Starting /dee2/code/volunteer_pipeline.sh SRR12671405 current disk space = 3052298469376 free memory = 1464761768 SRR12671405 SRAfilesize b8f4665fd1fea2ab2e31a803fa5aa14e SRR12671405.sra SRR12671405.sra file validated SRR12671405 is paired end SRR12671405 is conventional basespace SRR12671405 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671405_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5525 37.0 37.0 37.0 37.0 37.0 2 36.35775 37.0 37.0 37.0 37.0 37.0 3 36.4795 37.0 37.0 37.0 37.0 37.0 4 36.537 37.0 37.0 37.0 37.0 37.0 5 36.557 37.0 37.0 37.0 37.0 37.0 6 36.544 37.0 37.0 37.0 37.0 37.0 7 36.491 37.0 37.0 37.0 37.0 37.0 8 36.541 37.0 37.0 37.0 37.0 37.0 9 36.5775 37.0 37.0 37.0 37.0 37.0 10-14 36.5945 37.0 37.0 37.0 37.0 37.0 15-19 36.5361 37.0 37.0 37.0 37.0 37.0 20-24 36.5187 37.0 37.0 37.0 37.0 37.0 25-29 36.4704 37.0 37.0 37.0 37.0 37.0 30-34 36.446 37.0 37.0 37.0 37.0 37.0 35-39 36.448899999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.401300000000006 37.0 37.0 37.0 37.0 37.0 45-49 36.3489 37.0 37.0 37.0 37.0 37.0 50-54 36.3587 37.0 37.0 37.0 37.0 37.0 55-59 36.3078 37.0 37.0 37.0 37.0 37.0 60-64 36.28529999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.2277 37.0 37.0 37.0 37.0 37.0 70-74 36.204699999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.3089 37.0 37.0 37.0 37.0 37.0 80-84 36.2756 37.0 37.0 37.0 37.0 37.0 85-89 36.152100000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.169 37.0 37.0 37.0 37.0 37.0 95-99 36.081 37.0 37.0 37.0 37.0 37.0 100-104 36.1394 37.0 37.0 37.0 37.0 37.0 105-109 36.085899999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.0014 37.0 37.0 37.0 37.0 37.0 115-119 36.082 37.0 37.0 37.0 37.0 37.0 120-124 35.9771 37.0 37.0 37.0 37.0 37.0 125-129 36.0 37.0 37.0 37.0 37.0 37.0 130-134 35.8421 37.0 37.0 37.0 37.0 37.0 135-139 35.8016 37.0 37.0 37.0 37.0 37.0 140-144 35.672000000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.5243 37.0 37.0 37.0 37.0 37.0 150-151 35.366249999999994 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 1.0 24 2.0 25 5.0 26 2.0 27 11.0 28 13.0 29 20.0 30 34.0 31 44.0 32 76.0 33 79.0 34 120.0 35 282.0 36 2908.0 37 400.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.35 8.625 9.0 42.025 2 20.36619011788312 13.092550790067719 34.31151241534989 32.22974667669927 3 18.925 18.925 24.55 37.6 4 24.349999999999998 27.175 22.225 26.25 5 24.125 30.85 23.200000000000003 21.825 6 20.75 35.425000000000004 23.125 20.7 7 14.249999999999998 23.849999999999998 43.3 18.6 8 17.150000000000002 26.924999999999997 31.65 24.275 9 17.424999999999997 23.5 33.75 25.324999999999996 10-14 20.294999999999998 29.84 26.815 23.05 15-19 20.695 28.060000000000002 27.839999999999996 23.405 20-24 20.294999999999998 27.650000000000002 28.46 23.595 25-29 19.975 28.134999999999998 27.810000000000002 24.08 30-34 19.64 28.599999999999998 27.99 23.77 35-39 20.155 28.535 28.000000000000004 23.31 40-44 20.365 28.74 27.315 23.580000000000002 45-49 20.59 28.65 27.48 23.28 50-54 20.69 28.144999999999996 27.61 23.555 55-59 19.455 28.83 27.925 23.79 60-64 20.200000000000003 28.694999999999997 27.075 24.03 65-69 19.865 28.525 27.860000000000003 23.75 70-74 20.36 27.889999999999997 27.715 24.035 75-79 20.315 28.515 27.944999999999997 23.225 80-84 20.69 28.77 26.82 23.72 85-89 20.43 28.935 26.950000000000003 23.685000000000002 90-94 21.075 28.549999999999997 27.555000000000003 22.82 95-99 21.17 28.075 27.555000000000003 23.200000000000003 100-104 21.044999999999998 28.525 27.150000000000002 23.28 105-109 21.29 28.689999999999998 27.084999999999997 22.935 110-114 21.18 27.57 27.089999999999996 24.16 115-119 21.42 28.58 26.755000000000003 23.244999999999997 120-124 20.855 28.705000000000002 26.435 24.005000000000003 125-129 21.45 27.415 26.965 24.169999999999998 130-134 21.185000000000002 27.994999999999997 26.619999999999997 24.2 135-139 21.81 27.87 26.91 23.41 140-144 22.095000000000002 28.249999999999996 25.855 23.799999999999997 145-149 21.89 27.615000000000002 26.11 24.385 150-151 20.974999999999998 28.849999999999998 26.5625 23.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 2.0 7 2.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 3.0 24 4.0 25 2.5 26 2.5 27 5.0 28 4.5 29 12.0 30 22.5 31 31.0 32 38.0 33 41.5 34 53.5 35 64.0 36 75.0 37 96.0 38 124.0 39 164.5 40 187.0 41 194.5 42 221.0 43 250.5 44 260.0 45 268.5 46 271.5 47 249.5 48 223.5 49 217.0 50 188.0 51 141.5 52 123.5 53 110.0 54 81.5 55 58.0 56 46.0 57 33.5 58 38.5 59 33.0 60 14.5 61 9.0 62 8.5 63 5.5 64 2.5 65 3.0 66 2.5 67 2.0 68 2.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.475 #Duplication Level Percentage of deduplicated Percentage of total 1 84.5163222521713 70.55 2 12.039532794249777 20.1 3 2.8751123090745736 7.199999999999999 4 0.41928721174004197 1.4000000000000001 5 0.08984725965858043 0.375 6 0.0 0.0 7 0.02994908655286014 0.17500000000000002 8 0.02994908655286014 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTAGCTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGTGAGCTG 8 0.2 No Hit CCAGTAGGGAAGCCATCAAGCACAACATCATGAAGGTACATCTCTTTATG 7 0.17500000000000002 No Hit CCTCCGTCCAGCTGCATCAGTGCTGTTATCAGCTGGTTTGGATCCAGCAA 5 0.125 No Hit GGCATATTCATCCTAGCAGTTGTAGGCCTATTTGGAAAGTATCCTGCATA 5 0.125 No Hit GTGCAGAGGGGGCCGGTCTGTTTGGCCGAGAGTGAGAGCAACCAAAGGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0375 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.30000000000000004 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.5249999999999999 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.6875 0.0 0.0 0.0 0.0 86-87 0.7749999999999999 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 90-91 1.0625 0.0 0.0 0.0 0.0 92-93 1.2374999999999998 0.0 0.0 0.0 0.0 94-95 1.475 0.0 0.0 0.0 0.0 96-97 1.775 0.0 0.0 0.0 0.0 98-99 2.1500000000000004 0.0 0.0 0.0 0.0 100-101 2.5125 0.0 0.0 0.0 0.0 102-103 2.875 0.0 0.0 0.0 0.0 104-105 3.1500000000000004 0.0 0.0 0.0 0.0 106-107 3.55 0.0 0.0 0.0 0.0 108-109 3.975 0.0 0.0 0.0 0.0 110-111 4.637499999999999 0.0 0.0 0.0 0.0 112-113 5.012499999999999 0.0 0.0 0.0 0.0 114-115 5.375 0.0 0.0 0.0 0.0 116-117 5.7125 0.0 0.0 0.0 0.0 118-119 6.2875 0.0 0.0 0.0 0.0 120-121 7.0625 0.0 0.0 0.0 0.0 122-123 7.7375 0.0 0.0 0.0 0.0 124-125 8.5 0.0 0.0 0.0 0.0 126-127 9.1 0.0 0.0 0.0 0.0 128-129 9.925 0.0 0.0 0.0 0.0 130-131 10.75 0.0 0.0 0.0 0.0 132-133 11.4875 0.0 0.0 0.0 0.0 134-135 12.1 0.0 0.0 0.0 0.0 136-137 13.0125 0.0 0.0 0.0 0.0 138-139 13.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCAGAT 10 0.006830828 145.0 7 GGGGGGG 35 0.0035366106 20.714287 115-119 AGAGCAC 60 0.004491891 14.500001 140-144 >>END_MODULE SRR12671405 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671405_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3145 37.0 37.0 37.0 37.0 37.0 2 35.99 37.0 37.0 37.0 37.0 37.0 3 36.099 37.0 37.0 37.0 37.0 37.0 4 36.2025 37.0 37.0 37.0 37.0 37.0 5 36.459 37.0 37.0 37.0 37.0 37.0 6 36.248 37.0 37.0 37.0 37.0 37.0 7 36.227 37.0 37.0 37.0 37.0 37.0 8 36.2585 37.0 37.0 37.0 37.0 37.0 9 36.3305 37.0 37.0 37.0 37.0 37.0 10-14 36.2855 37.0 37.0 37.0 37.0 37.0 15-19 36.23729999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.172399999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.181799999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.1122 37.0 37.0 37.0 37.0 37.0 35-39 36.068799999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.0372 37.0 37.0 37.0 37.0 37.0 45-49 36.0873 37.0 37.0 37.0 37.0 37.0 50-54 36.0094 37.0 37.0 37.0 37.0 37.0 55-59 35.9927 37.0 37.0 37.0 37.0 37.0 60-64 36.013600000000004 37.0 37.0 37.0 37.0 37.0 65-69 35.9756 37.0 37.0 37.0 37.0 37.0 70-74 35.976 37.0 37.0 37.0 37.0 37.0 75-79 35.9251 37.0 37.0 37.0 37.0 37.0 80-84 35.8795 37.0 37.0 37.0 37.0 37.0 85-89 35.901300000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.8809 37.0 37.0 37.0 37.0 37.0 95-99 35.773 37.0 37.0 37.0 37.0 37.0 100-104 35.8741 37.0 37.0 37.0 37.0 37.0 105-109 35.7947 37.0 37.0 37.0 37.0 37.0 110-114 35.7271 37.0 37.0 37.0 37.0 37.0 115-119 35.7051 37.0 37.0 37.0 37.0 37.0 120-124 35.6927 37.0 37.0 37.0 37.0 37.0 125-129 35.6026 37.0 37.0 37.0 37.0 37.0 130-134 35.4673 37.0 37.0 37.0 37.0 37.0 135-139 35.321999999999996 37.0 37.0 37.0 34.6 37.0 140-144 35.2151 37.0 37.0 37.0 34.6 37.0 145-149 35.0572 37.0 37.0 37.0 27.4 37.0 150-151 34.84625 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 2.0 15 4.0 16 2.0 17 0.0 18 2.0 19 3.0 20 5.0 21 3.0 22 3.0 23 8.0 24 6.0 25 6.0 26 6.0 27 16.0 28 20.0 29 28.0 30 20.0 31 50.0 32 67.0 33 90.0 34 205.0 35 440.0 36 2621.0 37 388.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.975 19.675 13.525 26.825 2 27.450000000000003 25.474999999999998 29.975 17.1 3 23.35 27.6 30.025000000000002 19.025 4 25.874999999999996 33.1 22.825 18.2 5 26.150000000000002 35.8 21.6 16.45 6 21.5 37.525 23.1 17.875 7 18.975 21.275 39.775 19.975 8 20.95 25.6 28.375 25.074999999999996 9 23.075000000000003 26.375 28.000000000000004 22.55 10-14 23.77 28.42 26.465 21.345 15-19 23.39 28.08 27.605 20.925 20-24 22.720000000000002 28.67 27.950000000000003 20.66 25-29 23.05 28.24 28.27 20.44 30-34 22.685 28.439999999999998 28.575 20.3 35-39 23.23 27.500000000000004 28.225 21.044999999999998 40-44 23.995 27.83 27.785 20.39 45-49 23.36 28.384999999999998 27.12 21.135 50-54 22.605 27.450000000000003 28.18 21.765 55-59 23.785 28.095 27.705000000000002 20.415 60-64 23.86 28.205000000000002 27.595 20.34 65-69 23.215 27.88 28.38 20.525 70-74 23.5 27.544999999999998 27.925 21.029999999999998 75-79 23.23 27.82 27.61 21.34 80-84 23.635 27.875 27.665 20.825 85-89 23.724999999999998 27.310000000000002 28.199999999999996 20.765 90-94 24.065 27.334999999999997 27.855 20.745 95-99 24.68 27.405 27.47 20.445 100-104 24.565 27.85 26.68 20.905 105-109 24.65 27.825 27.365000000000002 20.16 110-114 23.79 28.24 27.32 20.65 115-119 24.935 27.96 26.69 20.415 120-124 25.224999999999998 28.235 26.810000000000002 19.73 125-129 25.855 27.439999999999998 26.56 20.145 130-134 26.095000000000002 27.495000000000005 27.075 19.335 135-139 26.279999999999998 27.685 26.205000000000002 19.830000000000002 140-144 26.61 27.0 26.784999999999997 19.605 145-149 26.667666766676668 27.487748774877485 26.542654265426542 19.301930193019302 150-151 26.4125 27.700000000000003 26.4125 19.475 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.5 16 0.5 17 0.5 18 2.0 19 4.5 20 3.5 21 1.0 22 0.5 23 2.0 24 3.0 25 4.5 26 7.0 27 6.5 28 10.5 29 13.0 30 18.5 31 31.5 32 31.5 33 33.5 34 44.0 35 59.0 36 80.5 37 107.5 38 133.0 39 159.0 40 183.5 41 222.5 42 260.5 43 274.5 44 269.5 45 253.5 46 250.0 47 230.5 48 213.5 49 202.0 50 161.5 51 138.0 52 126.0 53 86.5 54 74.0 55 70.0 56 52.0 57 41.0 58 32.0 59 24.0 60 14.0 61 10.0 62 7.5 63 5.0 64 2.5 65 2.5 66 3.0 67 3.0 68 2.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.5 75 1.5 76 1.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.5 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.5 98 0.5 99 1.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.525 #Duplication Level Percentage of deduplicated Percentage of total 1 84.94462735707872 70.95 2 11.792876384316072 19.7 3 2.5441484585453455 6.375 4 0.38910505836575876 1.3 5 0.20951810835079318 0.8750000000000001 6 0.029931158335827598 0.15 7 0.029931158335827598 0.17500000000000002 8 0.0 0.0 9 0.029931158335827598 0.22499999999999998 >10 0.029931158335827598 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit GGATATCAAGTATGAAGCGGATTTTGTGGTTCCACCAGATTTTGGAGAGA 7 0.17500000000000002 No Hit CAACACATACCTACAAGAACTTCATTTAGAAAATTGTTCTCTTTCGGGTC 6 0.15 No Hit ATTTTGACAACCTCAGAAAAAAATACAAAAAAAAACCTAACCCTAAACCC 5 0.125 No Hit TGGGATTGCGGAGGTTCAGCTACCCATTGAATACAAACTGAGAAATATTG 5 0.125 No Hit GAAGGACAGGAAGGAGATGATGCTGGTGTTGGTGTTCGATTTATTTATGA 5 0.125 No Hit GCTTCCTCCTCTATGATCTCATCGGCAGCCGTTGCCACCGTCAACCGCAC 5 0.125 No Hit ATTGAATTATCTTTATCGCCATTCCAAGTGTAACTTGCAACTAAGTTCAA 5 0.125 No Hit GTCAATCACTACTATGCAGACTCAAGTCTCATTGTGTCTGATAATGAGCT 5 0.125 No Hit GAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0375 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.30000000000000004 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.5249999999999999 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.6875 0.0 0.0 0.0 0.0 86-87 0.7749999999999999 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 90-91 1.0625 0.0 0.0 0.0 0.0 92-93 1.2374999999999998 0.0 0.0 0.0 0.0 94-95 1.475 0.0 0.0 0.0 0.0 96-97 1.775 0.0 0.0 0.0 0.0 98-99 2.175 0.0 0.0 0.0 0.0 100-101 2.5125 0.0 0.0 0.0 0.0 102-103 2.85 0.0 0.0 0.0 0.0 104-105 3.1500000000000004 0.0 0.0 0.0 0.0 106-107 3.55 0.0 0.0 0.0 0.0 108-109 3.975 0.0 0.0 0.0 0.0 110-111 4.637499999999999 0.0 0.0 0.0 0.0 112-113 5.0375 0.0 0.0 0.0 0.0 114-115 5.4 0.0 0.0 0.0 0.0 116-117 5.75 0.0 0.0 0.0 0.0 118-119 6.3625 0.0 0.0 0.0 0.0 120-121 7.1375 0.0 0.0 0.0 0.0 122-123 7.825 0.0 0.0 0.0 0.0 124-125 8.6125 0.0 0.0 0.0 0.0 126-127 9.2375 0.0 0.0 0.0 0.0 128-129 10.075 0.0 0.0 0.0 0.0 130-131 10.925 0.0 0.0 0.0 0.0 132-133 11.6875 0.0 0.0 0.0 0.0 134-135 12.3 0.0 0.0 0.0 0.0 136-137 13.2125 0.0 0.0 0.0 0.0 138-139 14.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTAAT 10 0.006830828 145.0 1 AAGAGCG 65 0.0076375785 13.384615 140-144 AGAGCGT 65 0.0076375785 13.384615 140-144 >>END_MODULE Read 849357 spots for SRR12671405.sra Written 849357 spots for SRR12671405.sra Read 849357 spots for SRR12671405.sra Written 849357 spots for SRR12671405.sra Read 849357 spots for SRR12671405.sra Written 849357 spots for SRR12671405.sra Read 849357 spots for SRR12671405.sra Written 849357 spots for SRR12671405.sra Read 849357 spots for SRR12671405.sra Written 849357 spots for SRR12671405.sra Read 849357 spots for SRR12671405.sra Written 849357 spots for SRR12671405.sra Read 849357 spots for SRR12671405.sra Written 849357 spots for SRR12671405.sra Read 849357 spots for SRR12671405.sra Written 849357 spots for SRR12671405.sra Read 849357 spots for SRR12671405.sra Written 849357 spots for SRR12671405.sra Read 849357 spots for SRR12671405.sra Written 849357 spots for SRR12671405.sra Read 849357 spots for SRR12671405.sra Written 849357 spots for SRR12671405.sra Read 849357 spots for SRR12671405.sra Written 849357 spots for SRR12671405.sra Read 849357 spots for SRR12671405.sra Written 849357 spots for SRR12671405.sra Read 849357 spots for SRR12671405.sra Written 849357 spots for SRR12671405.sra Read 849357 spots for SRR12671405.sra Written 849357 spots for SRR12671405.sra Read 849357 spots for SRR12671405.sra Written 849357 spots for SRR12671405.sra Read 849370 spots for SRR12671405.sra Written 849370 spots for SRR12671405.sra Read 849357 spots for SRR12671405.sra Written 849357 spots for SRR12671405.sra Read 849357 spots for SRR12671405.sra Written 849357 spots for SRR12671405.sra Read 849357 spots for SRR12671405.sra Written 849357 spots for SRR12671405.sra SRR ids: ['SRR12671405.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nhdysunh SRR12671405.sra spots: 16987153 blocks: [[1, 849357], [849358, 1698714], [1698715, 2548071], [2548072, 3397428], [3397429, 4246785], [4246786, 5096142], [5096143, 5945499], [5945500, 6794856], [6794857, 7644213], [7644214, 8493570], [8493571, 9342927], [9342928, 10192284], [10192285, 11041641], [11041642, 11890998], [11890999, 12740355], [12740356, 13589712], [13589713, 14439069], [14439070, 15288426], [15288427, 16137783], [16137784, 16987153]] SRR12671405 file size 5751277 SRR12671405 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671405 SRR12671405_1.fastq SRR12671405_2.fastq Input file: SRR12671405_1.fastq Paired file: SRR12671405_2.fastq trimmed: SRR12671405-trimmed-pair1.fastq, SRR12671405-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:23:24 2025 >> started Tue Feb 11 22:23:52 2025 >> done (27.977s) 16987153 read pairs processed; of these: 65 ( 0.00%) short read pairs filtered out after trimming by size control 16408 ( 0.10%) empty read pairs filtered out after trimming by size control 16970680 (99.90%) read pairs available; of these: 3026683 (17.83%) trimmed read pairs available after processing 13943997 (82.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 5 0.00% 20 8 0.00% 21 6 0.00% 22 10 0.00% 23 5 0.00% 24 7 0.00% 25 8 0.00% 26 8 0.00% 27 4 0.00% 28 15 0.00% 29 8 0.00% 30 12 0.00% 31 7 0.00% 32 15 0.00% 33 12 0.00% 34 15 0.00% 35 18 0.00% 36 19 0.00% 37 24 0.00% 38 39 0.00% 39 41 0.00% 40 40 0.00% 41 54 0.00% 42 46 0.00% 43 49 0.00% 44 56 0.00% 45 69 0.00% 46 78 0.00% 47 95 0.00% 48 122 0.00% 49 129 0.00% 50 171 0.00% 51 188 0.00% 52 186 0.00% 53 224 0.00% 54 257 0.00% 55 270 0.00% 56 287 0.00% 57 375 0.00% 58 434 0.00% 59 450 0.00% 60 560 0.00% 61 708 0.00% 62 691 0.00% 63 807 0.00% 64 898 0.01% 65 969 0.01% 66 1068 0.01% 67 1262 0.01% 68 1457 0.01% 69 1651 0.01% 70 1837 0.01% 71 2230 0.01% 72 2466 0.01% 73 2810 0.02% 74 3157 0.02% 75 3422 0.02% 76 3783 0.02% 77 4169 0.02% 78 4493 0.03% 79 5234 0.03% 80 5888 0.03% 81 6528 0.04% 82 7557 0.04% 83 8392 0.05% 84 9135 0.05% 85 10028 0.06% 86 10812 0.06% 87 11577 0.07% 88 12882 0.08% 89 13593 0.08% 90 14685 0.09% 91 15852 0.09% 92 16734 0.10% 93 18550 0.11% 94 20443 0.12% 95 21895 0.13% 96 22652 0.13% 97 24118 0.14% 98 24956 0.15% 99 26053 0.15% 100 28184 0.17% 101 28632 0.17% 102 30019 0.18% 103 31850 0.19% 104 33370 0.20% 105 34658 0.20% 106 36232 0.21% 107 37114 0.22% 108 37846 0.22% 109 39424 0.23% 110 39361 0.23% 111 40981 0.24% 112 42768 0.25% 113 43679 0.26% 114 44709 0.26% 115 45973 0.27% 116 47472 0.28% 117 48293 0.28% 118 49527 0.29% 119 49544 0.29% 120 50769 0.30% 121 51749 0.30% 122 52249 0.31% 123 53164 0.31% 124 55055 0.32% 125 55518 0.33% 126 56511 0.33% 127 57440 0.34% 128 57650 0.34% 129 57460 0.34% 130 58212 0.34% 131 58310 0.34% 132 59345 0.35% 133 60496 0.36% 134 60825 0.36% 135 61381 0.36% 136 62333 0.37% 137 63190 0.37% 138 62704 0.37% 139 64743 0.38% 140 63597 0.37% 141 64546 0.38% 142 65224 0.38% 143 65126 0.38% 144 66380 0.39% 145 65880 0.39% 146 66787 0.39% 147 66864 0.39% 148 68429 0.40% 149 67108 0.40% 150 68132 0.40% 151 13943997 82.17% 16970680 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=23 prefix-density=0.51 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=247.87 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=14.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.88 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=29 prefix-density=0.87 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.12 sequence-density-rank=29 fanout-score=37.84 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=13.3 sequence=AAAGAAAAGAAAA SRR12671405 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:24:43 Started mapping on | Feb 11 22:24:43 Finished on | Feb 11 22:27:09 Mapping speed, Million of reads per hour | 418.46 Number of input reads | 16970680 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 15658455 Uniquely mapped reads % | 92.27% Average mapped length | 290.67 Number of splices: Total | 15140812 Number of splices: Annotated (sjdb) | 14811165 Number of splices: GT/AG | 14834107 Number of splices: GC/AG | 246705 Number of splices: AT/AC | 9214 Number of splices: Non-canonical | 50786 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 401978 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 86974 % of reads mapped to too many loci | 0.51% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.67% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 910247 910247 910247 N_multimapping 401978 401978 401978 N_noFeature 616937 15416127 716536 N_ambiguous 234557 1130 91164 UnstrandedReadsAssigned:14806961 PositiveStrandReadsAssigned:241198 NegativeStrandReadsAssigned:14850755 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671405 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671405-trimmed-pair1.fastq SRR12671405-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,970,680 reads, 14,940,090 reads pseudoaligned [quant] estimated average fragment length: 235.663 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR12671405.ke.tsv 34699 SRR12671405.se.tsv 87100 total ==> SRR12671405.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.34 779 27.4889 Potri.005G024800.1.v4.1 1035 800.337 370 29.0926 Potri.004G059700.1.v4.1 961 726.52 8 0.69294 Potri.007G009000.2.v4.1 1416 1181.34 0 0 Potri.003G141000.2.v4.1 2943 2708.34 876.479 20.3654 Potri.016G087400.1.v4.1 270 97.9766 890.598 572.022 Potri.015G069301.1.v4.1 564 341.699 0 0 Potri.010G195200.1.v4.1 1773 1538.34 164 6.70882 Potri.012G127500.1.v4.1 977 742.422 259 21.9534 ==> SRR12671405.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 266 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 224 Potri.001G212900.v4.1 37 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR12671405 completed mapping pipeline successfully