Starting /dee2/code/volunteer_pipeline.sh SRR12671407 current disk space = 3052336631808 free memory = 1575575288 SRR12671407 SRAfilesize 333fc58eeeb783c11d4509e45f703ad0 SRR12671407.sra SRR12671407.sra file validated SRR12671407 is paired end SRR12671407 is conventional basespace SRR12671407 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671407_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6355 37.0 37.0 37.0 37.0 37.0 2 36.51525 37.0 37.0 37.0 37.0 37.0 3 36.642 37.0 37.0 37.0 37.0 37.0 4 36.6545 37.0 37.0 37.0 37.0 37.0 5 36.622 37.0 37.0 37.0 37.0 37.0 6 36.6275 37.0 37.0 37.0 37.0 37.0 7 36.582 37.0 37.0 37.0 37.0 37.0 8 36.671 37.0 37.0 37.0 37.0 37.0 9 36.7115 37.0 37.0 37.0 37.0 37.0 10-14 36.629599999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.6352 37.0 37.0 37.0 37.0 37.0 20-24 36.5768 37.0 37.0 37.0 37.0 37.0 25-29 36.5454 37.0 37.0 37.0 37.0 37.0 30-34 36.5261 37.0 37.0 37.0 37.0 37.0 35-39 36.4885 37.0 37.0 37.0 37.0 37.0 40-44 36.45700000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.4019 37.0 37.0 37.0 37.0 37.0 50-54 36.421800000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.4016 37.0 37.0 37.0 37.0 37.0 60-64 36.3802 37.0 37.0 37.0 37.0 37.0 65-69 36.352700000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.3 37.0 37.0 37.0 37.0 37.0 75-79 36.306400000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.290400000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.217699999999994 37.0 37.0 37.0 37.0 37.0 90-94 36.236599999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.155899999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.1817 37.0 37.0 37.0 37.0 37.0 105-109 36.183499999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.062 37.0 37.0 37.0 37.0 37.0 115-119 36.0763 37.0 37.0 37.0 37.0 37.0 120-124 36.084900000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.083299999999994 37.0 37.0 37.0 37.0 37.0 130-134 36.0185 37.0 37.0 37.0 37.0 37.0 135-139 35.9827 37.0 37.0 37.0 37.0 37.0 140-144 35.9161 37.0 37.0 37.0 37.0 37.0 145-149 35.8751 37.0 37.0 37.0 37.0 37.0 150-151 35.71575 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 6.0 22 4.0 23 6.0 24 10.0 25 3.0 26 1.0 27 7.0 28 10.0 29 13.0 30 18.0 31 27.0 32 35.0 33 75.0 34 97.0 35 269.0 36 2914.0 37 505.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.775 12.950000000000001 7.025 35.25 2 21.398145828113254 10.348283638185919 37.083437734903534 31.170132798797294 3 17.325 16.25 29.175 37.25 4 21.85 23.075000000000003 24.6 30.475 5 24.125 28.225 25.35 22.3 6 19.225 34.125 24.775 21.875 7 14.975 28.4 42.0 14.625 8 16.725 25.825 34.75 22.7 9 16.950000000000003 25.074999999999996 36.025 21.95 10-14 19.400000000000002 31.509999999999998 27.500000000000004 21.59 15-19 20.375 28.785 27.79 23.05 20-24 20.09 29.26 27.639999999999997 23.01 25-29 20.195 28.205000000000002 28.249999999999996 23.35 30-34 19.439999999999998 29.244999999999997 27.415 23.9 35-39 19.945 29.42 27.650000000000002 22.985 40-44 20.29 29.485 26.884999999999998 23.34 45-49 20.69 28.735 27.250000000000004 23.325000000000003 50-54 20.02 28.88 27.689999999999998 23.41 55-59 20.09 29.74 26.655 23.515 60-64 20.385 29.23 26.790000000000003 23.595 65-69 19.384999999999998 28.51 27.900000000000002 24.205 70-74 19.31 28.74 27.655 24.295 75-79 20.335 28.64 27.015 24.01 80-84 20.385 28.645 27.089999999999996 23.880000000000003 85-89 20.32 28.58 27.200000000000003 23.9 90-94 20.665 28.835 27.025 23.474999999999998 95-99 20.105 28.439999999999998 27.305 24.15 100-104 19.994999999999997 29.755 26.525 23.724999999999998 105-109 20.724999999999998 28.384999999999998 27.105 23.785 110-114 20.615 27.905 27.575 23.905 115-119 21.355 28.315 26.965 23.365 120-124 20.74 28.389999999999997 27.0 23.87 125-129 20.165 28.715000000000003 27.450000000000003 23.669999999999998 130-134 21.425 28.205000000000002 26.650000000000002 23.72 135-139 21.015 28.194999999999997 26.595000000000002 24.195 140-144 20.8 28.675 26.525 24.0 145-149 21.14 28.32 25.874999999999996 24.665 150-151 19.950000000000003 28.299999999999997 27.575 24.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.5 2 1.0 3 1.5 4 1.0 5 0.0 6 0.0 7 0.0 8 0.5 9 1.5 10 1.5 11 0.5 12 1.5 13 2.0 14 0.5 15 0.0 16 1.5 17 1.5 18 0.0 19 0.5 20 3.0 21 3.5 22 3.0 23 3.0 24 3.5 25 4.0 26 3.0 27 5.5 28 12.0 29 21.5 30 32.5 31 39.0 32 40.0 33 44.5 34 60.5 35 70.0 36 96.5 37 124.0 38 129.5 39 158.0 40 206.5 41 210.0 42 198.5 43 209.0 44 220.0 45 232.0 46 243.0 47 246.5 48 227.5 49 210.0 50 191.5 51 154.5 52 121.5 53 99.0 54 74.0 55 61.5 56 56.0 57 39.0 58 25.0 59 28.0 60 23.0 61 12.5 62 10.5 63 12.0 64 8.0 65 2.0 66 1.0 67 0.5 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.875 #Duplication Level Percentage of deduplicated Percentage of total 1 85.09687034277198 71.375 2 11.80327868852459 19.8 3 2.354694485842027 5.925 4 0.47690014903129657 1.6 5 0.08941877794336811 0.375 6 0.14903129657228018 0.75 7 0.029806259314456036 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAAAGAACTTGCACAATCTACTCCAGTTAGCATAAATGGCGAGCAAGAA 7 0.17500000000000002 No Hit TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 6 0.15 No Hit GCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGA 6 0.15 No Hit TAATGAAGAAGAGATATCTTCATCATTTTTGCTCATTTTAGCTAAAGCCC 6 0.15 No Hit GTCGTAGGGAGGGGGGATACCCTCGAAGGCCTTCAGGCGGTTCATGGCAG 6 0.15 No Hit GTCGAGATTGCTGATGGTATCAAAGAGCTTTCCAGTAAGTTCCTTAAGGG 6 0.15 No Hit GCCACCCAGTTTTCTGGCTTCTCAAACTCTATAGTGGTAGGATTCGAGGC 5 0.125 No Hit GACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTG 5 0.125 No Hit CCTTAAGGCCCTAACAGATATAGCTAGGGACACATCAAGTTCTGGGACGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7125 0.0 0.0 0.0 0.0 96-97 0.7875000000000001 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0375 0.025 0.0 0.0 0.0 102-103 1.125 0.025 0.0 0.0 0.0 104-105 1.3375 0.025 0.0 0.0 0.0 106-107 1.5875 0.025 0.0 0.0 0.0 108-109 1.7625000000000002 0.025 0.0 0.0 0.0 110-111 1.9625 0.025 0.0 0.0 0.0 112-113 2.075 0.025 0.0 0.0 0.0 114-115 2.3875 0.025 0.0 0.0 0.0 116-117 2.65 0.025 0.0 0.0 0.0 118-119 2.9125 0.025 0.0 0.0 0.0 120-121 3.1625 0.025 0.0 0.0 0.0 122-123 3.7 0.025 0.0 0.0 0.0 124-125 4.0625 0.025 0.0 0.0 0.0 126-127 4.4625 0.025 0.0 0.0 0.0 128-129 4.8375 0.025 0.0 0.0 0.0 130-131 5.1375 0.025 0.0 0.0 0.0 132-133 5.574999999999999 0.025 0.0 0.0 0.0 134-135 5.925 0.025 0.0 0.0 0.0 136-137 6.4625 0.025 0.0 0.0 0.0 138-139 6.887499999999999 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671407 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671407_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5065 37.0 37.0 37.0 37.0 37.0 2 36.3195 37.0 37.0 37.0 37.0 37.0 3 36.3635 37.0 37.0 37.0 37.0 37.0 4 36.405 37.0 37.0 37.0 37.0 37.0 5 36.436 37.0 37.0 37.0 37.0 37.0 6 36.374 37.0 37.0 37.0 37.0 37.0 7 36.4105 37.0 37.0 37.0 37.0 37.0 8 36.492 37.0 37.0 37.0 37.0 37.0 9 36.463 37.0 37.0 37.0 37.0 37.0 10-14 36.483799999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.4809 37.0 37.0 37.0 37.0 37.0 20-24 36.4488 37.0 37.0 37.0 37.0 37.0 25-29 36.384100000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.3416 37.0 37.0 37.0 37.0 37.0 35-39 36.417500000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.3869 37.0 37.0 37.0 37.0 37.0 45-49 36.3327 37.0 37.0 37.0 37.0 37.0 50-54 36.3122 37.0 37.0 37.0 37.0 37.0 55-59 36.2787 37.0 37.0 37.0 37.0 37.0 60-64 36.26270000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.2803 37.0 37.0 37.0 37.0 37.0 70-74 36.2818 37.0 37.0 37.0 37.0 37.0 75-79 36.214600000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.195499999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.244 37.0 37.0 37.0 37.0 37.0 90-94 36.2494 37.0 37.0 37.0 37.0 37.0 95-99 36.1276 37.0 37.0 37.0 37.0 37.0 100-104 36.160000000000004 37.0 37.0 37.0 37.0 37.0 105-109 36.1298 37.0 37.0 37.0 37.0 37.0 110-114 36.0783 37.0 37.0 37.0 37.0 37.0 115-119 36.0997 37.0 37.0 37.0 37.0 37.0 120-124 36.0971 37.0 37.0 37.0 37.0 37.0 125-129 36.059200000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.9713 37.0 37.0 37.0 37.0 37.0 135-139 35.8497 37.0 37.0 37.0 37.0 37.0 140-144 35.8832 37.0 37.0 37.0 37.0 37.0 145-149 35.864999999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.627 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 0.0 15 1.0 16 1.0 17 0.0 18 2.0 19 0.0 20 1.0 21 3.0 22 0.0 23 4.0 24 6.0 25 7.0 26 2.0 27 4.0 28 7.0 29 10.0 30 10.0 31 24.0 32 43.0 33 72.0 34 122.0 35 417.0 36 2882.0 37 380.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.825 25.900000000000002 9.475 23.799999999999997 2 26.974999999999998 26.25 31.05 15.725 3 20.575 27.224999999999998 33.7 18.5 4 25.3 32.25 23.599999999999998 18.85 5 26.424999999999997 36.975 20.575 16.025 6 20.200000000000003 39.550000000000004 22.825 17.424999999999997 7 21.525 22.675 36.65 19.15 8 20.325 24.9 28.65 26.125 9 22.55 23.150000000000002 32.300000000000004 22.0 10-14 22.765 29.665000000000003 26.69 20.880000000000003 15-19 23.16 27.755000000000003 28.07 21.015 20-24 23.53 28.52 27.11 20.84 25-29 23.345 27.884999999999998 27.229999999999997 21.54 30-34 24.08 27.705000000000002 27.115000000000002 21.099999999999998 35-39 23.64 27.6 27.455000000000002 21.305 40-44 23.325000000000003 27.79 27.779999999999998 21.105 45-49 23.845 28.215 27.57 20.369999999999997 50-54 23.195 28.544999999999998 26.93 21.33 55-59 23.735 28.28 27.41 20.575 60-64 23.34 27.105 28.465 21.09 65-69 24.03 27.395000000000003 27.544999999999998 21.029999999999998 70-74 23.75 28.275 27.060000000000002 20.915 75-79 22.435 26.865 28.1 22.6 80-84 23.685000000000002 27.925 27.24 21.15 85-89 23.655 27.650000000000002 27.755000000000003 20.94 90-94 24.13 28.139999999999997 26.479999999999997 21.25 95-99 23.799999999999997 27.55 28.51 20.14 100-104 24.16 26.905 27.675 21.26 105-109 23.36 27.305 28.189999999999998 21.145 110-114 23.955000000000002 27.455000000000002 27.794999999999998 20.794999999999998 115-119 24.47 27.755000000000003 27.16 20.615 120-124 23.985 28.744999999999997 26.87 20.4 125-129 24.775 28.255000000000003 27.005000000000003 19.965 130-134 25.255 27.405 27.67 19.67 135-139 23.995 27.905 27.675 20.424999999999997 140-144 25.09 27.689999999999998 27.250000000000004 19.97 145-149 25.322532253225322 27.49274927492749 27.51775177517752 19.666966696669665 150-151 26.2125 27.950000000000003 26.3625 19.475 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.5 22 1.5 23 1.0 24 1.0 25 2.5 26 4.5 27 6.0 28 6.5 29 7.5 30 7.5 31 15.5 32 34.5 33 40.0 34 43.5 35 63.0 36 81.0 37 114.0 38 143.5 39 148.5 40 174.5 41 202.0 42 227.5 43 257.0 44 258.5 45 249.5 46 257.0 47 256.0 48 229.0 49 206.0 50 184.0 51 150.0 52 133.0 53 119.5 54 93.0 55 75.5 56 55.5 57 45.0 58 33.0 59 18.5 60 12.5 61 9.5 62 9.0 63 4.0 64 2.5 65 1.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 1.0 92 1.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.825 #Duplication Level Percentage of deduplicated Percentage of total 1 85.35639725618849 71.55 2 11.422606620936476 19.15 3 2.445571130331047 6.15 4 0.5070086489710707 1.7000000000000002 5 0.11929615269907547 0.5 6 0.08947211452430659 0.44999999999999996 7 0.029824038174768867 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.029824038174768867 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 13 0.325 No Hit GTTCGTTTCCCTTGGTTGAGTTAAAAGTTTTCACTAGTTACATTTGGCAG 7 0.17500000000000002 No Hit GAAGGTTGTTGTTGTCCGCTGCGAGCAGCTCAACATCTCTGGCGAGTTCT 6 0.15 No Hit GTGGTTCTTATGCAATGTTTGCAGGCAAGGATGCAAGCAGGGCTTTAGCT 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCA 5 0.125 No Hit GATTGAGCCCAAGTTCTTGGACAAATTCCCTAACATCACCAAAAGACTGA 5 0.125 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit GAGGCATCTCAAGTGTTGCTTGAGCTTGAGGAGGCAAAGAAAGCTTACCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.0875 0.0 0.0 0.0 0.0 102-103 1.1749999999999998 0.0 0.0 0.0 0.0 104-105 1.3875 0.0 0.0 0.0 0.0 106-107 1.6375000000000002 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 2.0125 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 2.7 0.0 0.0 0.0 0.0 118-119 2.9625 0.0 0.0 0.0 0.0 120-121 3.2 0.0 0.0 0.0 0.0 122-123 3.725 0.0 0.0 0.0 0.0 124-125 4.0875 0.0 0.0 0.0 0.0 126-127 4.4875 0.0 0.0 0.0 0.0 128-129 4.8625 0.0 0.0 0.0 0.0 130-131 5.1625 0.0 0.0 0.0 0.0 132-133 5.6375 0.0 0.0 0.0 0.0 134-135 6.025 0.0 0.0 0.0 0.0 136-137 6.5625 0.0 0.0 0.0 0.0 138-139 6.987500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTCTT 10 0.006830828 145.0 9 >>END_MODULE Read 833214 spots for SRR12671407.sra Written 833214 spots for SRR12671407.sra Read 833214 spots for SRR12671407.sra Written 833214 spots for SRR12671407.sra Read 833214 spots for SRR12671407.sra Written 833214 spots for SRR12671407.sra Read 833214 spots for SRR12671407.sra Written 833214 spots for SRR12671407.sra Read 833214 spots for SRR12671407.sra Written 833214 spots for SRR12671407.sra Read 833214 spots for SRR12671407.sra Written 833214 spots for SRR12671407.sra Read 833214 spots for SRR12671407.sra Written 833214 spots for SRR12671407.sra Read 833214 spots for SRR12671407.sra Written 833214 spots for SRR12671407.sra Read 833214 spots for SRR12671407.sra Written 833214 spots for SRR12671407.sra Read 833214 spots for SRR12671407.sra Written 833214 spots for SRR12671407.sra Read 833214 spots for SRR12671407.sra Written 833214 spots for SRR12671407.sra Read 833214 spots for SRR12671407.sra Written 833214 spots for SRR12671407.sra Read 833214 spots for SRR12671407.sra Written 833214 spots for SRR12671407.sra Read 833214 spots for SRR12671407.sra Written 833214 spots for SRR12671407.sra Read 833214 spots for SRR12671407.sra Written 833214 spots for SRR12671407.sra Read 833214 spots for SRR12671407.sra Written 833214 spots for SRR12671407.sra Read 833214 spots for SRR12671407.sra Written 833214 spots for SRR12671407.sra Read 833214 spots for SRR12671407.sra Written 833214 spots for SRR12671407.sra Read 833214 spots for SRR12671407.sra Written 833214 spots for SRR12671407.sra Read 833232 spots for SRR12671407.sra Written 833232 spots for SRR12671407.sra SRR ids: ['SRR12671407.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0a0czpf0 SRR12671407.sra spots: 16664298 blocks: [[1, 833214], [833215, 1666428], [1666429, 2499642], [2499643, 3332856], [3332857, 4166070], [4166071, 4999284], [4999285, 5832498], [5832499, 6665712], [6665713, 7498926], [7498927, 8332140], [8332141, 9165354], [9165355, 9998568], [9998569, 10831782], [10831783, 11664996], [11664997, 12498210], [12498211, 13331424], [13331425, 14164638], [14164639, 14997852], [14997853, 15831066], [15831067, 16664298]] SRR12671407 file size 5641557 SRR12671407 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671407 SRR12671407_1.fastq SRR12671407_2.fastq Input file: SRR12671407_1.fastq Paired file: SRR12671407_2.fastq trimmed: SRR12671407-trimmed-pair1.fastq, SRR12671407-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:20:50 2025 >> started Tue Feb 11 23:21:09 2025 >> done (18.682s) 16664298 read pairs processed; of these: 151 ( 0.00%) short read pairs filtered out after trimming by size control 8871 ( 0.05%) empty read pairs filtered out after trimming by size control 16655276 (99.95%) read pairs available; of these: 1576811 ( 9.47%) trimmed read pairs available after processing 15078465 (90.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 18 0.00% 20 19 0.00% 21 17 0.00% 22 15 0.00% 23 17 0.00% 24 14 0.00% 25 17 0.00% 26 13 0.00% 27 21 0.00% 28 37 0.00% 29 29 0.00% 30 29 0.00% 31 28 0.00% 32 43 0.00% 33 43 0.00% 34 32 0.00% 35 23 0.00% 36 40 0.00% 37 41 0.00% 38 42 0.00% 39 47 0.00% 40 37 0.00% 41 63 0.00% 42 43 0.00% 43 44 0.00% 44 57 0.00% 45 42 0.00% 46 43 0.00% 47 54 0.00% 48 71 0.00% 49 58 0.00% 50 91 0.00% 51 117 0.00% 52 99 0.00% 53 126 0.00% 54 99 0.00% 55 152 0.00% 56 146 0.00% 57 159 0.00% 58 200 0.00% 59 230 0.00% 60 302 0.00% 61 347 0.00% 62 373 0.00% 63 430 0.00% 64 446 0.00% 65 478 0.00% 66 554 0.00% 67 614 0.00% 68 700 0.00% 69 752 0.00% 70 861 0.01% 71 991 0.01% 72 1214 0.01% 73 1232 0.01% 74 1531 0.01% 75 1737 0.01% 76 1837 0.01% 77 1998 0.01% 78 2166 0.01% 79 2450 0.01% 80 2639 0.02% 81 2929 0.02% 82 3396 0.02% 83 3660 0.02% 84 4300 0.03% 85 4642 0.03% 86 4880 0.03% 87 5370 0.03% 88 5977 0.04% 89 6097 0.04% 90 6501 0.04% 91 6874 0.04% 92 7486 0.04% 93 8148 0.05% 94 8729 0.05% 95 9558 0.06% 96 9894 0.06% 97 10439 0.06% 98 10699 0.06% 99 11110 0.07% 100 11786 0.07% 101 11919 0.07% 102 12659 0.08% 103 13447 0.08% 104 14099 0.08% 105 14693 0.09% 106 15634 0.09% 107 16072 0.10% 108 16820 0.10% 109 17236 0.10% 110 17415 0.10% 111 18133 0.11% 112 18701 0.11% 113 19399 0.12% 114 19831 0.12% 115 21001 0.13% 116 21757 0.13% 117 22698 0.14% 118 23155 0.14% 119 23407 0.14% 120 24204 0.15% 121 24795 0.15% 122 25338 0.15% 123 25692 0.15% 124 26621 0.16% 125 26776 0.16% 126 28416 0.17% 127 29137 0.17% 128 29448 0.18% 129 30947 0.19% 130 31278 0.19% 131 31452 0.19% 132 31993 0.19% 133 32483 0.20% 134 33476 0.20% 135 34247 0.21% 136 34876 0.21% 137 35687 0.21% 138 36365 0.22% 139 37561 0.23% 140 37982 0.23% 141 39231 0.24% 142 39458 0.24% 143 39751 0.24% 144 41010 0.25% 145 41440 0.25% 146 42243 0.25% 147 42829 0.26% 148 44245 0.27% 149 44671 0.27% 150 46428 0.28% 151 15078465 90.53% 16655276 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=22 prefix-density=0.57 prefix-fanout=2.0 sequence=GTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=53.47 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=3.5 sequence=AAAGCAGAATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTT criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=17 prefix-density=0.46 prefix-fanout=2.5 sequence=TGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=19.85 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=2.2 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTC SRR12671407 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:21:53 Started mapping on | Feb 11 23:21:54 Finished on | Feb 11 23:24:52 Mapping speed, Million of reads per hour | 336.85 Number of input reads | 16655276 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 15222539 Uniquely mapped reads % | 91.40% Average mapped length | 296.00 Number of splices: Total | 14456909 Number of splices: Annotated (sjdb) | 14159590 Number of splices: GT/AG | 14166458 Number of splices: GC/AG | 238050 Number of splices: AT/AC | 9068 Number of splices: Non-canonical | 43333 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.03% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 385291 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 90545 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.62% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1047446 1047446 1047446 N_multimapping 385291 385291 385291 N_noFeature 511761 14924787 596270 N_ambiguous 327377 1400 113559 UnstrandedReadsAssigned:14383401 PositiveStrandReadsAssigned:296352 NegativeStrandReadsAssigned:14512710 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671407 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671407-trimmed-pair1.fastq SRR12671407-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,655,276 reads, 14,463,338 reads pseudoaligned [quant] estimated average fragment length: 254.371 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,054 rounds 52401 SRR12671407.ke.tsv 34699 SRR12671407.se.tsv 87100 total ==> SRR12671407.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.63 393 11.6203 Potri.005G024800.1.v4.1 1035 781.629 154 10.2801 Potri.004G059700.1.v4.1 961 707.684 9 0.663562 Potri.007G009000.2.v4.1 1416 1162.63 0 0 Potri.003G141000.2.v4.1 2943 2689.63 467 9.05947 Potri.016G087400.1.v4.1 270 80.6681 709 458.588 Potri.015G069301.1.v4.1 564 319.538 0 0 Potri.010G195200.1.v4.1 1773 1519.63 97 3.33052 Potri.012G127500.1.v4.1 977 723.659 102 7.35435 ==> SRR12671407.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 173 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 348 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671407 completed mapping pipeline successfully