-69 26.1 26.845000000000002 27.785 19.27 70-74 25.605 27.229999999999997 27.265 19.900000000000002 75-79 25.365 27.005000000000003 27.71 19.919999999999998 80-84 25.845000000000002 26.790000000000003 27.305 20.06 85-89 26.19 26.784999999999997 26.840000000000003 20.185 90-94 25.224999999999998 26.875 27.845 20.055 95-99 25.41 27.87 27.045 19.675 100-104 25.869999999999997 27.810000000000002 26.735 19.585 105-109 26.14 27.084999999999997 27.400000000000002 19.375 110-114 25.825 27.534999999999997 26.865 19.775000000000002 115-119 26.369999999999997 27.455000000000002 27.11 19.064999999999998 120-124 26.474999999999998 27.200000000000003 27.155 19.17 125-129 26.345000000000002 27.284999999999997 27.35 19.02 130-134 26.44 26.825 27.21 19.525000000000002 135-139 26.825 26.69 27.29 19.195 140-144 27.565 26.47 27.16 18.805 145-149 27.32773277327733 27.927792779277926 26.43764376437644 18.306830683068306 150-151 27.787499999999998 27.825 26.137500000000003 18.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 3.0 3 2.5 4 1.5 5 1.0 6 0.0 7 0.0 8 0.5 9 1.0 10 1.0 11 1.0 12 1.5 13 1.0 14 0.5 15 2.5 16 2.0 17 0.0 18 1.0 19 2.0 20 1.5 21 1.0 22 2.0 23 3.5 24 5.0 25 5.0 26 4.0 27 4.0 28 7.5 29 12.5 30 13.0 31 15.0 32 29.5 33 47.0 34 53.0 35 61.0 36 77.5 37 91.5 38 108.0 39 136.5 40 166.5 41 181.5 42 209.5 43 236.0 44 252.5 45 256.5 46 240.0 47 230.0 48 228.0 49 216.5 50 180.5 51 140.0 52 112.0 53 110.0 54 106.5 55 77.5 56 60.0 57 49.5 58 30.0 59 22.0 60 18.0 61 13.5 62 9.0 63 6.5 64 4.0 65 2.0 66 5.5 67 4.0 68 0.5 69 0.5 70 1.5 71 1.5 72 1.0 73 1.5 74 2.5 75 2.5 76 2.0 77 1.5 78 1.0 79 1.5 80 2.0 81 1.5 82 1.5 83 2.5 84 2.5 85 4.0 86 7.5 87 6.0 88 2.5 89 4.5 90 6.0 91 4.5 92 6.5 93 6.0 94 3.0 95 3.5 96 5.0 97 5.5 98 5.5 99 6.5 100 15.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.1 #Duplication Level Percentage of deduplicated Percentage of total 1 86.69212690951822 73.775 2 10.957696827262046 18.65 3 1.8213866039952997 4.65 4 0.35252643948296125 1.2 5 0.05875440658049354 0.25 6 0.05875440658049354 0.3 7 0.0 0.0 8 0.0 0.0 9 0.02937720329024677 0.22499999999999998 >10 0.02937720329024677 0.95 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 38 0.95 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 9 0.22499999999999998 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit CATAGTCCCAACAAGCACTGGTGCAGCCAAAGCTGTATCTCTTGTGCTGC 6 0.15 No Hit GAGCAATCCTAGGTTGCAGTTCACTAGTTGCAGGGATGTGCTTGGTGTTT 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0125 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.037500000000000006 0.0 0.0 0.025 0.0 64-65 0.05 0.0 0.0 0.025 0.0 66-67 0.05 0.0 0.0 0.025 0.0 68-69 0.05 0.0 0.0 0.025 0.0 70-71 0.05 0.0 0.0 0.025 0.0 72-73 0.05 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.075 0.0 0.0 0.025 0.0 78-79 0.1 0.0 0.0 0.025 0.0 80-81 0.1125 0.0 0.0 0.025 0.0 82-83 0.1375 0.0 0.0 0.025 0.0 84-85 0.1875 0.0 0.0 0.025 0.0 86-87 0.275 0.0 0.0 0.025 0.0 88-89 0.5 0.0 0.0 0.025 0.0 90-91 0.5874999999999999 0.0 0.0 0.025 0.0 92-93 0.7124999999999999 0.0 0.0 0.025 0.0 94-95 0.8 0.0 0.0 0.025 0.0 96-97 1.1 0.0 0.0 0.025 0.0 98-99 1.2875 0.0 0.0 0.025 0.0 100-101 1.3875 0.0 0.0 0.025 0.0 102-103 1.45 0.0 0.0 0.025 0.0 104-105 1.5750000000000002 0.0 0.0 0.025 0.0 106-107 1.8125 0.0 0.0 0.025 0.0 108-109 2.0250000000000004 0.0 0.0 0.025 0.0 110-111 2.1875 0.0 0.0 0.025 0.0 112-113 2.4375 0.0 0.0 0.025 0.0 114-115 2.6500000000000004 0.0 0.0 0.025 0.0 116-117 2.7750000000000004 0.0 0.0 0.025 0.0 118-119 2.9749999999999996 0.0 0.0 0.025 0.0 120-121 3.125 0.0 0.0 0.025 0.0 122-123 3.4 0.0 0.0 0.025 0.0 124-125 3.875 0.0 0.0 0.025 0.0 126-127 4.1375 0.0 0.0 0.025 0.0 128-129 4.525 0.0 0.0 0.025 0.0 130-131 4.9375 0.0 0.0 0.025 0.0 132-133 5.324999999999999 0.0 0.0 0.025 0.0 134-135 5.6 0.0 0.0 0.025 0.0 136-137 6.0625 0.0 0.0 0.025 0.0 138-139 6.4375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCCAGT 10 0.006830828 145.0 6 >>END_MODULE Read 987570 spots for SRR12671404.sra Written 987570 spots for SRR12671404.sra Read 987570 spots for SRR12671404.sra Written 987570 spots for SRR12671404.sra Read 987570 spots for SRR12671404.sra Written 987570 spots for SRR12671404.sra Read 987570 spots for SRR12671404.sra Written 987570 spots for SRR12671404.sra Read 987570 spots for SRR12671404.sra Written 987570 spots for SRR12671404.sra Read 987570 spots for SRR12671404.sra Written 987570 spots for SRR12671404.sra Read 987570 spots for SRR12671404.sra Written 987570 spots for SRR12671404.sra Read 987570 spots for SRR12671404.sra Written 987570 spots for SRR12671404.sra Read 987570 spots for SRR12671404.sra Written 987570 spots for SRR12671404.sra Read 987570 spots for SRR12671404.sra Written 987570 spots for SRR12671404.sra Read 987570 spots for SRR12671404.sra Written 987570 spots for SRR12671404.sra Read 987570 spots for SRR12671404.sra Written 987570 spots for SRR12671404.sra Read 987570 spots for SRR12671404.sra Written 987570 spots for SRR12671404.sra Read 987570 spots for SRR12671404.sra Written 987570 spots for SRR12671404.sra Read 987572 spots for SRR12671404.sra Written 987572 spots for SRR12671404.sra Read 987570 spots for SRR12671404.sra Written 987570 spots for SRR12671404.sra Read 987570 spots for SRR12671404.sra Written 987570 spots for SRR12671404.sra Read 987570 spots for SRR12671404.sra Written 987570 spots for SRR12671404.sra Read 987570 spots for SRR12671404.sra Written 987570 spots for SRR12671404.sra Read 987570 spots for SRR12671404.sra Written 987570 spots for SRR12671404.sra SRR ids: ['SRR12671404.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kjqtycn7 SRR12671404.sra spots: 19751402 blocks: [[1, 987570], [987571, 1975140], [1975141, 2962710], [2962711, 3950280], [3950281, 4937850], [4937851, 5925420], [5925421, 6912990], [6912991, 7900560], [7900561, 8888130], [8888131, 9875700], [9875701, 10863270], [10863271, 11850840], [11850841, 12838410], [12838411, 13825980], [13825981, 14813550], [14813551, 15801120], [15801121, 16788690], [16788691, 17776260], [17776261, 18763830], [18763831, 19751402]] SRR12671404 file size 6690690 SRR12671404 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671404 SRR12671404_1.fastq SRR12671404_2.fastq Input file: SRR12671404_1.fastq Paired file: SRR12671404_2.fastq trimmed: SRR12671404-trimmed-pair1.fastq, SRR12671404-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:03:24 2025 >> started Tue Feb 11 22:04:03 2025 >> done (38.970s) 19751402 read pairs processed; of these: 263 ( 0.00%) short read pairs filtered out after trimming by size control 210999 ( 1.07%) empty read pairs filtered out after trimming by size control 19540140 (98.93%) read pairs available; of these: 1678382 ( 8.59%) trimmed read pairs available after processing 17861758 (91.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 29 0.00% 19 34 0.00% 20 52 0.00% 21 69 0.00% 22 69 0.00% 23 103 0.00% 24 88 0.00% 25 90 0.00% 26 126 0.00% 27 109 0.00% 28 118 0.00% 29 118 0.00% 30 137 0.00% 31 117 0.00% 32 84 0.00% 33 88 0.00% 34 95 0.00% 35 97 0.00% 36 96 0.00% 37 105 0.00% 38 72 0.00% 39 115 0.00% 40 94 0.00% 41 86 0.00% 42 133 0.00% 43 85 0.00% 44 104 0.00% 45 127 0.00% 46 127 0.00% 47 130 0.00% 48 164 0.00% 49 143 0.00% 50 200 0.00% 51 242 0.00% 52 224 0.00% 53 254 0.00% 54 281 0.00% 55 287 0.00% 56 373 0.00% 57 401 0.00% 58 501 0.00% 59 539 0.00% 60 603 0.00% 61 715 0.00% 62 778 0.00% 63 921 0.00% 64 918 0.00% 65 1064 0.01% 66 1204 0.01% 67 1283 0.01% 68 1462 0.01% 69 1693 0.01% 70 1940 0.01% 71 2078 0.01% 72 2450 0.01% 73 2678 0.01% 74 2899 0.01% 75 3100 0.02% 76 3389 0.02% 77 3684 0.02% 78 3802 0.02% 79 4292 0.02% 80 4551 0.02% 81 5269 0.03% 82 5505 0.03% 83 5800 0.03% 84 6622 0.03% 85 6830 0.03% 86 6939 0.04% 87 7249 0.04% 88 7511 0.04% 89 8153 0.04% 90 8425 0.04% 91 9043 0.05% 92 9554 0.05% 93 10322 0.05% 94 10736 0.05% 95 11142 0.06% 96 11581 0.06% 97 11956 0.06% 98 12033 0.06% 99 12824 0.07% 100 13397 0.07% 101 13433 0.07% 102 14128 0.07% 103 14789 0.08% 104 15187 0.08% 105 16071 0.08% 106 16276 0.08% 107 16746 0.09% 108 17356 0.09% 109 17921 0.09% 110 17696 0.09% 111 18465 0.09% 112 19344 0.10% 113 20358 0.10% 114 20909 0.11% 115 21463 0.11% 116 22193 0.11% 117 23113 0.12% 118 22841 0.12% 119 23706 0.12% 120 24596 0.13% 121 25142 0.13% 122 25943 0.13% 123 27082 0.14% 124 27929 0.14% 125 28803 0.15% 126 29992 0.15% 127 29911 0.15% 128 30256 0.15% 129 32015 0.16% 130 31313 0.16% 131 31774 0.16% 132 32591 0.17% 133 34270 0.18% 134 34775 0.18% 135 35938 0.18% 136 34834 0.18% 137 36060 0.18% 138 37232 0.19% 139 38026 0.19% 140 37596 0.19% 141 38899 0.20% 142 38510 0.20% 143 40736 0.21% 144 42166 0.22% 145 42173 0.22% 146 42495 0.22% 147 43276 0.22% 148 45006 0.23% 149 45491 0.23% 150 48656 0.25% 151 17861758 91.41% 19540140 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=17 prefix-density=0.89 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=31 fanout-score=19.73 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=4.4 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCGGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=27 prefix-density=0.64 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=9.32 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.6 sequence=ACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCA SRR12671404 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:04:55 Started mapping on | Feb 11 22:04:55 Finished on | Feb 11 22:09:05 Mapping speed, Million of reads per hour | 281.38 Number of input reads | 19540140 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16432127 Uniquely mapped reads % | 84.09% Average mapped length | 294.07 Number of splices: Total | 14427040 Number of splices: Annotated (sjdb) | 14166420 Number of splices: GT/AG | 14078944 Number of splices: GC/AG | 288643 Number of splices: AT/AC | 9329 Number of splices: Non-canonical | 50124 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.93 Insertion rate per base | 0.03% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 405380 % of reads mapped to multiple loci | 2.07% Number of reads mapped to too many loci | 62712 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.83% % of reads unmapped: other | 0.68% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2702633 2702633 2702633 N_multimapping 405380 405380 405380 N_noFeature 476539 15989063 594725 N_ambiguous 428441 1527 103017 UnstrandedReadsAssigned:15527147 PositiveStrandReadsAssigned:441537 NegativeStrandReadsAssigned:15734385 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671404 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671404-trimmed-pair1.fastq SRR12671404-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,540,140 reads, 16,209,366 reads pseudoaligned [quant] estimated average fragment length: 256.053 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52401 SRR12671404.ke.tsv 34699 SRR12671404.se.tsv 87100 total ==> SRR12671404.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.95 431 11.3881 Potri.005G024800.1.v4.1 1035 779.947 363 21.6798 Potri.004G059700.1.v4.1 961 705.947 7 0.461891 Potri.007G009000.2.v4.1 1416 1160.95 0 0 Potri.003G141000.2.v4.1 2943 2687.95 801.114 13.8831 Potri.016G087400.1.v4.1 270 81.6425 837.29 477.72 Potri.015G069301.1.v4.1 564 317.749 0 0 Potri.010G195200.1.v4.1 1773 1517.95 103 3.16078 Potri.012G127500.1.v4.1 977 721.947 80 5.16176 ==> SRR12671404.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 109 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 347 Potri.001G212900.v4.1 39 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12671404 completed mapping pipeline successfully