Starting /dee2/code/volunteer_pipeline.sh SRR12671406 current disk space = 3052303167488 free memory = 1473876072 SRR12671406 SRAfilesize 05fe1511b8b6f666e0744e0592f931b8 SRR12671406.sra SRR12671406.sra file validated SRR12671406 is paired end SRR12671406 is conventional basespace SRR12671406 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671406_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5185 37.0 37.0 37.0 37.0 37.0 2 36.3355 37.0 37.0 37.0 37.0 37.0 3 36.4955 37.0 37.0 37.0 37.0 37.0 4 36.6485 37.0 37.0 37.0 37.0 37.0 5 36.6205 37.0 37.0 37.0 37.0 37.0 6 36.6235 37.0 37.0 37.0 37.0 37.0 7 36.4665 37.0 37.0 37.0 37.0 37.0 8 36.6235 37.0 37.0 37.0 37.0 37.0 9 36.5625 37.0 37.0 37.0 37.0 37.0 10-14 36.612 37.0 37.0 37.0 37.0 37.0 15-19 36.6263 37.0 37.0 37.0 37.0 37.0 20-24 36.5997 37.0 37.0 37.0 37.0 37.0 25-29 36.5991 37.0 37.0 37.0 37.0 37.0 30-34 36.5271 37.0 37.0 37.0 37.0 37.0 35-39 36.477 37.0 37.0 37.0 37.0 37.0 40-44 36.474399999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4572 37.0 37.0 37.0 37.0 37.0 50-54 36.4568 37.0 37.0 37.0 37.0 37.0 55-59 36.4303 37.0 37.0 37.0 37.0 37.0 60-64 36.420100000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.38019999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.40410000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.37859999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.331399999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2626 37.0 37.0 37.0 37.0 37.0 90-94 36.253699999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.2164 37.0 37.0 37.0 37.0 37.0 100-104 36.2011 37.0 37.0 37.0 37.0 37.0 105-109 36.259299999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.1582 37.0 37.0 37.0 37.0 37.0 115-119 36.12140000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.109 37.0 37.0 37.0 37.0 37.0 125-129 36.1062 37.0 37.0 37.0 37.0 37.0 130-134 36.0843 37.0 37.0 37.0 37.0 37.0 135-139 36.079600000000006 37.0 37.0 37.0 37.0 37.0 140-144 35.9327 37.0 37.0 37.0 37.0 37.0 145-149 35.96939999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.9405 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 1.0 25 1.0 26 4.0 27 5.0 28 4.0 29 14.0 30 16.0 31 34.0 32 36.0 33 66.0 34 123.0 35 326.0 36 2964.0 37 403.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.775 11.625 4.675 36.925000000000004 2 19.68937875751503 11.948897795591181 37.72545090180361 30.636272545090183 3 16.775000000000002 17.275 29.075 36.875 4 21.349999999999998 25.025 24.45 29.175 5 25.1 31.75 23.474999999999998 19.675 6 18.625 35.5 22.25 23.625 7 14.099999999999998 25.85 43.65 16.400000000000002 8 14.95 24.6 35.075 25.374999999999996 9 16.225 23.575 36.449999999999996 23.75 10-14 18.96 30.5 27.77 22.770000000000003 15-19 19.865 28.13 28.125 23.880000000000003 20-24 20.380000000000003 28.115000000000002 27.905 23.599999999999998 25-29 20.0 28.765 27.839999999999996 23.395 30-34 19.32 28.804999999999996 27.900000000000002 23.974999999999998 35-39 19.775000000000002 27.534999999999997 28.065 24.625 40-44 19.885 28.79 27.310000000000002 24.015 45-49 20.155 29.265 27.439999999999998 23.14 50-54 19.78 28.549999999999997 28.349999999999998 23.32 55-59 19.64 27.85 27.589999999999996 24.92 60-64 20.435 28.275 27.785 23.505000000000003 65-69 20.48 28.665000000000003 27.29 23.565 70-74 20.105 28.299999999999997 27.694999999999997 23.9 75-79 20.225 28.27 27.015 24.490000000000002 80-84 20.005 28.65 27.575 23.77 85-89 20.025000000000002 27.994999999999997 28.775000000000002 23.205000000000002 90-94 20.11 28.835 27.375 23.68 95-99 19.759999999999998 28.549999999999997 28.060000000000002 23.630000000000003 100-104 20.13 28.15 28.205000000000002 23.515 105-109 20.46 28.9 27.16 23.48 110-114 20.474999999999998 28.185 27.51 23.830000000000002 115-119 20.995 28.48 27.560000000000002 22.965 120-124 20.525 28.485 27.615000000000002 23.375 125-129 20.145 28.585 27.200000000000003 24.07 130-134 20.830000000000002 28.415000000000003 27.35 23.405 135-139 21.099999999999998 27.88 27.01 24.01 140-144 20.580000000000002 28.585 27.615000000000002 23.22 145-149 20.61 28.665000000000003 27.195000000000004 23.53 150-151 21.587500000000002 27.474999999999998 27.6875 23.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 1.0 23 2.0 24 6.0 25 6.0 26 7.0 27 14.0 28 17.5 29 20.5 30 21.5 31 29.5 32 37.0 33 43.0 34 61.0 35 64.0 36 73.0 37 99.5 38 132.0 39 165.5 40 182.5 41 208.0 42 227.5 43 235.0 44 261.0 45 264.5 46 252.5 47 253.0 48 235.0 49 210.5 50 180.5 51 148.0 52 120.0 53 97.5 54 80.5 55 61.5 56 52.0 57 37.0 58 22.0 59 20.5 60 15.5 61 10.5 62 7.0 63 4.5 64 5.0 65 2.5 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 86.03351955307262 73.15 2 11.34960305792414 19.3 3 1.822993237283152 4.65 4 0.5586592178770949 1.9 5 0.23522493384298734 1.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGTAACTTTTCATATATTAGCTGCTGACCATTGTCACCTTCCCTATGAAT 5 0.125 No Hit CATCTCCATCTTAAAGTAACCGTTGTCGCCCCAGTCTTCTCCCCAAGAGT 5 0.125 No Hit GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 5 0.125 No Hit GTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGG 5 0.125 No Hit CTCAGCACTAGAACTGATATTATATCCTGCGCTGCCACAAACTTTTATTA 5 0.125 No Hit CATTTTTCTCACAGCAATAGCTGTAAAACCCGCCACACAAAGTGACGCCA 5 0.125 No Hit GGGTAGAGCCTTTTCTCTGGGTCAAGCTCTGCGTTCCTTTGGAATTCAAT 5 0.125 No Hit CAGGATATGATGCACAGGTTGCAATACCACACATGTTCTTCCCCATCTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.42500000000000004 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.8374999999999999 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.075 0.0 0.0 0.0 0.0 118-119 1.1 0.0 0.0 0.0 0.0 120-121 1.1749999999999998 0.0 0.0 0.0 0.0 122-123 1.3375 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.5 0.0 0.0 0.0 0.0 128-129 1.6749999999999998 0.0 0.0 0.0 0.0 130-131 1.7374999999999998 0.0 0.0 0.0 0.0 132-133 1.9625 0.0 0.0 0.0 0.0 134-135 2.1375 0.0 0.0 0.0 0.0 136-137 2.2625 0.0 0.0 0.0 0.0 138-139 2.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCTCA 10 0.006830828 145.0 1 >>END_MODULE SRR12671406 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671406_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.315 37.0 37.0 37.0 37.0 37.0 2 35.955 37.0 37.0 37.0 37.0 37.0 3 36.024 37.0 37.0 37.0 37.0 37.0 4 36.2525 37.0 37.0 37.0 37.0 37.0 5 36.188 37.0 37.0 37.0 37.0 37.0 6 36.15 37.0 37.0 37.0 37.0 37.0 7 36.2875 37.0 37.0 37.0 37.0 37.0 8 36.252 37.0 37.0 37.0 37.0 37.0 9 36.316 37.0 37.0 37.0 37.0 37.0 10-14 36.3017 37.0 37.0 37.0 37.0 37.0 15-19 36.2976 37.0 37.0 37.0 37.0 37.0 20-24 36.211299999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.230000000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.1841 37.0 37.0 37.0 37.0 37.0 35-39 36.1639 37.0 37.0 37.0 37.0 37.0 40-44 36.1105 37.0 37.0 37.0 37.0 37.0 45-49 36.1513 37.0 37.0 37.0 37.0 37.0 50-54 36.0673 37.0 37.0 37.0 37.0 37.0 55-59 36.060500000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.960300000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.0005 37.0 37.0 37.0 37.0 37.0 70-74 35.9394 37.0 37.0 37.0 37.0 37.0 75-79 35.9453 37.0 37.0 37.0 37.0 37.0 80-84 35.9514 37.0 37.0 37.0 37.0 37.0 85-89 35.9677 37.0 37.0 37.0 37.0 37.0 90-94 35.8886 37.0 37.0 37.0 37.0 37.0 95-99 35.8469 37.0 37.0 37.0 37.0 37.0 100-104 35.8693 37.0 37.0 37.0 37.0 37.0 105-109 35.7368 37.0 37.0 37.0 37.0 37.0 110-114 35.744899999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.8235 37.0 37.0 37.0 37.0 37.0 120-124 35.8247 37.0 37.0 37.0 37.0 37.0 125-129 35.7539 37.0 37.0 37.0 37.0 37.0 130-134 35.6914 37.0 37.0 37.0 37.0 37.0 135-139 35.5944 37.0 37.0 37.0 37.0 37.0 140-144 35.6424 37.0 37.0 37.0 37.0 37.0 145-149 35.5842 37.0 37.0 37.0 37.0 37.0 150-151 35.3375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 0.0 16 0.0 17 0.0 18 3.0 19 0.0 20 2.0 21 2.0 22 7.0 23 8.0 24 8.0 25 3.0 26 5.0 27 3.0 28 16.0 29 17.0 30 29.0 31 32.0 32 52.0 33 94.0 34 198.0 35 545.0 36 2747.0 37 226.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.475 26.025 8.3 23.200000000000003 2 27.224999999999998 26.900000000000002 30.8 15.075 3 20.525 29.125 32.7 17.65 4 22.575 35.325 24.2 17.9 5 24.85 38.4 20.4 16.35 6 19.35 39.525 22.75 18.375 7 19.375 21.25 39.0 20.375 8 19.175 25.5 30.3 25.025 9 21.05 23.75 30.825000000000003 24.375 10-14 22.555 29.580000000000002 26.715 21.15 15-19 23.31 28.194999999999997 27.495000000000005 21.0 20-24 22.525000000000002 28.744999999999997 28.425 20.305 25-29 22.2 28.249999999999996 28.785 20.765 30-34 22.655 28.465 27.485 21.395 35-39 22.035 28.105000000000004 28.02 21.84 40-44 22.33 28.439999999999998 27.955000000000002 21.275 45-49 22.23 27.944999999999997 28.634999999999998 21.19 50-54 22.86 28.225 27.700000000000003 21.215 55-59 22.945 27.43 27.965 21.66 60-64 22.155 28.000000000000004 27.93 21.915000000000003 65-69 23.07 27.465 27.944999999999997 21.52 70-74 22.555 27.735 27.38 22.33 75-79 22.39 28.294999999999998 27.284999999999997 22.03 80-84 22.895 28.405 26.995 21.705 85-89 23.21 27.55 27.779999999999998 21.46 90-94 23.135 28.21 27.339999999999996 21.315 95-99 23.0 27.839999999999996 28.044999999999998 21.115000000000002 100-104 22.900000000000002 28.43 27.785 20.885 105-109 23.595 28.16 27.794999999999998 20.45 110-114 24.0 27.93 27.700000000000003 20.369999999999997 115-119 23.735 28.9 26.950000000000003 20.415 120-124 23.200000000000003 27.845 28.389999999999997 20.565 125-129 24.12 27.755000000000003 27.534999999999997 20.59 130-134 22.96 28.194999999999997 28.095 20.75 135-139 23.735 27.089999999999996 28.360000000000003 20.815 140-144 23.549999999999997 27.74 28.065 20.645 145-149 24.582458245824583 27.597759775977597 27.317731773177318 20.502050205020502 150-151 23.7875 27.537499999999998 27.8125 20.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.5 9 1.5 10 1.0 11 0.0 12 1.0 13 1.0 14 1.5 15 2.0 16 1.0 17 1.5 18 1.0 19 1.0 20 1.0 21 1.0 22 1.5 23 1.0 24 2.5 25 4.0 26 4.5 27 8.5 28 10.5 29 14.5 30 19.5 31 22.0 32 27.0 33 38.5 34 55.0 35 70.5 36 93.5 37 122.0 38 129.5 39 142.0 40 198.5 41 241.0 42 238.5 43 258.0 44 277.5 45 261.0 46 256.0 47 251.0 48 220.0 49 187.0 50 166.0 51 145.0 52 110.5 53 81.0 54 73.0 55 62.5 56 47.5 57 42.0 58 30.0 59 14.5 60 11.5 61 11.0 62 9.0 63 7.0 64 5.0 65 1.5 66 1.0 67 1.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.5 98 0.5 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.575 #Duplication Level Percentage of deduplicated Percentage of total 1 85.84096955365061 72.6 2 11.409991132131244 19.3 3 1.9213715637008573 4.875 4 0.6207508128879693 2.1 5 0.11823825007389892 0.5 6 0.0 0.0 7 0.05911912503694946 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.02955956251847473 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 11 0.27499999999999997 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit GGGACCCGTACTGAGGTTTCTGATGTGAAGTCAACTCCGTTCCAGCCTTA 5 0.125 No Hit GGTATCATTCCACTTTGTTTCAAGTCCGGGGAGGATGCTGAGACACTTGG 5 0.125 No Hit GTTCTGCATATTCTCAGTTTTAGTCATTCTTGATATAACTATTCCGGCTG 5 0.125 No Hit GACGAATTGAAGCATGCAGTTGCATTTGTTCGTCCAGTTAGCGTTGCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.025 0.0 0.0 5 0.0 0.0 0.025 0.0 0.0 6 0.0 0.0 0.025 0.0 0.0 7 0.0 0.0 0.025 0.0 0.0 8 0.0 0.0 0.025 0.0 0.0 9 0.0 0.0 0.025 0.0 0.0 10-11 0.0 0.0 0.025 0.0 0.0 12-13 0.0 0.0 0.025 0.0 0.0 14-15 0.0 0.0 0.025 0.0 0.0 16-17 0.0 0.0 0.025 0.0 0.0 18-19 0.0 0.0 0.025 0.0 0.0 20-21 0.0 0.0 0.025 0.0 0.0 22-23 0.0 0.0 0.025 0.0 0.0 24-25 0.0 0.0 0.025 0.0 0.0 26-27 0.0 0.0 0.025 0.0 0.0 28-29 0.0 0.0 0.025 0.0 0.0 30-31 0.0 0.0 0.025 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0 0.0 0.025 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.0 0.0 0.025 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.0 70-71 0.0 0.0 0.025 0.0 0.0 72-73 0.0 0.0 0.025 0.0 0.0 74-75 0.0125 0.0 0.025 0.0 0.0 76-77 0.025 0.0 0.025 0.0 0.0 78-79 0.025 0.0 0.025 0.0 0.0 80-81 0.025 0.0 0.025 0.0 0.0 82-83 0.025 0.0 0.025 0.0 0.0 84-85 0.05 0.0 0.025 0.0 0.0 86-87 0.05 0.0 0.025 0.0 0.0 88-89 0.1125 0.0 0.025 0.0 0.0 90-91 0.15 0.0 0.025 0.0 0.0 92-93 0.16249999999999998 0.0 0.025 0.0 0.0 94-95 0.21250000000000002 0.0 0.025 0.0 0.0 96-97 0.25 0.0 0.025 0.0 0.0 98-99 0.25 0.0 0.025 0.0 0.0 100-101 0.2625 0.0 0.025 0.0 0.0 102-103 0.3125 0.0 0.025 0.0 0.0 104-105 0.4 0.0 0.025 0.0 0.0 106-107 0.475 0.0 0.025 0.0 0.0 108-109 0.575 0.0 0.025 0.0 0.0 110-111 0.65 0.0 0.025 0.0 0.0 112-113 0.8125 0.0 0.025 0.0 0.0 114-115 0.8999999999999999 0.0 0.025 0.0 0.0 116-117 1.05 0.0 0.025 0.0 0.0 118-119 1.0750000000000002 0.0 0.025 0.0 0.0 120-121 1.15 0.0 0.025 0.0 0.0 122-123 1.3125 0.0 0.025 0.0 0.0 124-125 1.3875 0.0 0.025 0.0 0.0 126-127 1.475 0.0 0.025 0.0 0.0 128-129 1.65 0.0 0.025 0.0 0.0 130-131 1.7125 0.0 0.025 0.0 0.0 132-133 1.9375 0.0 0.025 0.0 0.0 134-135 2.1125 0.0 0.025 0.0 0.0 136-137 2.2375 0.0 0.025 0.0 0.0 138-139 2.5125 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTTAT 10 0.006830828 145.0 5 TATACTG 10 0.006830828 145.0 9 TTATACT 10 0.006830828 145.0 8 CCCAAAT 10 0.006830828 145.0 145 ATTTCAA 10 0.006830828 145.0 145 >>END_MODULE Read 981949 spots for SRR12671406.sra Written 981949 spots for SRR12671406.sra Read 981949 spots for SRR12671406.sra Written 981949 spots for SRR12671406.sra Read 981949 spots for SRR12671406.sra Written 981949 spots for SRR12671406.sra Read 981949 spots for SRR12671406.sra Written 981949 spots for SRR12671406.sra Read 981949 spots for SRR12671406.sra Written 981949 spots for SRR12671406.sra Read 981949 spots for SRR12671406.sra Written 981949 spots for SRR12671406.sra Read 981949 spots for SRR12671406.sra Written 981949 spots for SRR12671406.sra Read 981949 spots for SRR12671406.sra Written 981949 spots for SRR12671406.sra Read 981949 spots for SRR12671406.sra Written 981949 spots for SRR12671406.sra Read 981949 spots for SRR12671406.sra Written 981949 spots for SRR12671406.sra Read 981949 spots for SRR12671406.sra Written 981949 spots for SRR12671406.sra Read 981949 spots for SRR12671406.sra Written 981949 spots for SRR12671406.sra Read 981949 spots for SRR12671406.sra Written 981949 spots for SRR12671406.sra Read 981949 spots for SRR12671406.sra Written 981949 spots for SRR12671406.sra Read 981949 spots for SRR12671406.sra Written 981949 spots for SRR12671406.sra Read 981949 spots for SRR12671406.sra Written 981949 spots for SRR12671406.sra Read 981949 spots for SRR12671406.sra Written 981949 spots for SRR12671406.sra Read 981968 spots for SRR12671406.sra Written 981968 spots for SRR12671406.sra Read 981949 spots for SRR12671406.sra Written 981949 spots for SRR12671406.sra Read 981949 spots for SRR12671406.sra Written 981949 spots for SRR12671406.sra SRR ids: ['SRR12671406.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_779h5t44 SRR12671406.sra spots: 19638999 blocks: [[1, 981949], [981950, 1963898], [1963899, 2945847], [2945848, 3927796], [3927797, 4909745], [4909746, 5891694], [5891695, 6873643], [6873644, 7855592], [7855593, 8837541], [8837542, 9819490], [9819491, 10801439], [10801440, 11783388], [11783389, 12765337], [12765338, 13747286], [13747287, 14729235], [14729236, 15711184], [15711185, 16693133], [16693134, 17675082], [17675083, 18657031], [18657032, 19638999]] SRR12671406 file size 6652490 SRR12671406 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671406 SRR12671406_1.fastq SRR12671406_2.fastq Input file: SRR12671406_1.fastq Paired file: SRR12671406_2.fastq trimmed: SRR12671406-trimmed-pair1.fastq, SRR12671406-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:26:41 2025 >> started Tue Feb 11 22:27:04 2025 >> done (23.085s) 19638999 read pairs processed; of these: 98 ( 0.00%) short read pairs filtered out after trimming by size control 6189 ( 0.03%) empty read pairs filtered out after trimming by size control 19632712 (99.97%) read pairs available; of these: 822710 ( 4.19%) trimmed read pairs available after processing 18810002 (95.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 7 0.00% 21 9 0.00% 22 8 0.00% 23 7 0.00% 24 15 0.00% 25 18 0.00% 26 25 0.00% 27 18 0.00% 28 23 0.00% 29 29 0.00% 30 10 0.00% 31 19 0.00% 32 27 0.00% 33 31 0.00% 34 25 0.00% 35 32 0.00% 36 28 0.00% 37 24 0.00% 38 25 0.00% 39 29 0.00% 40 32 0.00% 41 30 0.00% 42 26 0.00% 43 29 0.00% 44 37 0.00% 45 54 0.00% 46 33 0.00% 47 54 0.00% 48 45 0.00% 49 57 0.00% 50 68 0.00% 51 72 0.00% 52 72 0.00% 53 72 0.00% 54 73 0.00% 55 102 0.00% 56 100 0.00% 57 123 0.00% 58 122 0.00% 59 144 0.00% 60 172 0.00% 61 195 0.00% 62 176 0.00% 63 234 0.00% 64 269 0.00% 65 291 0.00% 66 321 0.00% 67 350 0.00% 68 400 0.00% 69 414 0.00% 70 460 0.00% 71 570 0.00% 72 665 0.00% 73 679 0.00% 74 749 0.00% 75 860 0.00% 76 993 0.01% 77 937 0.00% 78 1200 0.01% 79 1248 0.01% 80 1453 0.01% 81 1620 0.01% 82 1821 0.01% 83 1882 0.01% 84 2239 0.01% 85 2324 0.01% 86 2548 0.01% 87 2590 0.01% 88 2875 0.01% 89 3002 0.02% 90 3271 0.02% 91 3422 0.02% 92 3678 0.02% 93 4083 0.02% 94 4332 0.02% 95 4634 0.02% 96 4973 0.03% 97 5241 0.03% 98 5184 0.03% 99 5496 0.03% 100 5871 0.03% 101 6081 0.03% 102 6367 0.03% 103 6553 0.03% 104 7040 0.04% 105 7157 0.04% 106 7635 0.04% 107 7939 0.04% 108 8433 0.04% 109 8549 0.04% 110 8715 0.04% 111 9069 0.05% 112 9272 0.05% 113 9456 0.05% 114 9875 0.05% 115 10395 0.05% 116 10644 0.05% 117 11216 0.06% 118 11582 0.06% 119 11871 0.06% 120 12223 0.06% 121 12528 0.06% 122 12749 0.06% 123 13065 0.07% 124 13329 0.07% 125 14084 0.07% 126 14629 0.07% 127 15047 0.08% 128 15521 0.08% 129 15569 0.08% 130 16253 0.08% 131 16302 0.08% 132 16671 0.08% 133 17020 0.09% 134 17269 0.09% 135 17917 0.09% 136 18449 0.09% 137 18998 0.10% 138 19428 0.10% 139 20490 0.10% 140 20522 0.10% 141 20929 0.11% 142 21252 0.11% 143 21694 0.11% 144 22089 0.11% 145 22508 0.11% 146 23339 0.12% 147 23911 0.12% 148 25071 0.13% 149 24511 0.12% 150 26006 0.13% 151 18810002 95.81% 19632712 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=19 prefix-density=0.84 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=13.21 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.6 sequence=GACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=1.37 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=26 prefix-density=1.36 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.14 sequence-density-rank=23 fanout-score=29.78 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=11.7 sequence=AAAGAAAAGAAAA SRR12671406 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:28:17 Started mapping on | Feb 11 22:28:18 Finished on | Feb 11 22:30:30 Mapping speed, Million of reads per hour | 535.44 Number of input reads | 19632712 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17702787 Uniquely mapped reads % | 90.17% Average mapped length | 295.20 Number of splices: Total | 17687006 Number of splices: Annotated (sjdb) | 17331227 Number of splices: GT/AG | 17339432 Number of splices: GC/AG | 286638 Number of splices: AT/AC | 9556 Number of splices: Non-canonical | 51380 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 463594 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 46420 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.13% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1466331 1466331 1466331 N_multimapping 463594 463594 463594 N_noFeature 629976 17391952 712708 N_ambiguous 375559 1469 146628 UnstrandedReadsAssigned:16697252 PositiveStrandReadsAssigned:309366 NegativeStrandReadsAssigned:16843451 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671406 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671406-trimmed-pair1.fastq SRR12671406-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,632,712 reads, 17,270,298 reads pseudoaligned [quant] estimated average fragment length: 300.087 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,045 rounds 52401 SRR12671406.ke.tsv 34699 SRR12671406.se.tsv 87100 total ==> SRR12671406.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1718.91 673.526 18.6765 Potri.005G024800.1.v4.1 1035 735.913 251 16.257 Potri.004G059700.1.v4.1 961 662.111 4 0.287954 Potri.007G009000.2.v4.1 1416 1116.91 0 0 Potri.003G141000.2.v4.1 2943 2643.91 793.811 14.3108 Potri.016G087400.1.v4.1 270 70.7878 651 438.345 Potri.015G069301.1.v4.1 564 283.461 0 0 Potri.010G195200.1.v4.1 1773 1473.91 155 5.01249 Potri.012G127500.1.v4.1 977 677.984 102 7.17091 ==> SRR12671406.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 326 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 244 Potri.001G212900.v4.1 113 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 24 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12671406 completed mapping pipeline successfully