Starting /dee2/code/volunteer_pipeline.sh SRR12671411 current disk space = 3052462641152 free memory = 1453277776 SRR12671411 SRAfilesize 04be2d9aab82f080eca1764fe878a3fe SRR12671411.sra SRR12671411.sra file validated SRR12671411 is paired end SRR12671411 is conventional basespace SRR12671411 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671411_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4505 37.0 37.0 37.0 37.0 37.0 2 36.28075 37.0 37.0 37.0 37.0 37.0 3 36.47 37.0 37.0 37.0 37.0 37.0 4 36.5995 37.0 37.0 37.0 37.0 37.0 5 36.6245 37.0 37.0 37.0 37.0 37.0 6 36.593 37.0 37.0 37.0 37.0 37.0 7 36.4225 37.0 37.0 37.0 37.0 37.0 8 36.547 37.0 37.0 37.0 37.0 37.0 9 36.589 37.0 37.0 37.0 37.0 37.0 10-14 36.585 37.0 37.0 37.0 37.0 37.0 15-19 36.5982 37.0 37.0 37.0 37.0 37.0 20-24 36.4941 37.0 37.0 37.0 37.0 37.0 25-29 36.533100000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.4926 37.0 37.0 37.0 37.0 37.0 35-39 36.4468 37.0 37.0 37.0 37.0 37.0 40-44 36.3821 37.0 37.0 37.0 37.0 37.0 45-49 36.3439 37.0 37.0 37.0 37.0 37.0 50-54 36.3177 37.0 37.0 37.0 37.0 37.0 55-59 36.3078 37.0 37.0 37.0 37.0 37.0 60-64 36.3216 37.0 37.0 37.0 37.0 37.0 65-69 36.3288 37.0 37.0 37.0 37.0 37.0 70-74 36.29469999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.245599999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.220299999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.1871 37.0 37.0 37.0 37.0 37.0 90-94 36.2241 37.0 37.0 37.0 37.0 37.0 95-99 36.122 37.0 37.0 37.0 37.0 37.0 100-104 36.1495 37.0 37.0 37.0 37.0 37.0 105-109 36.1596 37.0 37.0 37.0 37.0 37.0 110-114 36.0813 37.0 37.0 37.0 37.0 37.0 115-119 36.0228 37.0 37.0 37.0 37.0 37.0 120-124 36.0209 37.0 37.0 37.0 37.0 37.0 125-129 36.0034 37.0 37.0 37.0 37.0 37.0 130-134 36.028 37.0 37.0 37.0 37.0 37.0 135-139 35.9259 37.0 37.0 37.0 37.0 37.0 140-144 35.9369 37.0 37.0 37.0 37.0 37.0 145-149 35.8532 37.0 37.0 37.0 37.0 37.0 150-151 35.701750000000004 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 3.0 21 1.0 22 2.0 23 4.0 24 6.0 25 6.0 26 6.0 27 10.0 28 8.0 29 21.0 30 20.0 31 34.0 32 42.0 33 76.0 34 110.0 35 277.0 36 2898.0 37 476.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 56.025000000000006 10.65 6.0249999999999995 27.3 2 20.51667920742413 10.634562327564586 38.2242287434161 30.624529721595184 3 17.125 19.925 29.575000000000003 33.375 4 22.625 24.875 25.25 27.250000000000004 5 22.675 31.974999999999998 26.35 19.0 6 18.925 33.300000000000004 26.424999999999997 21.349999999999998 7 13.25 27.525 43.55 15.675 8 16.3 24.2 34.675 24.825 9 16.275000000000002 22.975 36.15 24.6 10-14 19.715 29.835 28.389999999999997 22.06 15-19 19.939999999999998 28.970000000000002 27.6 23.49 20-24 19.74 29.375 27.700000000000003 23.185 25-29 19.875 29.095 27.474999999999998 23.555 30-34 19.755 29.09 28.199999999999996 22.955000000000002 35-39 19.97 29.630000000000003 27.625 22.775000000000002 40-44 19.97 28.585 27.615000000000002 23.830000000000002 45-49 19.85 29.110000000000003 27.334999999999997 23.705000000000002 50-54 19.919999999999998 30.259999999999998 26.625 23.195 55-59 19.645000000000003 28.96 28.02 23.375 60-64 20.599999999999998 28.565 27.61 23.225 65-69 19.985 29.360000000000003 27.16 23.494999999999997 70-74 20.075000000000003 28.935 27.785 23.205000000000002 75-79 20.125 28.395 28.125 23.355 80-84 20.07 28.975 27.83 23.125 85-89 20.380000000000003 29.134999999999998 26.834999999999997 23.65 90-94 19.869999999999997 28.360000000000003 27.96 23.810000000000002 95-99 20.365 28.660000000000004 27.54 23.435 100-104 20.61 29.220000000000002 26.939999999999998 23.23 105-109 20.575 29.215000000000003 26.584999999999997 23.625 110-114 19.91 28.65 28.050000000000004 23.39 115-119 20.305 28.71 27.694999999999997 23.29 120-124 20.135 29.085 27.060000000000002 23.72 125-129 21.205 27.79 27.35 23.655 130-134 20.465 28.4 27.04 24.095 135-139 20.064999999999998 28.53 27.339999999999996 24.065 140-144 20.865000000000002 27.845 27.51 23.78 145-149 20.65 28.225 27.395000000000003 23.73 150-151 19.725 28.537499999999998 27.725 24.0125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 1.5 5 1.5 6 0.0 7 0.0 8 0.5 9 1.5 10 1.0 11 1.0 12 1.5 13 0.5 14 0.5 15 1.5 16 1.5 17 1.0 18 1.5 19 1.5 20 1.0 21 1.5 22 3.0 23 3.5 24 4.5 25 10.5 26 16.0 27 14.5 28 13.5 29 19.5 30 19.5 31 27.0 32 35.5 33 46.5 34 67.0 35 74.0 36 84.5 37 101.5 38 133.5 39 174.5 40 192.5 41 193.0 42 217.5 43 251.0 44 275.0 45 277.5 46 267.5 47 252.5 48 209.5 49 183.0 50 164.5 51 135.5 52 121.5 53 97.5 54 72.5 55 57.0 56 45.0 57 37.0 58 20.0 59 15.0 60 18.0 61 12.0 62 4.5 63 4.0 64 3.5 65 1.0 66 0.0 67 1.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.325 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 83.775 #Duplication Level Percentage of deduplicated Percentage of total 1 84.33303491495077 70.65 2 12.682781259325573 21.25 3 2.4171888988361685 6.075 4 0.4476275738585497 1.5 5 0.08952551477170993 0.375 6 0.029841838257236648 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTACACTAATTATAAGACTTCATTAAAACCACACCAGAGGCC 6 0.15 No Hit GACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTG 5 0.125 No Hit GTACAGTCCTGGCTAGTCACTGTAATAATGAACCAGGAAAAAAAGGGGTG 5 0.125 No Hit CTCTCCTGGCAAAGTAAAGACCATAACTCCTTTATTGGGAGCACTAAACC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.2125 0.0 0.0 0.0 0.0 104-105 1.2875 0.0 0.0 0.0 0.0 106-107 1.4 0.0 0.0 0.0 0.0 108-109 1.55 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.9125 0.0 0.0 0.0 0.0 114-115 2.1125 0.0 0.0 0.0 0.0 116-117 2.2 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.7125000000000004 0.0 0.0 0.0 0.0 124-125 2.8375000000000004 0.0 0.0 0.0 0.0 126-127 2.9749999999999996 0.0 0.0 0.0 0.0 128-129 3.2375 0.0 0.0 0.0 0.0 130-131 3.4375 0.0 0.0 0.0 0.0 132-133 3.7375 0.0 0.0 0.0 0.0 134-135 4.0 0.0 0.0 0.0 0.0 136-137 4.2 0.0 0.0 0.0 0.0 138-139 4.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATTGAT 10 0.006830828 145.0 5 >>END_MODULE SRR12671411 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671411_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2295 37.0 37.0 37.0 37.0 37.0 2 35.7595 37.0 37.0 37.0 37.0 37.0 3 35.928 37.0 37.0 37.0 37.0 37.0 4 36.0575 37.0 37.0 37.0 37.0 37.0 5 36.176 37.0 37.0 37.0 37.0 37.0 6 36.0145 37.0 37.0 37.0 37.0 37.0 7 36.0945 37.0 37.0 37.0 37.0 37.0 8 36.0645 37.0 37.0 37.0 37.0 37.0 9 36.1815 37.0 37.0 37.0 37.0 37.0 10-14 36.088699999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.0702 37.0 37.0 37.0 37.0 37.0 20-24 36.0048 37.0 37.0 37.0 37.0 37.0 25-29 35.974000000000004 37.0 37.0 37.0 37.0 37.0 30-34 35.8855 37.0 37.0 37.0 37.0 37.0 35-39 35.97279999999999 37.0 37.0 37.0 37.0 37.0 40-44 35.9246 37.0 37.0 37.0 37.0 37.0 45-49 35.8618 37.0 37.0 37.0 37.0 37.0 50-54 35.818200000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.7884 37.0 37.0 37.0 37.0 37.0 60-64 35.801399999999994 37.0 37.0 37.0 37.0 37.0 65-69 35.7661 37.0 37.0 37.0 37.0 37.0 70-74 35.722500000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.7287 37.0 37.0 37.0 37.0 37.0 80-84 35.6857 37.0 37.0 37.0 37.0 37.0 85-89 35.7404 37.0 37.0 37.0 37.0 37.0 90-94 35.6832 37.0 37.0 37.0 37.0 37.0 95-99 35.6457 37.0 37.0 37.0 37.0 37.0 100-104 35.5722 37.0 37.0 37.0 37.0 37.0 105-109 35.4893 37.0 37.0 37.0 37.0 37.0 110-114 35.434999999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.5438 37.0 37.0 37.0 37.0 37.0 120-124 35.467 37.0 37.0 37.0 37.0 37.0 125-129 35.4213 37.0 37.0 37.0 37.0 37.0 130-134 35.345600000000005 37.0 37.0 37.0 34.6 37.0 135-139 35.2776 37.0 37.0 37.0 34.6 37.0 140-144 35.256499999999996 37.0 37.0 37.0 32.2 37.0 145-149 35.1899 37.0 37.0 37.0 32.2 37.0 150-151 34.9695 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 1.0 14 9.0 15 4.0 16 7.0 17 3.0 18 3.0 19 1.0 20 6.0 21 5.0 22 7.0 23 6.0 24 14.0 25 5.0 26 13.0 27 7.0 28 16.0 29 23.0 30 28.0 31 45.0 32 54.0 33 126.0 34 195.0 35 566.0 36 2630.0 37 224.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.625 24.349999999999998 6.825 19.2 2 27.85 24.075 31.775 16.3 3 19.775000000000002 27.775 34.9 17.549999999999997 4 25.25 34.975 22.400000000000002 17.375 5 25.924999999999997 39.324999999999996 18.7 16.05 6 20.525 39.925 20.575 18.975 7 19.950000000000003 23.45 38.5 18.099999999999998 8 18.65 25.15 29.75 26.450000000000003 9 21.55 23.549999999999997 29.799999999999997 25.1 10-14 23.549999999999997 29.39 26.474999999999998 20.585 15-19 23.515 29.32 26.465 20.7 20-24 22.805 28.685 27.54 20.97 25-29 23.0 28.325 28.294999999999998 20.380000000000003 30-34 23.5 28.315 28.03 20.155 35-39 22.81 28.275 27.994999999999997 20.919999999999998 40-44 24.02 27.534999999999997 27.834999999999997 20.61 45-49 23.305 27.705000000000002 28.544999999999998 20.445 50-54 23.255 28.095 27.92 20.73 55-59 23.275000000000002 28.095 27.395000000000003 21.235 60-64 23.125 27.700000000000003 28.07 21.105 65-69 23.22 27.575 27.83 21.375 70-74 23.29 28.23 28.15 20.330000000000002 75-79 23.14 27.584999999999997 27.639999999999997 21.634999999999998 80-84 23.044999999999998 28.015 27.63 21.310000000000002 85-89 23.145 27.965 28.165000000000003 20.724999999999998 90-94 23.09 27.67 28.494999999999997 20.745 95-99 23.51 27.744999999999997 27.985 20.76 100-104 23.3 27.99 27.77 20.94 105-109 24.51 27.589999999999996 27.725 20.175 110-114 23.845 28.17 27.68 20.305 115-119 23.865 28.199999999999996 28.265 19.67 120-124 23.875 28.07 27.785 20.27 125-129 24.29 28.310000000000002 26.97 20.43 130-134 24.915000000000003 27.905 27.650000000000002 19.53 135-139 24.13 27.195000000000004 28.384999999999998 20.29 140-144 24.48 26.97 27.860000000000003 20.69 145-149 24.67987194877951 27.74609843937575 27.616046418567425 19.95798319327731 150-151 24.675 27.8625 28.199999999999996 19.2625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.5 9 1.5 10 1.5 11 1.5 12 1.5 13 1.0 14 1.0 15 1.0 16 2.0 17 1.5 18 0.5 19 3.0 20 2.5 21 1.0 22 1.0 23 0.0 24 2.0 25 8.0 26 9.5 27 5.5 28 6.5 29 12.5 30 22.5 31 28.0 32 30.0 33 31.0 34 51.0 35 74.0 36 82.5 37 99.0 38 114.0 39 147.5 40 188.0 41 226.5 42 251.0 43 270.5 44 282.0 45 260.5 46 242.5 47 262.5 48 257.0 49 214.5 50 169.0 51 132.0 52 116.0 53 88.0 54 70.0 55 58.0 56 43.5 57 32.0 58 20.5 59 15.5 60 11.0 61 6.0 62 4.5 63 1.5 64 2.0 65 3.5 66 2.0 67 1.0 68 2.0 69 1.5 70 0.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.5 81 0.5 82 1.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.5 92 1.0 93 0.5 94 0.5 95 0.5 96 0.5 97 0.5 98 0.5 99 0.5 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.04 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.45 #Duplication Level Percentage of deduplicated Percentage of total 1 85.10953226761397 71.875 2 12.3149792776791 20.8 3 2.0130254588513914 5.1 4 0.4144464179988159 1.4000000000000001 5 0.059206631142687975 0.25 6 0.029603315571343988 0.15 7 0.029603315571343988 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.029603315571343988 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit GAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCA 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit AGAACTCCGGTCTTTTTTCTTTAATTCTTAATAGAACAAAATTATAACCT 5 0.125 No Hit CTATTGACTATTACAACCAGAAGAGATGTTTTGATGCAAAAGGGCTTGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.2375 0.0 0.0 0.0 0.0 104-105 1.2999999999999998 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.575 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 1.9375 0.0 0.0 0.0 0.0 114-115 2.125 0.0 0.0 0.0 0.0 116-117 2.2 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.7125000000000004 0.0 0.0 0.0 0.0 124-125 2.8375000000000004 0.0 0.0 0.0 0.0 126-127 2.9749999999999996 0.0 0.0 0.0 0.0 128-129 3.2375 0.0 0.0 0.0 0.0 130-131 3.4375 0.0 0.0 0.0 0.0 132-133 3.7125 0.0 0.0 0.0 0.0 134-135 3.9875 0.0 0.0 0.0 0.0 136-137 4.2 0.0 0.0 0.0 0.0 138-139 4.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 947265 spots for SRR12671411.sra Written 947265 spots for SRR12671411.sra Read 947265 spots for SRR12671411.sra Written 947265 spots for SRR12671411.sra Read 947265 spots for SRR12671411.sra Written 947265 spots for SRR12671411.sra Read 947265 spots for SRR12671411.sra Written 947265 spots for SRR12671411.sra Read 947265 spots for SRR12671411.sra Written 947265 spots for SRR12671411.sra Read 947265 spots for SRR12671411.sra Written 947265 spots for SRR12671411.sra Read 947265 spots for SRR12671411.sra Written 947265 spots for SRR12671411.sra Read 947265 spots for SRR12671411.sra Written 947265 spots for SRR12671411.sra Read 947265 spots for SRR12671411.sra Written 947265 spots for SRR12671411.sra Read 947265 spots for SRR12671411.sra Written 947265 spots for SRR12671411.sra Read 947265 spots for SRR12671411.sra Written 947265 spots for SRR12671411.sra Read 947266 spots for SRR12671411.sra Written 947266 spots for SRR12671411.sra Read 947265 spots for SRR12671411.sra Written 947265 spots for SRR12671411.sra Read 947265 spots for SRR12671411.sra Written 947265 spots for SRR12671411.sra Read 947265 spots for SRR12671411.sra Written 947265 spots for SRR12671411.sra Read 947265 spots for SRR12671411.sra Written 947265 spots for SRR12671411.sra Read 947265 spots for SRR12671411.sra Written 947265 spots for SRR12671411.sra Read 947265 spots for SRR12671411.sra Written 947265 spots for SRR12671411.sra Read 947265 spots for SRR12671411.sra Written 947265 spots for SRR12671411.sra Read 947265 spots for SRR12671411.sra Written 947265 spots for SRR12671411.sra SRR ids: ['SRR12671411.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_27jdsxel SRR12671411.sra spots: 18945301 blocks: [[1, 947265], [947266, 1894530], [1894531, 2841795], [2841796, 3789060], [3789061, 4736325], [4736326, 5683590], [5683591, 6630855], [6630856, 7578120], [7578121, 8525385], [8525386, 9472650], [9472651, 10419915], [10419916, 11367180], [11367181, 12314445], [12314446, 13261710], [13261711, 14208975], [14208976, 15156240], [15156241, 16103505], [16103506, 17050770], [17050771, 17998035], [17998036, 18945301]] SRR12671411 file size 6416741 SRR12671411 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671411 SRR12671411_1.fastq SRR12671411_2.fastq Input file: SRR12671411_1.fastq Paired file: SRR12671411_2.fastq trimmed: SRR12671411-trimmed-pair1.fastq, SRR12671411-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:57:42 2025 >> started Tue Feb 11 22:58:03 2025 >> done (21.824s) 18945301 read pairs processed; of these: 162 ( 0.00%) short read pairs filtered out after trimming by size control 3911 ( 0.02%) empty read pairs filtered out after trimming by size control 18941228 (99.98%) read pairs available; of these: 1235387 ( 6.52%) trimmed read pairs available after processing 17705841 (93.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 18 0.00% 20 27 0.00% 21 28 0.00% 22 26 0.00% 23 38 0.00% 24 46 0.00% 25 52 0.00% 26 63 0.00% 27 49 0.00% 28 64 0.00% 29 56 0.00% 30 65 0.00% 31 59 0.00% 32 75 0.00% 33 57 0.00% 34 56 0.00% 35 51 0.00% 36 51 0.00% 37 77 0.00% 38 54 0.00% 39 72 0.00% 40 66 0.00% 41 66 0.00% 42 71 0.00% 43 77 0.00% 44 66 0.00% 45 91 0.00% 46 102 0.00% 47 106 0.00% 48 113 0.00% 49 113 0.00% 50 167 0.00% 51 139 0.00% 52 175 0.00% 53 203 0.00% 54 203 0.00% 55 218 0.00% 56 217 0.00% 57 278 0.00% 58 308 0.00% 59 365 0.00% 60 431 0.00% 61 484 0.00% 62 470 0.00% 63 651 0.00% 64 649 0.00% 65 619 0.00% 66 734 0.00% 67 807 0.00% 68 885 0.00% 69 1056 0.01% 70 1208 0.01% 71 1374 0.01% 72 1583 0.01% 73 1816 0.01% 74 1875 0.01% 75 2053 0.01% 76 2308 0.01% 77 2482 0.01% 78 2641 0.01% 79 2940 0.02% 80 3348 0.02% 81 3555 0.02% 82 4033 0.02% 83 4335 0.02% 84 4752 0.03% 85 5277 0.03% 86 5378 0.03% 87 5741 0.03% 88 6093 0.03% 89 6365 0.03% 90 6948 0.04% 91 7360 0.04% 92 7709 0.04% 93 8153 0.04% 94 8976 0.05% 95 9400 0.05% 96 9736 0.05% 97 10007 0.05% 98 10150 0.05% 99 10882 0.06% 100 11288 0.06% 101 11370 0.06% 102 12211 0.06% 103 12572 0.07% 104 13121 0.07% 105 13198 0.07% 106 13836 0.07% 107 14058 0.07% 108 14181 0.07% 109 14503 0.08% 110 14755 0.08% 111 15371 0.08% 112 15741 0.08% 113 16155 0.09% 114 16410 0.09% 115 17012 0.09% 116 17778 0.09% 117 17869 0.09% 118 17998 0.10% 119 18625 0.10% 120 18983 0.10% 121 19345 0.10% 122 19547 0.10% 123 20292 0.11% 124 20669 0.11% 125 20824 0.11% 126 21370 0.11% 127 21560 0.11% 128 22064 0.12% 129 22566 0.12% 130 23010 0.12% 131 22879 0.12% 132 23316 0.12% 133 23964 0.13% 134 24190 0.13% 135 24966 0.13% 136 25422 0.13% 137 25529 0.13% 138 25684 0.14% 139 26261 0.14% 140 26134 0.14% 141 26626 0.14% 142 27161 0.14% 143 27525 0.15% 144 28466 0.15% 145 28728 0.15% 146 29054 0.15% 147 29998 0.16% 148 30453 0.16% 149 30294 0.16% 150 30945 0.16% 151 17705841 93.48% 18941228 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=33 prefix-density=0.69 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=411.36 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=15.4 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=36 prefix-density=0.81 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=27.28 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=2.6 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGGCCTCTCTGCTGACCCAGAGACCTTTGCCAAGAACCGTGAGCTTGAAGTCATCCATTCCAGGTGGGCCATGCTTGGAGCTCTTGGATGCGTCTTCCCCGAGCTCTTGTCCCGCAACGGTGTCAAGTTCGGCGAGGCTGTATGGTTCAAGGCTGGAGCCCAGATCTTCAGCGAGGGTGGACTTGACTACTTGGGCAACCCAAGCTTGATCCAC SRR12671411 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:59:09 Started mapping on | Feb 11 22:59:09 Finished on | Feb 11 23:01:01 Mapping speed, Million of reads per hour | 608.83 Number of input reads | 18941228 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 16378837 Uniquely mapped reads % | 86.47% Average mapped length | 290.04 Number of splices: Total | 16361515 Number of splices: Annotated (sjdb) | 16032720 Number of splices: GT/AG | 16030016 Number of splices: GC/AG | 273194 Number of splices: AT/AC | 9013 Number of splices: Non-canonical | 49292 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 445386 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 36426 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.80% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2117005 2117005 2117005 N_multimapping 445386 445386 445386 N_noFeature 545741 16134099 620687 N_ambiguous 313978 1757 143180 UnstrandedReadsAssigned:15519118 PositiveStrandReadsAssigned:242981 NegativeStrandReadsAssigned:15614970 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=143 echo kmer=139 SRR12671411 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671411-trimmed-pair1.fastq SRR12671411-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,941,228 reads, 16,530,071 reads pseudoaligned [quant] estimated average fragment length: 282.927 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR12671411.ke.tsv 34699 SRR12671411.se.tsv 87100 total ==> SRR12671411.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.07 632 20.3848 Potri.005G024800.1.v4.1 1035 753.073 516 38.3681 Potri.004G059700.1.v4.1 961 679.348 0 0 Potri.007G009000.2.v4.1 1416 1134.07 0 0 Potri.003G141000.2.v4.1 2943 2661.07 1005.49 21.1581 Potri.016G087400.1.v4.1 270 82.1046 1033 704.514 Potri.015G069301.1.v4.1 564 301.224 0 0 Potri.010G195200.1.v4.1 1773 1491.07 77 2.89167 Potri.012G127500.1.v4.1 977 695.205 63 5.07441 ==> SRR12671411.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 172 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 232 Potri.001G212900.v4.1 12 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR12671411 completed mapping pipeline successfully