Starting /dee2/code/volunteer_pipeline.sh SRR12671408 current disk space = 3052598784000 free memory = 1223353736 SRR12671408 SRAfilesize 10555ae4bb99f8ce8527d55d9663ee30 SRR12671408.sra SRR12671408.sra file validated SRR12671408 is paired end SRR12671408 is conventional basespace SRR12671408 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671408_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.598 37.0 37.0 37.0 37.0 37.0 2 36.25925 37.0 37.0 37.0 37.0 37.0 3 36.5425 37.0 37.0 37.0 37.0 37.0 4 36.6255 37.0 37.0 37.0 37.0 37.0 5 36.6575 37.0 37.0 37.0 37.0 37.0 6 36.629 37.0 37.0 37.0 37.0 37.0 7 36.5925 37.0 37.0 37.0 37.0 37.0 8 36.519 37.0 37.0 37.0 37.0 37.0 9 36.6125 37.0 37.0 37.0 37.0 37.0 10-14 36.6023 37.0 37.0 37.0 37.0 37.0 15-19 36.604 37.0 37.0 37.0 37.0 37.0 20-24 36.5636 37.0 37.0 37.0 37.0 37.0 25-29 36.5847 37.0 37.0 37.0 37.0 37.0 30-34 36.5664 37.0 37.0 37.0 37.0 37.0 35-39 36.5138 37.0 37.0 37.0 37.0 37.0 40-44 36.4796 37.0 37.0 37.0 37.0 37.0 45-49 36.436099999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.4584 37.0 37.0 37.0 37.0 37.0 55-59 36.4431 37.0 37.0 37.0 37.0 37.0 60-64 36.3547 37.0 37.0 37.0 37.0 37.0 65-69 36.3305 37.0 37.0 37.0 37.0 37.0 70-74 36.3579 37.0 37.0 37.0 37.0 37.0 75-79 36.319 37.0 37.0 37.0 37.0 37.0 80-84 36.2885 37.0 37.0 37.0 37.0 37.0 85-89 36.2188 37.0 37.0 37.0 37.0 37.0 90-94 36.255700000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.2087 37.0 37.0 37.0 37.0 37.0 100-104 36.186800000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.2229 37.0 37.0 37.0 37.0 37.0 110-114 36.1515 37.0 37.0 37.0 37.0 37.0 115-119 36.1108 37.0 37.0 37.0 37.0 37.0 120-124 36.093900000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.076100000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.9739 37.0 37.0 37.0 37.0 37.0 135-139 35.994 37.0 37.0 37.0 37.0 37.0 140-144 35.9362 37.0 37.0 37.0 37.0 37.0 145-149 35.9422 37.0 37.0 37.0 37.0 37.0 150-151 35.82125 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 1.0 23 1.0 24 3.0 25 4.0 26 4.0 27 6.0 28 8.0 29 11.0 30 24.0 31 35.0 32 44.0 33 60.0 34 115.0 35 282.0 36 2968.0 37 432.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.3 9.950000000000001 4.9750000000000005 40.775 2 17.365119196988708 11.191969887076537 42.183186951066496 29.259723964868257 3 18.35 17.5 28.075 36.075 4 24.175 23.1 23.225 29.5 5 24.825 30.099999999999998 24.725 20.349999999999998 6 19.025 34.25 25.224999999999998 21.5 7 14.875 25.35 43.7 16.075 8 14.975 24.6 35.225 25.2 9 16.075 22.475 36.575 24.875 10-14 19.215 29.315 28.560000000000002 22.91 15-19 19.72 27.91 28.465 23.905 20-24 19.025 28.689999999999998 28.000000000000004 24.285 25-29 19.765 27.345000000000002 28.544999999999998 24.345 30-34 19.994999999999997 28.299999999999997 27.43 24.275 35-39 19.505 28.155 28.310000000000002 24.03 40-44 20.26 27.765 28.79 23.185 45-49 19.665 28.199999999999996 27.985 24.15 50-54 19.259999999999998 28.765 27.705000000000002 24.27 55-59 19.41 28.04 28.265 24.285 60-64 19.74 27.73 28.444999999999997 24.085 65-69 19.82 28.050000000000004 28.51 23.62 70-74 19.615 28.535 27.865000000000002 23.985 75-79 20.155 28.125 28.050000000000004 23.669999999999998 80-84 19.744999999999997 28.015 27.99 24.25 85-89 19.705000000000002 28.705000000000002 27.79 23.799999999999997 90-94 20.064999999999998 28.29 27.634999999999998 24.01 95-99 19.869999999999997 28.67 27.98 23.48 100-104 19.79 28.01 28.605000000000004 23.595 105-109 20.015 28.315 28.055000000000003 23.615 110-114 20.335 27.405 28.645 23.615 115-119 21.099999999999998 28.24 27.49 23.169999999999998 120-124 20.09 28.63 27.505000000000003 23.775 125-129 20.080000000000002 28.115000000000002 28.449999999999996 23.355 130-134 20.365 27.584999999999997 28.689999999999998 23.36 135-139 20.5 29.189999999999998 26.895000000000003 23.415 140-144 20.695 28.360000000000003 27.465 23.48 145-149 20.4 28.13 28.115000000000002 23.355 150-151 20.375 27.575 27.0 25.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 1.0 2 2.0 3 1.0 4 0.0 5 0.0 6 0.5 7 2.0 8 1.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 2.0 21 3.5 22 3.5 23 3.0 24 2.5 25 3.5 26 7.5 27 12.5 28 15.0 29 16.0 30 17.5 31 22.0 32 30.0 33 43.0 34 49.5 35 68.0 36 83.0 37 96.0 38 125.0 39 152.5 40 178.0 41 200.0 42 235.5 43 250.0 44 252.0 45 270.0 46 283.5 47 276.0 48 257.0 49 221.0 50 167.5 51 139.0 52 121.0 53 93.5 54 78.5 55 63.0 56 42.5 57 25.5 58 19.0 59 21.5 60 18.0 61 12.0 62 6.0 63 2.0 64 0.5 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.0 #Duplication Level Percentage of deduplicated Percentage of total 1 85.17857142857143 71.55 2 11.488095238095237 19.3 3 2.7083333333333335 6.825 4 0.4464285714285714 1.5 5 0.08928571428571429 0.375 6 0.08928571428571429 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGCTATAATCGATGAAGGAAAAGGCCGCCAGGGAGGAGGTGGTGTTACA 6 0.15 No Hit CTACGAGTCTGACAAGATTCATGTGTTGCAATTTAGCTATGAGTATAAGC 6 0.15 No Hit GTGAACATCTTGATTCCTGATATCAGTACTTCTCAGTTTTGGTAAGCCTA 6 0.15 No Hit CTGTGCTGTCACATCCATCAACATCCCATCCCTTAAAGCTGCAATCCCCG 5 0.125 No Hit CAATTCATGAGTTTCAGCCATCAAGCTGTCCACAGAATCTGCACTTGCAT 5 0.125 No Hit CCTCAATATCCGGGCACTTGAGTGCAATGACAGCCATTGTAGGCCCACCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 0.9625 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.225 0.0 0.0 0.0 0.0 120-121 1.325 0.0 0.0 0.0 0.0 122-123 1.4874999999999998 0.0 0.0 0.0 0.0 124-125 1.6 0.0 0.0 0.0 0.0 126-127 1.9125 0.0 0.0 0.0 0.0 128-129 2.1125 0.0 0.0 0.0 0.0 130-131 2.2750000000000004 0.0 0.0 0.0 0.0 132-133 2.425 0.0 0.0 0.0 0.0 134-135 2.6125 0.0 0.0 0.0 0.0 136-137 2.7125000000000004 0.0 0.0 0.0 0.0 138-139 2.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACATCT 10 0.006830828 145.0 9 >>END_MODULE SRR12671408 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671408_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1345 37.0 37.0 37.0 37.0 37.0 2 35.8105 37.0 37.0 37.0 37.0 37.0 3 35.93 37.0 37.0 37.0 37.0 37.0 4 36.117 37.0 37.0 37.0 37.0 37.0 5 36.075 37.0 37.0 37.0 37.0 37.0 6 36.155 37.0 37.0 37.0 37.0 37.0 7 36.0345 37.0 37.0 37.0 37.0 37.0 8 36.1425 37.0 37.0 37.0 37.0 37.0 9 36.227 37.0 37.0 37.0 37.0 37.0 10-14 36.202400000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.083 37.0 37.0 37.0 37.0 37.0 20-24 36.06699999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.0531 37.0 37.0 37.0 37.0 37.0 30-34 36.0323 37.0 37.0 37.0 37.0 37.0 35-39 36.025099999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.0177 37.0 37.0 37.0 37.0 37.0 45-49 35.9285 37.0 37.0 37.0 37.0 37.0 50-54 35.949 37.0 37.0 37.0 37.0 37.0 55-59 35.923 37.0 37.0 37.0 37.0 37.0 60-64 35.89 37.0 37.0 37.0 37.0 37.0 65-69 35.8641 37.0 37.0 37.0 37.0 37.0 70-74 35.8596 37.0 37.0 37.0 37.0 37.0 75-79 35.8438 37.0 37.0 37.0 37.0 37.0 80-84 35.8248 37.0 37.0 37.0 37.0 37.0 85-89 35.857299999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.7736 37.0 37.0 37.0 37.0 37.0 95-99 35.7376 37.0 37.0 37.0 37.0 37.0 100-104 35.707100000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.6748 37.0 37.0 37.0 37.0 37.0 110-114 35.611399999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.723699999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.6588 37.0 37.0 37.0 37.0 37.0 125-129 35.619 37.0 37.0 37.0 37.0 37.0 130-134 35.518600000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.479699999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.5317 37.0 37.0 37.0 37.0 37.0 145-149 35.4378 37.0 37.0 37.0 34.6 37.0 150-151 35.1965 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 4.0 15 1.0 16 0.0 17 0.0 18 1.0 19 1.0 20 2.0 21 3.0 22 3.0 23 5.0 24 6.0 25 6.0 26 5.0 27 9.0 28 16.0 29 22.0 30 29.0 31 54.0 32 68.0 33 125.0 34 217.0 35 607.0 36 2592.0 37 222.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.475 24.025 8.85 26.650000000000002 2 25.374999999999996 27.1 33.45 14.075 3 20.175 25.775 34.925 19.125 4 22.975 33.5 23.575 19.950000000000003 5 24.7 38.15 21.175 15.975 6 19.650000000000002 39.800000000000004 22.925 17.625 7 20.5 22.375 37.125 20.0 8 18.525 25.55 30.5 25.424999999999997 9 21.375 24.525 30.975 23.125 10-14 23.225 29.69 26.484999999999996 20.599999999999998 15-19 23.025000000000002 28.12 28.050000000000004 20.805 20-24 23.474999999999998 28.305000000000003 28.199999999999996 20.02 25-29 21.97 28.360000000000003 28.854999999999997 20.815 30-34 22.365 28.59 28.384999999999998 20.66 35-39 22.925 28.225 27.894999999999996 20.955 40-44 22.939999999999998 28.325 27.839999999999996 20.895 45-49 22.55 27.925 28.22 21.305 50-54 22.275 28.525 27.884999999999998 21.315 55-59 22.445 28.365000000000002 27.800000000000004 21.39 60-64 23.080000000000002 27.644999999999996 27.97 21.305 65-69 22.855 27.365000000000002 28.035 21.745 70-74 22.925 27.794999999999998 27.715 21.565 75-79 22.325 28.360000000000003 27.725 21.59 80-84 23.48 27.375 27.66 21.485000000000003 85-89 23.195 28.21 27.560000000000002 21.035 90-94 23.29 27.744999999999997 28.02 20.945 95-99 23.724999999999998 28.03 26.935 21.310000000000002 100-104 23.544999999999998 28.79 27.155 20.51 105-109 23.544999999999998 27.735 28.1 20.62 110-114 24.265 28.34 27.589999999999996 19.805 115-119 23.815 28.68 27.0 20.505000000000003 120-124 23.565 28.050000000000004 27.529999999999998 20.855 125-129 23.805 28.235 27.16 20.8 130-134 23.669999999999998 27.839999999999996 27.900000000000002 20.59 135-139 24.08 27.935 27.3 20.685000000000002 140-144 24.365000000000002 28.4 27.115000000000002 20.119999999999997 145-149 24.557455745574558 27.652765276527653 27.37273727372737 20.417041704170416 150-151 24.05 27.8625 27.500000000000004 20.5875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 1.0 19 1.5 20 1.0 21 1.5 22 1.0 23 3.0 24 7.0 25 6.5 26 6.5 27 7.0 28 10.0 29 12.5 30 17.5 31 25.0 32 31.0 33 38.5 34 50.0 35 69.0 36 104.5 37 126.0 38 144.0 39 175.0 40 190.5 41 211.5 42 246.0 43 276.0 44 284.5 45 268.5 46 249.5 47 220.5 48 198.5 49 195.0 50 162.0 51 123.5 52 104.0 53 94.0 54 84.5 55 63.5 56 48.0 57 39.5 58 26.5 59 20.5 60 16.5 61 12.5 62 9.5 63 4.0 64 1.0 65 0.0 66 0.0 67 0.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.325 #Duplication Level Percentage of deduplicated Percentage of total 1 85.47287281351912 72.075 2 11.414171360806403 19.25 3 2.4607174621998222 6.225 4 0.4447079750963534 1.5 5 0.11858879335902757 0.5 6 0.08894159501927068 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCCTCAACAAAAAGTGTTTAGCTCATGTTAGCCAAGCCGCAGGTAGTAA 6 0.15 No Hit GTCATGATGGCTGCAGTAATGGGTGCCGATGAGTATGGATTTGGTTCCGT 6 0.15 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit AAGACGTCAAACAAATTACTCTCTTGATCTCTCTCTTTACATTCCGAGGT 5 0.125 No Hit TGGTATGAATGTTCCAGAGAAGTTTTTTGAAGGGATGAAAGAAATTGAAG 5 0.125 No Hit TGTGACTTTTGTATCCGCTGAAGATGCTAAGGCTGTACTATCAGGTGAAC 5 0.125 No Hit GTGGATGTAGAGAAAAGGAAAAGGAAAAGCAATTGGATATGGATTATTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 0.9874999999999999 0.0 0.0 0.0 0.0 114-115 1.1875 0.0 0.0 0.0 0.0 116-117 1.2375 0.0 0.0 0.0 0.0 118-119 1.25 0.0 0.0 0.0 0.0 120-121 1.35 0.0 0.0 0.0 0.0 122-123 1.5125000000000002 0.0 0.0 0.0 0.0 124-125 1.625 0.0 0.0 0.0 0.0 126-127 1.9375 0.0 0.0 0.0 0.0 128-129 2.1375 0.0 0.0 0.0 0.0 130-131 2.3 0.0 0.0 0.0 0.0 132-133 2.4625 0.0 0.0 0.0 0.0 134-135 2.6625 0.0 0.0 0.0 0.0 136-137 2.7625 0.0 0.0 0.0 0.0 138-139 2.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1005468 spots for SRR12671408.sra Written 1005468 spots for SRR12671408.sra Read 1005468 spots for SRR12671408.sra Written 1005468 spots for SRR12671408.sra Read 1005468 spots for SRR12671408.sra Written 1005468 spots for SRR12671408.sra Read 1005468 spots for SRR12671408.sra Written 1005468 spots for SRR12671408.sra Read 1005468 spots for SRR12671408.sra Written 1005468 spots for SRR12671408.sra Read 1005468 spots for SRR12671408.sra Written 1005468 spots for SRR12671408.sra Read 1005468 spots for SRR12671408.sra Written 1005468 spots for SRR12671408.sra Read 1005468 spots for SRR12671408.sra Written 1005468 spots for SRR12671408.sra Read 1005468 spots for SRR12671408.sra Written 1005468 spots for SRR12671408.sra Read 1005468 spots for SRR12671408.sra Written 1005468 spots for SRR12671408.sra Read 1005468 spots for SRR12671408.sra Written 1005468 spots for SRR12671408.sra Read 1005468 spots for SRR12671408.sra Written 1005468 spots for SRR12671408.sra Read 1005468 spots for SRR12671408.sra Written 1005468 spots for SRR12671408.sra Read 1005468 spots for SRR12671408.sra Written 1005468 spots for SRR12671408.sra Read 1005468 spots for SRR12671408.sra Written 1005468 spots for SRR12671408.sra Read 1005468 spots for SRR12671408.sra Written 1005468 spots for SRR12671408.sra Read 1005480 spots for SRR12671408.sra Written 1005480 spots for SRR12671408.sra Read 1005468 spots for SRR12671408.sra Written 1005468 spots for SRR12671408.sra Read 1005468 spots for SRR12671408.sra Written 1005468 spots for SRR12671408.sra Read 1005468 spots for SRR12671408.sra Written 1005468 spots for SRR12671408.sra SRR ids: ['SRR12671408.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zm80sw15 SRR12671408.sra spots: 20109372 blocks: [[1, 1005468], [1005469, 2010936], [2010937, 3016404], [3016405, 4021872], [4021873, 5027340], [5027341, 6032808], [6032809, 7038276], [7038277, 8043744], [8043745, 9049212], [9049213, 10054680], [10054681, 11060148], [11060149, 12065616], [12065617, 13071084], [13071085, 14076552], [14076553, 15082020], [15082021, 16087488], [16087489, 17092956], [17092957, 18098424], [18098425, 19103892], [19103893, 20109372]] SRR12671408 file size 6812344 SRR12671408 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671408 SRR12671408_1.fastq SRR12671408_2.fastq Input file: SRR12671408_1.fastq Paired file: SRR12671408_2.fastq trimmed: SRR12671408-trimmed-pair1.fastq, SRR12671408-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:41:55 2025 >> started Tue Feb 11 22:42:16 2025 >> done (21.147s) 20109372 read pairs processed; of these: 155 ( 0.00%) short read pairs filtered out after trimming by size control 2405 ( 0.01%) empty read pairs filtered out after trimming by size control 20106812 (99.99%) read pairs available; of these: 819825 ( 4.08%) trimmed read pairs available after processing 19286987 (95.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 11 0.00% 20 8 0.00% 21 12 0.00% 22 20 0.00% 23 18 0.00% 24 26 0.00% 25 14 0.00% 26 7 0.00% 27 16 0.00% 28 19 0.00% 29 20 0.00% 30 23 0.00% 31 27 0.00% 32 20 0.00% 33 24 0.00% 34 20 0.00% 35 25 0.00% 36 23 0.00% 37 32 0.00% 38 26 0.00% 39 25 0.00% 40 31 0.00% 41 32 0.00% 42 37 0.00% 43 28 0.00% 44 27 0.00% 45 35 0.00% 46 31 0.00% 47 31 0.00% 48 45 0.00% 49 52 0.00% 50 68 0.00% 51 76 0.00% 52 55 0.00% 53 59 0.00% 54 67 0.00% 55 80 0.00% 56 91 0.00% 57 80 0.00% 58 108 0.00% 59 109 0.00% 60 133 0.00% 61 138 0.00% 62 189 0.00% 63 165 0.00% 64 190 0.00% 65 221 0.00% 66 240 0.00% 67 256 0.00% 68 278 0.00% 69 320 0.00% 70 383 0.00% 71 431 0.00% 72 500 0.00% 73 571 0.00% 74 633 0.00% 75 625 0.00% 76 839 0.00% 77 755 0.00% 78 917 0.00% 79 1013 0.01% 80 1097 0.01% 81 1147 0.01% 82 1340 0.01% 83 1524 0.01% 84 1706 0.01% 85 1787 0.01% 86 2011 0.01% 87 2272 0.01% 88 2444 0.01% 89 2547 0.01% 90 2647 0.01% 91 2925 0.01% 92 2954 0.01% 93 3491 0.02% 94 3715 0.02% 95 4039 0.02% 96 4437 0.02% 97 4618 0.02% 98 4706 0.02% 99 5043 0.03% 100 5382 0.03% 101 5446 0.03% 102 6025 0.03% 103 6436 0.03% 104 6534 0.03% 105 6902 0.03% 106 7218 0.04% 107 7418 0.04% 108 7921 0.04% 109 8155 0.04% 110 8365 0.04% 111 8769 0.04% 112 9167 0.05% 113 9103 0.05% 114 9844 0.05% 115 10122 0.05% 116 10492 0.05% 117 11345 0.06% 118 11508 0.06% 119 11794 0.06% 120 12339 0.06% 121 12637 0.06% 122 12674 0.06% 123 13222 0.07% 124 13760 0.07% 125 13828 0.07% 126 14919 0.07% 127 15199 0.08% 128 15488 0.08% 129 15969 0.08% 130 16519 0.08% 131 16444 0.08% 132 17195 0.09% 133 17793 0.09% 134 17862 0.09% 135 18379 0.09% 136 19121 0.10% 137 19594 0.10% 138 19850 0.10% 139 21399 0.11% 140 21194 0.11% 141 21503 0.11% 142 22472 0.11% 143 22114 0.11% 144 22994 0.11% 145 23438 0.12% 146 24389 0.12% 147 24530 0.12% 148 25532 0.13% 149 25931 0.13% 150 26776 0.13% 151 19286987 95.92% 20106812 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=23 prefix-density=0.56 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=10.37 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=2.2 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=26 prefix-density=0.71 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.14 sequence-density-rank=28 fanout-score=30.63 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=8.3 sequence=AAAAAAGAAAGATGGCCTCGGCATCATTTCTCAAGTCATCACCAGTTCTAGACAAGTCTGAGTTTGTTAAGGGTCAGACCCTCCGCTTGCCTTCTGCCTCCATTGTCCGGTGCCGCTCCACCGCCCCTTCTGCTCTTACCGTTCGTGCTGGTTCCTATGCTGAGGAGCTTGTCAAAACCGCGAAAAC SRR12671408 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:43:02 Started mapping on | Feb 11 22:43:02 Finished on | Feb 11 22:45:15 Mapping speed, Million of reads per hour | 544.24 Number of input reads | 20106812 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 18692217 Uniquely mapped reads % | 92.96% Average mapped length | 298.53 Number of splices: Total | 18846312 Number of splices: Annotated (sjdb) | 18467178 Number of splices: GT/AG | 18476781 Number of splices: GC/AG | 304695 Number of splices: AT/AC | 10655 Number of splices: Non-canonical | 54181 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.03% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 504667 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 169633 % of reads mapped to too many loci | 0.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.47% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 909928 909928 909928 N_multimapping 504667 504667 504667 N_noFeature 783432 18388112 862365 N_ambiguous 363420 1289 137517 UnstrandedReadsAssigned:17545365 PositiveStrandReadsAssigned:302816 NegativeStrandReadsAssigned:17692335 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671408 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671408-trimmed-pair1.fastq SRR12671408-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,106,812 reads, 17,725,789 reads pseudoaligned [quant] estimated average fragment length: 306.362 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52401 SRR12671408.ke.tsv 34699 SRR12671408.se.tsv 87100 total ==> SRR12671408.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1712.64 1003 28.3711 Potri.005G024800.1.v4.1 1035 729.638 235 15.6028 Potri.004G059700.1.v4.1 961 655.963 3 0.221556 Potri.007G009000.2.v4.1 1416 1110.64 0 0 Potri.003G141000.2.v4.1 2943 2637.64 1182 21.7092 Potri.016G087400.1.v4.1 270 69.4428 735 512.745 Potri.015G069301.1.v4.1 564 280.747 0 0 Potri.010G195200.1.v4.1 1773 1467.64 82 2.70668 Potri.012G127500.1.v4.1 977 671.809 99 7.13889 ==> SRR12671408.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 150 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 179 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 6 SRR12671408 completed mapping pipeline successfully