Starting /dee2/code/volunteer_pipeline.sh SRR12671409 current disk space = 3052229451776 free memory = 1458970756 SRR12671409 SRAfilesize afa480c6ea271c29e955eb95103653f0 SRR12671409.sra SRR12671409.sra file validated SRR12671409 is paired end SRR12671409 is conventional basespace SRR12671409 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671409_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.6025 37.0 37.0 37.0 37.0 37.0 2 36.416 37.0 37.0 37.0 37.0 37.0 3 36.6165 37.0 37.0 37.0 37.0 37.0 4 36.639 37.0 37.0 37.0 37.0 37.0 5 36.609 37.0 37.0 37.0 37.0 37.0 6 36.695 37.0 37.0 37.0 37.0 37.0 7 36.5825 37.0 37.0 37.0 37.0 37.0 8 36.557 37.0 37.0 37.0 37.0 37.0 9 36.585 37.0 37.0 37.0 37.0 37.0 10-14 36.6459 37.0 37.0 37.0 37.0 37.0 15-19 36.6058 37.0 37.0 37.0 37.0 37.0 20-24 36.5781 37.0 37.0 37.0 37.0 37.0 25-29 36.5616 37.0 37.0 37.0 37.0 37.0 30-34 36.499700000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.466699999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.459199999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.4761 37.0 37.0 37.0 37.0 37.0 50-54 36.461 37.0 37.0 37.0 37.0 37.0 55-59 36.429 37.0 37.0 37.0 37.0 37.0 60-64 36.427499999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.41030000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.40780000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.3765 37.0 37.0 37.0 37.0 37.0 80-84 36.3478 37.0 37.0 37.0 37.0 37.0 85-89 36.30929999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.3357 37.0 37.0 37.0 37.0 37.0 95-99 36.270500000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.2538 37.0 37.0 37.0 37.0 37.0 105-109 36.259499999999996 37.0 37.0 37.0 37.0 37.0 110-114 36.15560000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.203700000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.177600000000005 37.0 37.0 37.0 37.0 37.0 125-129 36.1472 37.0 37.0 37.0 37.0 37.0 130-134 36.0746 37.0 37.0 37.0 37.0 37.0 135-139 36.1148 37.0 37.0 37.0 37.0 37.0 140-144 35.9933 37.0 37.0 37.0 37.0 37.0 145-149 36.0064 37.0 37.0 37.0 37.0 37.0 150-151 35.9095 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 1.0 25 4.0 26 3.0 27 5.0 28 9.0 29 15.0 30 21.0 31 40.0 32 41.0 33 55.0 34 109.0 35 276.0 36 2926.0 37 494.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.800000000000004 12.15 4.65 43.4 2 17.935871743486974 12.925851703406813 42.18436873747495 26.95390781563126 3 15.875 18.525 27.925 37.675 4 24.224999999999998 25.424999999999997 25.074999999999996 25.275 5 23.575 32.824999999999996 24.575 19.025 6 17.825 35.85 25.25 21.075 7 14.124999999999998 25.3 41.449999999999996 19.125 8 14.475 25.05 35.375 25.1 9 17.075000000000003 22.55 35.725 24.65 10-14 19.835 29.294999999999998 27.565 23.305 15-19 20.615 28.455000000000002 27.675 23.255 20-24 19.595000000000002 28.485 27.37 24.55 25-29 19.555 28.53 28.1 23.815 30-34 19.36 28.535 27.834999999999997 24.27 35-39 19.98 27.71 28.04 24.27 40-44 20.325 28.775000000000002 27.750000000000004 23.150000000000002 45-49 20.04 28.915000000000003 27.22 23.825 50-54 19.305 29.165000000000003 27.975 23.555 55-59 19.705000000000002 28.18 28.02 24.095 60-64 20.26 28.384999999999998 27.765 23.59 65-69 20.125 27.815 28.485 23.575 70-74 20.080000000000002 28.71 27.465 23.745 75-79 19.950000000000003 28.655 27.339999999999996 24.055 80-84 20.075000000000003 27.805000000000003 27.855 24.265 85-89 19.975 28.33 27.525 24.169999999999998 90-94 20.035 28.015 27.97 23.98 95-99 19.915 28.125 27.905 24.055 100-104 20.674999999999997 28.675 27.389999999999997 23.26 105-109 20.419999999999998 28.065 27.265 24.25 110-114 20.44 27.975 27.775 23.810000000000002 115-119 21.085 27.950000000000003 27.589999999999996 23.375 120-124 20.674999999999997 28.18 28.044999999999998 23.1 125-129 20.57 28.345 26.939999999999998 24.145 130-134 21.07 28.065 27.435 23.43 135-139 21.61 28.09 27.305 22.994999999999997 140-144 21.005 28.01 26.8 24.185000000000002 145-149 20.849999999999998 28.165000000000003 26.945000000000004 24.04 150-151 20.4125 27.5875 27.05 24.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 1.0 22 1.5 23 2.5 24 3.5 25 4.5 26 6.0 27 5.0 28 8.0 29 16.0 30 20.0 31 27.0 32 29.0 33 48.0 34 61.5 35 63.0 36 82.5 37 100.5 38 127.5 39 161.0 40 198.0 41 230.0 42 240.0 43 230.5 44 237.0 45 260.5 46 273.5 47 284.5 48 259.0 49 203.5 50 168.5 51 142.0 52 117.0 53 100.5 54 80.5 55 55.0 56 44.0 57 32.0 58 22.0 59 19.0 60 12.0 61 6.0 62 5.0 63 6.0 64 2.0 65 0.0 66 0.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.075 #Duplication Level Percentage of deduplicated Percentage of total 1 83.77971712308155 69.6 2 13.030394222088473 21.65 3 2.407463135720734 6.0 4 0.6018657839301835 2.0 5 0.18055973517905505 0.75 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCAATCAATTATTCGTCCAGTTGGTGTGTGTAAGATGACAGGATCTTCAG 5 0.125 No Hit CCGGAAAAAATAATCAATAACCCCTTCGAAGTGTGTTCACTGATCTCAAA 5 0.125 No Hit CACGGCGTAGAAGTAGCCATCTTGGGTGTCAAATAGATGGTCTATATTCT 5 0.125 No Hit GCTGCTAAACCGGTGTCAGATTCTTTAATGCCCCGAAGATCATTAATCTT 5 0.125 No Hit GCCTCTTTGTAGATGCTGACCGAGCTTTTCTAGGAACCGACACACCAATC 5 0.125 No Hit AGGTGACACCAGAAATCCCACCAAAGAAGAATCCTCCAGTGAACTTGGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0875 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.9125 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.2874999999999996 0.0 0.0 0.0 0.0 118-119 2.525 0.0 0.0 0.0 0.0 120-121 2.825 0.0 0.0 0.0 0.0 122-123 3.1625 0.0 0.0 0.0 0.0 124-125 3.4375 0.0 0.0 0.0 0.0 126-127 3.8 0.0 0.0 0.0 0.0 128-129 4.0875 0.0 0.0 0.0 0.0 130-131 4.45 0.0 0.0 0.0 0.0 132-133 4.887499999999999 0.0 0.0 0.0 0.0 134-135 5.262499999999999 0.0 0.0 0.0 0.0 136-137 5.6125 0.0 0.0 0.0 0.0 138-139 6.237500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671409 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671409_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3615 37.0 37.0 37.0 37.0 37.0 2 36.0645 37.0 37.0 37.0 37.0 37.0 3 36.2385 37.0 37.0 37.0 37.0 37.0 4 36.273 37.0 37.0 37.0 37.0 37.0 5 36.342 37.0 37.0 37.0 37.0 37.0 6 36.4115 37.0 37.0 37.0 37.0 37.0 7 36.3415 37.0 37.0 37.0 37.0 37.0 8 36.312 37.0 37.0 37.0 37.0 37.0 9 36.3435 37.0 37.0 37.0 37.0 37.0 10-14 36.3305 37.0 37.0 37.0 37.0 37.0 15-19 36.3169 37.0 37.0 37.0 37.0 37.0 20-24 36.215199999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.2395 37.0 37.0 37.0 37.0 37.0 30-34 36.206199999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.19540000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.1737 37.0 37.0 37.0 37.0 37.0 45-49 36.1511 37.0 37.0 37.0 37.0 37.0 50-54 36.1188 37.0 37.0 37.0 37.0 37.0 55-59 36.088300000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.0373 37.0 37.0 37.0 37.0 37.0 65-69 36.0517 37.0 37.0 37.0 37.0 37.0 70-74 36.018499999999996 37.0 37.0 37.0 37.0 37.0 75-79 36.0061 37.0 37.0 37.0 37.0 37.0 80-84 35.9322 37.0 37.0 37.0 37.0 37.0 85-89 35.9647 37.0 37.0 37.0 37.0 37.0 90-94 35.9799 37.0 37.0 37.0 37.0 37.0 95-99 35.944 37.0 37.0 37.0 37.0 37.0 100-104 35.9199 37.0 37.0 37.0 37.0 37.0 105-109 35.8752 37.0 37.0 37.0 37.0 37.0 110-114 35.7878 37.0 37.0 37.0 37.0 37.0 115-119 35.9293 37.0 37.0 37.0 37.0 37.0 120-124 35.8431 37.0 37.0 37.0 37.0 37.0 125-129 35.7827 37.0 37.0 37.0 37.0 37.0 130-134 35.641200000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.5892 37.0 37.0 37.0 37.0 37.0 140-144 35.68399999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.5638 37.0 37.0 37.0 37.0 37.0 150-151 35.3145 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 4.0 15 5.0 16 0.0 17 1.0 18 1.0 19 1.0 20 0.0 21 2.0 22 4.0 23 2.0 24 3.0 25 5.0 26 7.0 27 9.0 28 13.0 29 24.0 30 18.0 31 32.0 32 50.0 33 97.0 34 169.0 35 506.0 36 2712.0 37 333.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.275 24.3 7.75 28.675 2 24.425 26.474999999999998 35.6 13.5 3 19.05 27.3 33.025 20.625 4 23.825 35.325 23.425 17.424999999999997 5 23.7 39.025 21.4 15.875 6 19.275000000000002 39.800000000000004 22.225 18.7 7 19.1 20.4 41.075 19.425 8 18.0 24.75 31.35 25.900000000000002 9 21.525 24.175 30.575000000000003 23.724999999999998 10-14 22.715 29.975 26.21 21.099999999999998 15-19 23.27 28.610000000000003 27.334999999999997 20.785 20-24 22.64 28.794999999999998 27.87 20.695 25-29 23.165 27.815 28.03 20.990000000000002 30-34 22.085 28.050000000000004 28.075 21.790000000000003 35-39 22.185 28.050000000000004 28.005000000000003 21.759999999999998 40-44 22.54 27.58 28.155 21.725 45-49 22.63 27.045 28.725 21.6 50-54 22.25 28.105000000000004 27.91 21.735 55-59 22.395 28.375 28.345 20.885 60-64 22.805 27.575 28.244999999999997 21.375 65-69 22.845 28.29 28.03 20.835 70-74 23.200000000000003 27.384999999999998 28.155 21.26 75-79 22.27 27.595 28.675 21.46 80-84 23.195 27.865000000000002 27.99 20.95 85-89 23.9 27.785 27.589999999999996 20.724999999999998 90-94 23.06 28.139999999999997 27.52 21.279999999999998 95-99 23.61 28.24 27.889999999999997 20.26 100-104 23.905 28.125 26.93 21.04 105-109 23.265 28.499999999999996 27.79 20.445 110-114 23.810000000000002 28.494999999999997 26.935 20.76 115-119 24.245 28.18 27.665 19.91 120-124 23.59 29.515 26.595000000000002 20.3 125-129 23.73 28.74 26.674999999999997 20.855 130-134 24.51 27.584999999999997 27.255000000000003 20.65 135-139 24.37 28.035 27.500000000000004 20.095 140-144 24.975 28.249999999999996 27.365000000000002 19.41 145-149 25.332533253325334 27.457745774577457 27.262726272627262 19.946994699469947 150-151 27.287499999999998 27.775 26.05 18.8875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 2.5 24 3.5 25 3.5 26 4.0 27 8.5 28 13.5 29 12.0 30 13.0 31 24.5 32 33.0 33 37.0 34 44.5 35 71.5 36 96.5 37 107.5 38 126.5 39 161.0 40 197.5 41 227.0 42 268.0 43 292.0 44 295.0 45 280.5 46 256.0 47 228.5 48 219.5 49 211.5 50 159.5 51 116.5 52 102.0 53 78.5 54 69.0 55 62.5 56 39.0 57 32.0 58 24.5 59 18.0 60 17.0 61 13.0 62 8.0 63 4.0 64 3.5 65 2.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.7 #Duplication Level Percentage of deduplicated Percentage of total 1 84.67741935483872 70.875 2 12.395459976105137 20.75 3 2.0908004778972518 5.25 4 0.5973715651135006 2.0 5 0.14934289127837516 0.625 6 0.02986857825567503 0.15 7 0.05973715651135006 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit CTTTGCTTCTCCAGTCTTGGCTTCAGTGGCCTTTTAGGTTTAAGATTTGG 6 0.15 No Hit GTTTGCCATGGCCTACTACGTGATCAACTACTCCAAGCTCCGAATTTGGA 5 0.125 No Hit GTCTGATCGTAATCCTAAGCATTTGCTTGACCATGTATGGAGCTGCATCC 5 0.125 No Hit GTGGAGTTGCAAGAAACAACGAAGCTGCGAGATCGAAGAAAGGATCGAGA 5 0.125 No Hit GTATGCTCCTCTTATCCGTGATGGTCGTATGGAGAAATTCTACTGGGCTC 5 0.125 No Hit GTTTTCTCGCAGTGGTTAGGGAAGCGTTTGGTCCGTATAGTGATCCTCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.9125 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.3 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.8875 0.0 0.0 0.0 0.0 122-123 3.2375 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.875 0.0 0.0 0.0 0.0 128-129 4.1625 0.0 0.0 0.0 0.0 130-131 4.525 0.0 0.0 0.0 0.0 132-133 4.9625 0.0 0.0 0.0 0.0 134-135 5.3375 0.0 0.0 0.0 0.0 136-137 5.6875 0.0 0.0 0.0 0.0 138-139 6.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATACTGA 10 0.006830828 145.0 6 CAAACTC 10 0.006830828 145.0 2 >>END_MODULE Read 667135 spots for SRR12671409.sra Written 667135 spots for SRR12671409.sra Read 667135 spots for SRR12671409.sra Written 667135 spots for SRR12671409.sra Read 667135 spots for SRR12671409.sra Written 667135 spots for SRR12671409.sra Read 667135 spots for SRR12671409.sra Written 667135 spots for SRR12671409.sra Read 667135 spots for SRR12671409.sra Written 667135 spots for SRR12671409.sra Read 667135 spots for SRR12671409.sra Written 667135 spots for SRR12671409.sra Read 667135 spots for SRR12671409.sra Written 667135 spots for SRR12671409.sra Read 667135 spots for SRR12671409.sra Written 667135 spots for SRR12671409.sra Read 667135 spots for SRR12671409.sra Written 667135 spots for SRR12671409.sra Read 667135 spots for SRR12671409.sra Written 667135 spots for SRR12671409.sra Read 667135 spots for SRR12671409.sra Written 667135 spots for SRR12671409.sra Read 667135 spots for SRR12671409.sra Written 667135 spots for SRR12671409.sra Read 667135 spots for SRR12671409.sra Written 667135 spots for SRR12671409.sra Read 667135 spots for SRR12671409.sra Written 667135 spots for SRR12671409.sra Read 667135 spots for SRR12671409.sra Written 667135 spots for SRR12671409.sra Read 667152 spots for SRR12671409.sra Written 667152 spots for SRR12671409.sra Read 667135 spots for SRR12671409.sra Written 667135 spots for SRR12671409.sra Read 667135 spots for SRR12671409.sra Written 667135 spots for SRR12671409.sra Read 667135 spots for SRR12671409.sra Written 667135 spots for SRR12671409.sra Read 667135 spots for SRR12671409.sra Written 667135 spots for SRR12671409.sra SRR ids: ['SRR12671409.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_krf7cxx2 SRR12671409.sra spots: 13342717 blocks: [[1, 667135], [667136, 1334270], [1334271, 2001405], [2001406, 2668540], [2668541, 3335675], [3335676, 4002810], [4002811, 4669945], [4669946, 5337080], [5337081, 6004215], [6004216, 6671350], [6671351, 7338485], [7338486, 8005620], [8005621, 8672755], [8672756, 9339890], [9339891, 10007025], [10007026, 10674160], [10674161, 11341295], [11341296, 12008430], [12008431, 12675565], [12675566, 13342717]] SRR12671409 file size 4512738 SRR12671409 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671409 SRR12671409_1.fastq SRR12671409_2.fastq Input file: SRR12671409_1.fastq Paired file: SRR12671409_2.fastq trimmed: SRR12671409-trimmed-pair1.fastq, SRR12671409-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:36:47 2025 >> started Tue Feb 11 22:37:02 2025 >> done (15.597s) 13342717 read pairs processed; of these: 84 ( 0.00%) short read pairs filtered out after trimming by size control 366 ( 0.00%) empty read pairs filtered out after trimming by size control 13342267 (100.00%) read pairs available; of these: 1241549 ( 9.31%) trimmed read pairs available after processing 12100718 (90.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 6 0.00% 21 3 0.00% 22 8 0.00% 23 7 0.00% 24 7 0.00% 25 14 0.00% 26 8 0.00% 27 6 0.00% 28 10 0.00% 29 10 0.00% 30 10 0.00% 31 8 0.00% 32 8 0.00% 33 20 0.00% 34 10 0.00% 35 25 0.00% 36 11 0.00% 37 18 0.00% 38 24 0.00% 39 7 0.00% 40 35 0.00% 41 26 0.00% 42 21 0.00% 43 17 0.00% 44 25 0.00% 45 20 0.00% 46 20 0.00% 47 35 0.00% 48 49 0.00% 49 41 0.00% 50 54 0.00% 51 62 0.00% 52 61 0.00% 53 63 0.00% 54 65 0.00% 55 56 0.00% 56 91 0.00% 57 93 0.00% 58 109 0.00% 59 124 0.00% 60 143 0.00% 61 152 0.00% 62 185 0.00% 63 229 0.00% 64 244 0.00% 65 251 0.00% 66 327 0.00% 67 278 0.00% 68 368 0.00% 69 396 0.00% 70 513 0.00% 71 561 0.00% 72 637 0.00% 73 722 0.01% 74 795 0.01% 75 919 0.01% 76 1028 0.01% 77 1089 0.01% 78 1186 0.01% 79 1394 0.01% 80 1499 0.01% 81 1677 0.01% 82 1901 0.01% 83 2135 0.02% 84 2368 0.02% 85 2591 0.02% 86 2937 0.02% 87 3195 0.02% 88 3468 0.03% 89 3601 0.03% 90 4102 0.03% 91 4372 0.03% 92 4729 0.04% 93 5192 0.04% 94 5689 0.04% 95 6114 0.05% 96 6570 0.05% 97 7074 0.05% 98 7220 0.05% 99 7697 0.06% 100 8226 0.06% 101 8611 0.06% 102 9248 0.07% 103 9567 0.07% 104 10222 0.08% 105 10560 0.08% 106 11014 0.08% 107 11673 0.09% 108 12080 0.09% 109 12688 0.10% 110 13218 0.10% 111 13558 0.10% 112 14137 0.11% 113 14839 0.11% 114 15060 0.11% 115 15661 0.12% 116 16484 0.12% 117 17439 0.13% 118 18240 0.14% 119 18654 0.14% 120 19173 0.14% 121 19602 0.15% 122 20102 0.15% 123 20497 0.15% 124 21274 0.16% 125 22232 0.17% 126 23044 0.17% 127 23372 0.18% 128 23719 0.18% 129 24726 0.19% 130 25579 0.19% 131 25574 0.19% 132 26333 0.20% 133 27206 0.20% 134 27284 0.20% 135 28287 0.21% 136 29019 0.22% 137 29795 0.22% 138 30214 0.23% 139 32149 0.24% 140 32022 0.24% 141 32767 0.25% 142 33264 0.25% 143 33304 0.25% 144 33988 0.25% 145 34713 0.26% 146 35624 0.27% 147 35632 0.27% 148 37397 0.28% 149 37042 0.28% 150 38597 0.29% 151 12100718 90.69% 13342267 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=30 prefix-density=0.49 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=65.92 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.6 sequence=CAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=27 prefix-density=0.58 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=100.80 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.2 sequence=AAGGATGGTAGAGTAGCATCCTTAGCGTTGCTGGTTTACTTTCCTAACAATCCTCAAAACCATTCTTCTTAGACTCTCTATACATTCCAAATAACCTAATTTGTACTGTATAGATATATAGTCTACGTCAAGCTTAAATAAATCCTCATTAACATGGCCCCAGGAGTGCCTATAGATGGGAATATTTTGGGTACCGGGAAGGTTTCCACAGTTAACACTGGCTATTCTAAGAGGGCCTACGTGACATTTTTAGCCGGCAACGGGGATTATGTTAAAGGGGTAGTTGGGTTGGCTAAGGGTTTGCGCAAGGTGAAGAGTGCATACCCTCTTGTCGTAGCAATCTTGCCGGATGTGCCCGAGGAACACCGTGACATTTTGAGGTCTCAAGGTTGCATTGTTCGTGAGATCGAGCCTATTTATCCACCTGAGAACCAGATTCAGTTTGCCATGGCCTACTACGTGATCAACTACTCCAAGCTCCGAATTTGGAATTTTGAGGAGTACAGCAAGA SRR12671409 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:37:45 Started mapping on | Feb 11 22:37:46 Finished on | Feb 11 22:39:20 Mapping speed, Million of reads per hour | 510.98 Number of input reads | 13342267 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 12523667 Uniquely mapped reads % | 93.86% Average mapped length | 296.26 Number of splices: Total | 12736769 Number of splices: Annotated (sjdb) | 12492677 Number of splices: GT/AG | 12478987 Number of splices: GC/AG | 217197 Number of splices: AT/AC | 7123 Number of splices: Non-canonical | 33462 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280306 % of reads mapped to multiple loci | 2.10% Number of reads mapped to too many loci | 26903 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.75% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 538294 538294 538294 N_multimapping 280306 280306 280306 N_noFeature 465489 12332978 536579 N_ambiguous 191192 744 71141 UnstrandedReadsAssigned:11866986 PositiveStrandReadsAssigned:189945 NegativeStrandReadsAssigned:11915947 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671409 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671409-trimmed-pair1.fastq SRR12671409-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,342,267 reads, 11,902,842 reads pseudoaligned [quant] estimated average fragment length: 267.056 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,028 rounds 52401 SRR12671409.ke.tsv 34699 SRR12671409.se.tsv 87100 total ==> SRR12671409.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.94 302 13.7512 Potri.005G024800.1.v4.1 1035 768.944 200 20.7487 Potri.004G059700.1.v4.1 961 695.14 0 0 Potri.007G009000.2.v4.1 1416 1149.94 0 0 Potri.003G141000.2.v4.1 2943 2676.94 594 17.7012 Potri.016G087400.1.v4.1 270 82.9093 507 487.82 Potri.015G069301.1.v4.1 564 314.615 0 0 Potri.010G195200.1.v4.1 1773 1506.94 32 1.69398 Potri.012G127500.1.v4.1 977 711.038 39 4.37549 ==> SRR12671409.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 154 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12671409 completed mapping pipeline successfully