Starting /dee2/code/volunteer_pipeline.sh SRR12671412 current disk space = 3052480647168 free memory = 1538882988 SRR12671412 SRAfilesize 3aec3d2f626c11f2e18fd3af6da37722 SRR12671412.sra SRR12671412.sra file validated SRR12671412 is paired end SRR12671412 is conventional basespace SRR12671412 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671412_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.652 37.0 37.0 37.0 37.0 37.0 2 36.4005 37.0 37.0 37.0 37.0 37.0 3 36.536 37.0 37.0 37.0 37.0 37.0 4 36.5945 37.0 37.0 37.0 37.0 37.0 5 36.6615 37.0 37.0 37.0 37.0 37.0 6 36.629 37.0 37.0 37.0 37.0 37.0 7 36.544 37.0 37.0 37.0 37.0 37.0 8 36.58 37.0 37.0 37.0 37.0 37.0 9 36.641 37.0 37.0 37.0 37.0 37.0 10-14 36.64209999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.6323 37.0 37.0 37.0 37.0 37.0 20-24 36.5824 37.0 37.0 37.0 37.0 37.0 25-29 36.53490000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.5325 37.0 37.0 37.0 37.0 37.0 35-39 36.4966 37.0 37.0 37.0 37.0 37.0 40-44 36.4214 37.0 37.0 37.0 37.0 37.0 45-49 36.37220000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.403999999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.35260000000001 37.0 37.0 37.0 37.0 37.0 60-64 36.39919999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.3438 37.0 37.0 37.0 37.0 37.0 70-74 36.36559999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.324 37.0 37.0 37.0 37.0 37.0 80-84 36.2413 37.0 37.0 37.0 37.0 37.0 85-89 36.254900000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.2821 37.0 37.0 37.0 37.0 37.0 95-99 36.183 37.0 37.0 37.0 37.0 37.0 100-104 36.1726 37.0 37.0 37.0 37.0 37.0 105-109 36.2516 37.0 37.0 37.0 37.0 37.0 110-114 36.1068 37.0 37.0 37.0 37.0 37.0 115-119 36.156099999999995 37.0 37.0 37.0 37.0 37.0 120-124 36.0869 37.0 37.0 37.0 37.0 37.0 125-129 36.085 37.0 37.0 37.0 37.0 37.0 130-134 36.029399999999995 37.0 37.0 37.0 37.0 37.0 135-139 36.037099999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.943799999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.9063 37.0 37.0 37.0 37.0 37.0 150-151 35.91825 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 0.0 20 1.0 21 4.0 22 2.0 23 6.0 24 3.0 25 8.0 26 4.0 27 5.0 28 8.0 29 4.0 30 14.0 31 41.0 32 39.0 33 74.0 34 98.0 35 260.0 36 2960.0 37 468.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.95 11.525 6.8500000000000005 37.675 2 19.398496240601503 11.829573934837093 37.24310776942356 31.528822055137844 3 18.875 17.375 28.925 34.825 4 23.0 24.9 23.525 28.575 5 24.425 30.775000000000002 23.799999999999997 21.0 6 18.775 33.900000000000006 25.1 22.225 7 13.975000000000001 26.125 43.55 16.35 8 16.625 24.775 33.225 25.374999999999996 9 16.825000000000003 24.175 35.975 23.025000000000002 10-14 19.495 29.68 28.000000000000004 22.825 15-19 20.04 28.325 27.779999999999998 23.855 20-24 19.99 28.299999999999997 27.839999999999996 23.87 25-29 20.565 28.075 27.67 23.69 30-34 19.994999999999997 28.410000000000004 27.725 23.87 35-39 20.294999999999998 28.645 27.060000000000002 24.0 40-44 19.72 28.055000000000003 28.17 24.055 45-49 19.945 29.349999999999998 26.950000000000003 23.755000000000003 50-54 20.075000000000003 29.38 27.224999999999998 23.32 55-59 20.13 29.615000000000002 26.584999999999997 23.669999999999998 60-64 19.17 28.994999999999997 27.555000000000003 24.279999999999998 65-69 20.349999999999998 28.275 27.589999999999996 23.785 70-74 20.04 28.720000000000002 27.115000000000002 24.125 75-79 19.939999999999998 28.42 27.97 23.669999999999998 80-84 20.13 28.355000000000004 27.35 24.165 85-89 20.185 28.49 27.034999999999997 24.29 90-94 20.13 28.645 27.389999999999997 23.835 95-99 19.945 28.93 27.139999999999997 23.985 100-104 19.955000000000002 29.29 27.295 23.46 105-109 20.599999999999998 27.634999999999998 27.445000000000004 24.32 110-114 20.555 28.060000000000002 27.779999999999998 23.605 115-119 20.95 28.71 26.605 23.735 120-124 21.215 27.96 27.005000000000003 23.82 125-129 20.89 28.15 27.43 23.53 130-134 20.085 28.055000000000003 27.615000000000002 24.245 135-139 21.154999999999998 28.28 26.495 24.07 140-144 20.885 27.860000000000003 27.52 23.735 145-149 20.915 28.439999999999998 27.150000000000002 23.494999999999997 150-151 21.0375 27.212500000000002 26.887499999999996 24.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.0 5 0.5 6 2.0 7 2.0 8 1.0 9 0.5 10 0.5 11 1.0 12 0.5 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.5 21 2.0 22 2.0 23 2.0 24 3.5 25 6.0 26 7.0 27 11.5 28 18.5 29 19.0 30 19.0 31 27.5 32 25.5 33 33.5 34 62.5 35 78.5 36 90.5 37 117.5 38 140.5 39 152.5 40 165.5 41 182.5 42 210.5 43 230.5 44 239.5 45 244.5 46 255.5 47 244.5 48 223.5 49 208.5 50 190.0 51 163.5 52 135.0 53 115.0 54 79.5 55 61.5 56 57.0 57 38.0 58 28.0 59 31.5 60 27.5 61 17.0 62 7.5 63 3.5 64 2.0 65 1.0 66 1.0 67 1.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 84.575 #Duplication Level Percentage of deduplicated Percentage of total 1 84.65858705291161 71.6 2 12.858409695536507 21.75 3 2.069169376293231 5.25 4 0.4138338752586462 1.4000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.6 0.0 0.0 0.0 0.0 114-115 0.7124999999999999 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.9375 0.0 0.0 0.0 0.0 120-121 1.075 0.0 0.0 0.0 0.0 122-123 1.125 0.0 0.0 0.0 0.0 124-125 1.2125 0.0 0.0 0.0 0.0 126-127 1.3125 0.0 0.0 0.0 0.0 128-129 1.4 0.0 0.0 0.0 0.0 130-131 1.4625 0.0 0.0 0.0 0.0 132-133 1.65 0.0 0.0 0.0 0.0 134-135 1.8625 0.0 0.0 0.0 0.0 136-137 1.95 0.0 0.0 0.0 0.0 138-139 2.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCGGG 10 0.006830828 145.0 6 GTCAGAT 10 0.006830828 145.0 1 >>END_MODULE SRR12671412 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671412_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.245 37.0 37.0 37.0 37.0 37.0 2 35.815 37.0 37.0 37.0 37.0 37.0 3 36.0595 37.0 37.0 37.0 37.0 37.0 4 36.1155 37.0 37.0 37.0 37.0 37.0 5 36.1365 37.0 37.0 37.0 37.0 37.0 6 36.1265 37.0 37.0 37.0 37.0 37.0 7 36.06 37.0 37.0 37.0 37.0 37.0 8 36.1155 37.0 37.0 37.0 37.0 37.0 9 36.1 37.0 37.0 37.0 37.0 37.0 10-14 36.14450000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.13440000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.064499999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.051300000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.0099 37.0 37.0 37.0 37.0 37.0 35-39 35.910399999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.9608 37.0 37.0 37.0 37.0 37.0 45-49 35.919500000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.9096 37.0 37.0 37.0 37.0 37.0 55-59 35.8113 37.0 37.0 37.0 37.0 37.0 60-64 35.8606 37.0 37.0 37.0 37.0 37.0 65-69 35.8356 37.0 37.0 37.0 37.0 37.0 70-74 35.7543 37.0 37.0 37.0 37.0 37.0 75-79 35.759100000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.726800000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.721199999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.75920000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.647800000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.6124 37.0 37.0 37.0 37.0 37.0 105-109 35.5826 37.0 37.0 37.0 37.0 37.0 110-114 35.557100000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.612300000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.5967 37.0 37.0 37.0 37.0 37.0 125-129 35.569399999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.4411 37.0 37.0 37.0 37.0 37.0 135-139 35.3904 37.0 37.0 37.0 34.6 37.0 140-144 35.455600000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.431 37.0 37.0 37.0 34.6 37.0 150-151 35.06225 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 3.0 14 4.0 15 2.0 16 2.0 17 3.0 18 1.0 19 3.0 20 2.0 21 5.0 22 3.0 23 3.0 24 3.0 25 12.0 26 12.0 27 8.0 28 26.0 29 22.0 30 23.0 31 44.0 32 68.0 33 106.0 34 220.0 35 638.0 36 2567.0 37 220.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.625 22.975 9.65 24.75 2 25.55 27.275 31.3 15.875 3 19.45 29.075 32.875 18.6 4 24.175 36.199999999999996 21.625 18.0 5 23.9 38.574999999999996 20.5 17.025000000000002 6 19.0 39.75 22.3 18.95 7 19.1 21.349999999999998 39.925 19.625 8 19.45 26.825 29.675 24.05 9 22.25 23.599999999999998 30.45 23.7 10-14 22.525000000000002 29.075 27.605 20.794999999999998 15-19 23.21 27.71 27.900000000000002 21.18 20-24 22.295 28.32 28.08 21.305 25-29 22.905 28.075 27.794999999999998 21.224999999999998 30-34 22.33 28.455000000000002 27.93 21.285 35-39 22.905 27.815 28.175 21.105 40-44 22.86 27.900000000000002 27.950000000000003 21.29 45-49 22.720000000000002 27.96 28.235 21.085 50-54 23.244999999999997 28.389999999999997 27.37 20.995 55-59 23.43 27.21 27.92 21.44 60-64 24.04 27.1 27.905 20.955 65-69 22.650000000000002 27.1 28.21 22.040000000000003 70-74 23.305 27.825 27.41 21.46 75-79 22.335 28.895 27.005000000000003 21.765 80-84 22.895 28.4 26.974999999999998 21.73 85-89 23.69 27.284999999999997 27.47 21.555 90-94 23.45 27.955000000000002 27.395000000000003 21.2 95-99 23.005 28.139999999999997 27.775 21.08 100-104 23.65 27.189999999999998 27.634999999999998 21.525 105-109 23.32 27.42 27.57 21.69 110-114 23.27 27.689999999999998 28.055000000000003 20.985 115-119 24.169999999999998 27.665 27.24 20.925 120-124 23.3 27.74 27.58 21.38 125-129 23.875 26.974999999999998 27.99 21.16 130-134 23.45 28.050000000000004 27.400000000000002 21.099999999999998 135-139 24.015 26.884999999999998 28.4 20.7 140-144 23.98 28.189999999999998 27.634999999999998 20.195 145-149 24.27 27.339999999999996 27.82 20.57 150-151 24.4875 27.650000000000002 27.500000000000004 20.3625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.5 9 1.5 10 1.0 11 0.5 12 1.0 13 1.5 14 1.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.5 21 2.5 22 3.0 23 3.0 24 4.5 25 4.5 26 1.5 27 7.5 28 11.5 29 12.0 30 18.5 31 20.5 32 24.0 33 33.0 34 48.0 35 71.0 36 88.0 37 105.0 38 133.0 39 167.0 40 186.5 41 207.5 42 227.5 43 239.5 44 263.0 45 273.5 46 270.0 47 258.0 48 232.0 49 204.0 50 178.0 51 136.5 52 117.0 53 104.5 54 77.0 55 63.5 56 54.0 57 40.5 58 26.0 59 17.0 60 11.0 61 8.5 62 8.5 63 8.5 64 3.5 65 0.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 1.0 98 1.0 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 85.2 #Duplication Level Percentage of deduplicated Percentage of total 1 85.71009389671362 73.02499999999999 2 11.883802816901408 20.25 3 1.9072769953051645 4.875 4 0.3814553990610329 1.3 5 0.08802816901408451 0.375 6 0.0 0.0 7 0.029342723004694836 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 7 0.17500000000000002 No Hit CTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATCA 5 0.125 No Hit AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.3625 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.6875 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.9125 0.0 0.0 0.0 0.0 120-121 1.05 0.0 0.0 0.0 0.0 122-123 1.1 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.2625000000000002 0.0 0.0 0.0 0.0 128-129 1.35 0.0 0.0 0.0 0.0 130-131 1.4125 0.0 0.0 0.0 0.0 132-133 1.6 0.0 0.0 0.0 0.0 134-135 1.8125 0.0 0.0 0.0 0.0 136-137 1.9 0.0 0.0 0.0 0.0 138-139 2.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 30 0.0014437955 24.166668 140-144 >>END_MODULE Read 890607 spots for SRR12671412.sra Written 890607 spots for SRR12671412.sra Read 890607 spots for SRR12671412.sra Written 890607 spots for SRR12671412.sra Read 890607 spots for SRR12671412.sra Written 890607 spots for SRR12671412.sra Read 890607 spots for SRR12671412.sra Written 890607 spots for SRR12671412.sra Read 890607 spots for SRR12671412.sra Written 890607 spots for SRR12671412.sra Read 890607 spots for SRR12671412.sra Written 890607 spots for SRR12671412.sra Read 890607 spots for SRR12671412.sra Written 890607 spots for SRR12671412.sra Read 890607 spots for SRR12671412.sra Written 890607 spots for SRR12671412.sra Read 890607 spots for SRR12671412.sra Written 890607 spots for SRR12671412.sra Read 890607 spots for SRR12671412.sra Written 890607 spots for SRR12671412.sra Read 890607 spots for SRR12671412.sra Written 890607 spots for SRR12671412.sra Read 890607 spots for SRR12671412.sra Written 890607 spots for SRR12671412.sra Read 890607 spots for SRR12671412.sra Written 890607 spots for SRR12671412.sra Read 890607 spots for SRR12671412.sra Written 890607 spots for SRR12671412.sra Read 890607 spots for SRR12671412.sra Written 890607 spots for SRR12671412.sra Read 890607 spots for SRR12671412.sra Written 890607 spots for SRR12671412.sra Read 890607 spots for SRR12671412.sra Written 890607 spots for SRR12671412.sra Read 890607 spots for SRR12671412.sra Written 890607 spots for SRR12671412.sra Read 890626 spots for SRR12671412.sra Written 890626 spots for SRR12671412.sra Read 890607 spots for SRR12671412.sra Written 890607 spots for SRR12671412.sra SRR ids: ['SRR12671412.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vzqcynxu SRR12671412.sra spots: 17812159 blocks: [[1, 890607], [890608, 1781214], [1781215, 2671821], [2671822, 3562428], [3562429, 4453035], [4453036, 5343642], [5343643, 6234249], [6234250, 7124856], [7124857, 8015463], [8015464, 8906070], [8906071, 9796677], [9796678, 10687284], [10687285, 11577891], [11577892, 12468498], [12468499, 13359105], [13359106, 14249712], [14249713, 15140319], [15140320, 16030926], [16030927, 16921533], [16921534, 17812159]] SRR12671412 file size 6031650 SRR12671412 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671412 SRR12671412_1.fastq SRR12671412_2.fastq Input file: SRR12671412_1.fastq Paired file: SRR12671412_2.fastq trimmed: SRR12671412-trimmed-pair1.fastq, SRR12671412-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:00:57 2025 >> started Tue Feb 11 23:01:26 2025 >> done (28.260s) 17812159 read pairs processed; of these: 113 ( 0.00%) short read pairs filtered out after trimming by size control 3459 ( 0.02%) empty read pairs filtered out after trimming by size control 17808587 (99.98%) read pairs available; of these: 630959 ( 3.54%) trimmed read pairs available after processing 17177628 (96.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 5 0.00% 21 10 0.00% 22 9 0.00% 23 14 0.00% 24 8 0.00% 25 12 0.00% 26 15 0.00% 27 21 0.00% 28 19 0.00% 29 12 0.00% 30 13 0.00% 31 14 0.00% 32 17 0.00% 33 17 0.00% 34 17 0.00% 35 16 0.00% 36 18 0.00% 37 18 0.00% 38 17 0.00% 39 27 0.00% 40 12 0.00% 41 30 0.00% 42 30 0.00% 43 29 0.00% 44 23 0.00% 45 27 0.00% 46 34 0.00% 47 40 0.00% 48 40 0.00% 49 36 0.00% 50 56 0.00% 51 58 0.00% 52 51 0.00% 53 51 0.00% 54 59 0.00% 55 85 0.00% 56 86 0.00% 57 85 0.00% 58 93 0.00% 59 108 0.00% 60 135 0.00% 61 132 0.00% 62 152 0.00% 63 163 0.00% 64 181 0.00% 65 228 0.00% 66 237 0.00% 67 229 0.00% 68 253 0.00% 69 282 0.00% 70 345 0.00% 71 353 0.00% 72 441 0.00% 73 585 0.00% 74 577 0.00% 75 660 0.00% 76 709 0.00% 77 749 0.00% 78 805 0.00% 79 917 0.01% 80 999 0.01% 81 1128 0.01% 82 1226 0.01% 83 1317 0.01% 84 1527 0.01% 85 1664 0.01% 86 1790 0.01% 87 1999 0.01% 88 2027 0.01% 89 2200 0.01% 90 2268 0.01% 91 2594 0.01% 92 2609 0.01% 93 2865 0.02% 94 3186 0.02% 95 3515 0.02% 96 3628 0.02% 97 3833 0.02% 98 3984 0.02% 99 4216 0.02% 100 4328 0.02% 101 4497 0.03% 102 4877 0.03% 103 5079 0.03% 104 5438 0.03% 105 5514 0.03% 106 5973 0.03% 107 6215 0.03% 108 6345 0.04% 109 6538 0.04% 110 6503 0.04% 111 6924 0.04% 112 7149 0.04% 113 7291 0.04% 114 7718 0.04% 115 7976 0.04% 116 8313 0.05% 117 8876 0.05% 118 8831 0.05% 119 8978 0.05% 120 9412 0.05% 121 9676 0.05% 122 9802 0.06% 123 10247 0.06% 124 10611 0.06% 125 10744 0.06% 126 11373 0.06% 127 11667 0.07% 128 11675 0.07% 129 12138 0.07% 130 12155 0.07% 131 12500 0.07% 132 12775 0.07% 133 13443 0.08% 134 13636 0.08% 135 14040 0.08% 136 14064 0.08% 137 14589 0.08% 138 15119 0.08% 139 15618 0.09% 140 15893 0.09% 141 16110 0.09% 142 16321 0.09% 143 16626 0.09% 144 16960 0.10% 145 17471 0.10% 146 17857 0.10% 147 18249 0.10% 148 19357 0.11% 149 18990 0.11% 150 20428 0.11% 151 17177628 96.46% 17808587 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=16 prefix-density=0.76 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=49.07 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=20 prefix-density=0.91 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.16 sequence-density-rank=23 fanout-score=26.89 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=10.8 sequence=AAAGAAAAGAAAA SRR12671412 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:02:09 Started mapping on | Feb 11 23:02:09 Finished on | Feb 11 23:04:12 Mapping speed, Million of reads per hour | 521.23 Number of input reads | 17808587 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 16586404 Uniquely mapped reads % | 93.14% Average mapped length | 298.74 Number of splices: Total | 16626096 Number of splices: Annotated (sjdb) | 16325288 Number of splices: GT/AG | 16297635 Number of splices: GC/AG | 280402 Number of splices: AT/AC | 8235 Number of splices: Non-canonical | 39824 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 387621 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 58079 % of reads mapped to too many loci | 0.33% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.24% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 834562 834562 834562 N_multimapping 387621 387621 387621 N_noFeature 567956 16307112 650304 N_ambiguous 298008 1151 100447 UnstrandedReadsAssigned:15720440 PositiveStrandReadsAssigned:278141 NegativeStrandReadsAssigned:15835653 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671412 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671412-trimmed-pair1.fastq SRR12671412-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,808,587 reads, 15,799,416 reads pseudoaligned [quant] estimated average fragment length: 317.596 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,087 rounds 52401 SRR12671412.ke.tsv 34699 SRR12671412.se.tsv 87100 total ==> SRR12671412.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1701.4 509 15.7753 Potri.005G024800.1.v4.1 1035 718.404 256 18.7905 Potri.004G059700.1.v4.1 961 644.73 7 0.572515 Potri.007G009000.2.v4.1 1416 1099.4 0 0 Potri.003G141000.2.v4.1 2943 2626.4 962 19.3144 Potri.016G087400.1.v4.1 270 67.5129 566.458 442.433 Potri.015G069301.1.v4.1 564 271.382 0 0 Potri.010G195200.1.v4.1 1773 1456.4 100 3.62064 Potri.012G127500.1.v4.1 977 660.566 94 7.50375 ==> SRR12671412.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 332 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 248 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR12671412 completed mapping pipeline successfully