Starting /dee2/code/volunteer_pipeline.sh SRR12671413 current disk space = 3052437790720 free memory = 1458523116 SRR12671413 SRAfilesize 10b594f5858fe1261f3b22d9ce0b3ca7 SRR12671413.sra SRR12671413.sra file validated SRR12671413 is paired end SRR12671413 is conventional basespace SRR12671413 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671413_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.583 37.0 37.0 37.0 37.0 37.0 2 36.379 37.0 37.0 37.0 37.0 37.0 3 36.532 37.0 37.0 37.0 37.0 37.0 4 36.6345 37.0 37.0 37.0 37.0 37.0 5 36.6635 37.0 37.0 37.0 37.0 37.0 6 36.5935 37.0 37.0 37.0 37.0 37.0 7 36.491 37.0 37.0 37.0 37.0 37.0 8 36.6575 37.0 37.0 37.0 37.0 37.0 9 36.6335 37.0 37.0 37.0 37.0 37.0 10-14 36.651500000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.62479999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.5904 37.0 37.0 37.0 37.0 37.0 25-29 36.561400000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.57469999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.537699999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.4829 37.0 37.0 37.0 37.0 37.0 45-49 36.439099999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.4713 37.0 37.0 37.0 37.0 37.0 55-59 36.43169999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.425 37.0 37.0 37.0 37.0 37.0 65-69 36.405800000000006 37.0 37.0 37.0 37.0 37.0 70-74 36.368199999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.384899999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.332800000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.3145 37.0 37.0 37.0 37.0 37.0 90-94 36.3048 37.0 37.0 37.0 37.0 37.0 95-99 36.2375 37.0 37.0 37.0 37.0 37.0 100-104 36.2164 37.0 37.0 37.0 37.0 37.0 105-109 36.28660000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.155199999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.1411 37.0 37.0 37.0 37.0 37.0 120-124 36.1457 37.0 37.0 37.0 37.0 37.0 125-129 36.1295 37.0 37.0 37.0 37.0 37.0 130-134 36.100300000000004 37.0 37.0 37.0 37.0 37.0 135-139 36.06420000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.9799 37.0 37.0 37.0 37.0 37.0 145-149 35.958099999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.85025 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 0.0 24 2.0 25 2.0 26 5.0 27 2.0 28 14.0 29 12.0 30 25.0 31 29.0 32 33.0 33 65.0 34 112.0 35 254.0 36 3013.0 37 430.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.825 10.549999999999999 5.325 35.3 2 19.589178356713425 12.19939879759519 37.27454909819639 30.936873747494992 3 17.675 18.125 28.125 36.075 4 24.775 24.575 24.025 26.625 5 24.525 31.6 23.075000000000003 20.8 6 18.7 33.900000000000006 25.5 21.9 7 14.524999999999999 24.9 44.800000000000004 15.775 8 14.975 23.549999999999997 35.5 25.974999999999998 9 17.2 23.724999999999998 34.75 24.325 10-14 20.105 29.735 27.63 22.53 15-19 20.54 28.16 27.644999999999996 23.655 20-24 20.1 28.265 27.650000000000002 23.985 25-29 19.935 28.34 27.825 23.9 30-34 19.775000000000002 27.715 27.810000000000002 24.7 35-39 20.200000000000003 28.815 27.150000000000002 23.835 40-44 20.23 28.725 27.855 23.189999999999998 45-49 20.349999999999998 28.375 27.865000000000002 23.41 50-54 20.11 27.675 28.610000000000003 23.605 55-59 20.330000000000002 28.095 27.495000000000005 24.08 60-64 19.85 28.235 28.03 23.885 65-69 19.93 28.215 28.000000000000004 23.855 70-74 20.775 27.875 27.57 23.78 75-79 20.7 28.599999999999998 27.005000000000003 23.695 80-84 20.51 28.560000000000002 27.529999999999998 23.400000000000002 85-89 20.8 28.21 27.525 23.465 90-94 20.294999999999998 28.62 27.744999999999997 23.34 95-99 20.71 28.29 27.189999999999998 23.810000000000002 100-104 20.04 28.535 28.26 23.165 105-109 20.31 28.18 27.85 23.66 110-114 20.335 27.6 28.48 23.585 115-119 20.885 28.68 27.255000000000003 23.18 120-124 20.73 27.439999999999998 28.134999999999998 23.695 125-129 20.25 28.415000000000003 27.485 23.849999999999998 130-134 21.47 27.694999999999997 27.325 23.51 135-139 21.14 27.650000000000002 27.63 23.580000000000002 140-144 20.82 28.155 26.86 24.165 145-149 21.154999999999998 28.360000000000003 26.935 23.549999999999997 150-151 21.5375 29.0875 25.624999999999996 23.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 1.0 17 1.0 18 0.5 19 1.0 20 1.0 21 0.5 22 2.5 23 3.5 24 3.5 25 4.5 26 5.0 27 7.0 28 11.5 29 14.0 30 17.0 31 25.0 32 35.0 33 39.5 34 44.0 35 66.0 36 85.5 37 96.0 38 130.0 39 157.0 40 182.0 41 199.5 42 210.5 43 227.0 44 257.5 45 282.0 46 269.0 47 258.0 48 243.5 49 214.0 50 176.5 51 145.0 52 130.0 53 106.5 54 76.0 55 61.0 56 59.5 57 49.0 58 31.0 59 28.0 60 15.5 61 6.5 62 6.5 63 4.0 64 1.5 65 0.0 66 0.5 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.75 #Duplication Level Percentage of deduplicated Percentage of total 1 87.46397694524497 75.875 2 10.432276657060518 18.099999999999998 3 1.6426512968299711 4.275 4 0.345821325648415 1.2 5 0.08645533141210375 0.375 6 0.0 0.0 7 0.028818443804034585 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTACACTCCATTCTTGAGAGTCCCTGCAAAGCCCAGAGGGTCAAAGAACT 7 0.17500000000000002 No Hit CTTCCACAAACTTCCTTTTAGTAGCAGTAACTACCAACCTATCAGAATTA 5 0.125 No Hit AGATCTTATCTGTTTCAGCTAAAGCGTCCTTTCCAACAAGTTGGACAATT 5 0.125 No Hit GGAACAATGTTAAGAGCTGCAGCTCTTGCACGTCTGAGATCACGGTGGCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6625000000000001 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.2375 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.8125 0.0 0.0 0.0 0.0 122-123 3.0 0.0 0.0 0.0 0.0 124-125 3.25 0.0 0.0 0.0 0.0 126-127 3.45 0.0 0.0 0.0 0.0 128-129 3.75 0.0 0.0 0.0 0.0 130-131 4.0125 0.0 0.0 0.0 0.0 132-133 4.300000000000001 0.0 0.0 0.0 0.0 134-135 4.65 0.0 0.0 0.0 0.0 136-137 4.8875 0.0 0.0 0.0 0.0 138-139 5.449999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTTTA 10 0.006830828 145.0 7 TATTCTT 10 0.006830828 145.0 5 TAATATT 10 0.006830828 145.0 9 >>END_MODULE SRR12671413 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671413_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1505 37.0 37.0 37.0 37.0 37.0 2 35.856 37.0 37.0 37.0 37.0 37.0 3 36.041 37.0 37.0 37.0 37.0 37.0 4 36.157 37.0 37.0 37.0 37.0 37.0 5 36.131 37.0 37.0 37.0 37.0 37.0 6 36.153 37.0 37.0 37.0 37.0 37.0 7 36.1 37.0 37.0 37.0 37.0 37.0 8 36.1525 37.0 37.0 37.0 37.0 37.0 9 36.054 37.0 37.0 37.0 37.0 37.0 10-14 36.136100000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.154 37.0 37.0 37.0 37.0 37.0 20-24 36.041399999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.033100000000005 37.0 37.0 37.0 37.0 37.0 30-34 35.9714 37.0 37.0 37.0 37.0 37.0 35-39 35.968300000000006 37.0 37.0 37.0 37.0 37.0 40-44 35.9766 37.0 37.0 37.0 37.0 37.0 45-49 35.9003 37.0 37.0 37.0 37.0 37.0 50-54 35.849000000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.8796 37.0 37.0 37.0 37.0 37.0 60-64 35.8423 37.0 37.0 37.0 37.0 37.0 65-69 35.9007 37.0 37.0 37.0 37.0 37.0 70-74 35.8326 37.0 37.0 37.0 37.0 37.0 75-79 35.8082 37.0 37.0 37.0 37.0 37.0 80-84 35.72240000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.778999999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.7749 37.0 37.0 37.0 37.0 37.0 95-99 35.7214 37.0 37.0 37.0 37.0 37.0 100-104 35.6023 37.0 37.0 37.0 37.0 37.0 105-109 35.596599999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.5302 37.0 37.0 37.0 37.0 37.0 115-119 35.6057 37.0 37.0 37.0 37.0 37.0 120-124 35.517700000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.523700000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.426199999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.3744 37.0 37.0 37.0 34.6 37.0 140-144 35.3417 37.0 37.0 37.0 34.6 37.0 145-149 35.2355 37.0 37.0 37.0 29.8 37.0 150-151 35.07025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 4.0 14 3.0 15 4.0 16 2.0 17 0.0 18 1.0 19 0.0 20 0.0 21 4.0 22 3.0 23 5.0 24 9.0 25 11.0 26 12.0 27 13.0 28 15.0 29 12.0 30 35.0 31 54.0 32 58.0 33 127.0 34 231.0 35 617.0 36 2550.0 37 230.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.224999999999994 25.55 8.55 21.675 2 25.8 27.05 31.2 15.950000000000001 3 21.95 27.950000000000003 33.35 16.75 4 24.474999999999998 35.225 22.325 17.974999999999998 5 25.75 37.925 20.7 15.625 6 19.925 40.075 21.15 18.85 7 20.65 21.475 38.975 18.9 8 19.7 26.075 28.65 25.575 9 22.45 24.65 29.75 23.150000000000002 10-14 23.44 29.459999999999997 26.115 20.985 15-19 23.51 27.875 27.595 21.02 20-24 22.505 29.205 27.544999999999998 20.745 25-29 22.655 28.46 27.93 20.955 30-34 22.905 28.585 27.445000000000004 21.065 35-39 22.759999999999998 28.79 27.474999999999998 20.974999999999998 40-44 22.985 28.04 28.435 20.54 45-49 22.919999999999998 28.33 28.035 20.715 50-54 23.05 28.199999999999996 27.894999999999996 20.855 55-59 23.0 28.03 27.92 21.05 60-64 23.0 27.76 27.61 21.63 65-69 23.494999999999997 27.474999999999998 27.284999999999997 21.745 70-74 23.025000000000002 28.715000000000003 27.22 21.04 75-79 22.39 27.88 27.665 22.065 80-84 24.104999999999997 28.32 26.76 20.815 85-89 23.150000000000002 28.09 27.735 21.025 90-94 23.185 28.544999999999998 26.85 21.42 95-99 23.14 28.115000000000002 27.655 21.09 100-104 23.71 28.075 26.995 21.22 105-109 23.549999999999997 28.525 27.525 20.4 110-114 23.849999999999998 28.605000000000004 27.334999999999997 20.21 115-119 23.48 28.744999999999997 27.165 20.61 120-124 24.87 28.585 26.25 20.294999999999998 125-129 23.98 27.839999999999996 27.634999999999998 20.544999999999998 130-134 24.085 28.275 27.139999999999997 20.5 135-139 24.86 27.750000000000004 27.334999999999997 20.055 140-144 24.38 27.465 27.544999999999998 20.61 145-149 25.07750775077508 28.047804780478046 26.7026702670267 20.172017201720173 150-151 26.437500000000004 27.3375 26.2875 19.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.0 7 1.0 8 2.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 2.5 18 3.0 19 1.0 20 1.5 21 2.0 22 1.5 23 1.0 24 2.0 25 3.5 26 5.5 27 10.0 28 10.0 29 11.0 30 15.5 31 18.5 32 30.0 33 45.0 34 57.5 35 68.5 36 79.0 37 102.5 38 143.5 39 166.0 40 172.0 41 199.5 42 241.5 43 252.5 44 267.5 45 275.5 46 255.5 47 247.0 48 238.5 49 224.0 50 181.0 51 141.0 52 117.5 53 86.0 54 75.0 55 57.5 56 44.0 57 39.5 58 25.0 59 26.5 60 18.0 61 7.0 62 4.0 63 2.5 64 2.0 65 0.5 66 0.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 1.0 78 1.0 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 87.56461803561172 76.225 2 10.511200459506032 18.3 3 1.5795519816197585 4.125 4 0.2584721424468696 0.8999999999999999 5 0.02871912693854107 0.125 6 0.02871912693854107 0.15 7 0.02871912693854107 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAATGGTACAGGGAAGCTGAACTCATTCACGGCCGGTGGGCTATGGCTGC 7 0.17500000000000002 No Hit GTGATCATCACAGCCCCTGGAAAGGGTGATATACCAACCTACGTTGTTGG 6 0.15 No Hit TGGCAATATCACTTCTCTTAAAAAAAAAAAGGAAAGCAAATTAATTGCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.6625000000000001 0.0 0.0 0.0 0.0 96-97 0.7124999999999999 0.0 0.0 0.0 0.0 98-99 0.8 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.05 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.2375 0.0 0.0 0.0 0.0 118-119 2.375 0.0 0.0 0.0 0.0 120-121 2.7875 0.0 0.0 0.0 0.0 122-123 2.9625 0.0 0.0 0.0 0.0 124-125 3.175 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.7 0.0 0.0 0.0 0.0 130-131 3.9625 0.0 0.0 0.0 0.0 132-133 4.25 0.0 0.0 0.0 0.0 134-135 4.6125 0.0 0.0 0.0 0.0 136-137 4.8625 0.0 0.0 0.0 0.0 138-139 5.425000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACTTC 10 0.006830828 145.0 9 TTCCTGA 10 0.006830828 145.0 6 TTTTTTT 50 0.0013298223 17.4 20-24 >>END_MODULE Read 798905 spots for SRR12671413.sra Written 798905 spots for SRR12671413.sra Read 798905 spots for SRR12671413.sra Written 798905 spots for SRR12671413.sra Read 798905 spots for SRR12671413.sra Written 798905 spots for SRR12671413.sra Read 798905 spots for SRR12671413.sra Written 798905 spots for SRR12671413.sra Read 798905 spots for SRR12671413.sra Written 798905 spots for SRR12671413.sra Read 798905 spots for SRR12671413.sra Written 798905 spots for SRR12671413.sra Read 798905 spots for SRR12671413.sra Written 798905 spots for SRR12671413.sra Read 798905 spots for SRR12671413.sra Written 798905 spots for SRR12671413.sra Read 798905 spots for SRR12671413.sra Written 798905 spots for SRR12671413.sra Read 798905 spots for SRR12671413.sra Written 798905 spots for SRR12671413.sra Read 798905 spots for SRR12671413.sra Written 798905 spots for SRR12671413.sra Read 798905 spots for SRR12671413.sra Written 798905 spots for SRR12671413.sra Read 798905 spots for SRR12671413.sra Written 798905 spots for SRR12671413.sra Read 798905 spots for SRR12671413.sra Written 798905 spots for SRR12671413.sra Read 798905 spots for SRR12671413.sra Written 798905 spots for SRR12671413.sra Read 798905 spots for SRR12671413.sra Written 798905 spots for SRR12671413.sra Read 798905 spots for SRR12671413.sra Written 798905 spots for SRR12671413.sra Read 798905 spots for SRR12671413.sra Written 798905 spots for SRR12671413.sra Read 798905 spots for SRR12671413.sra Written 798905 spots for SRR12671413.sra Read 798907 spots for SRR12671413.sra Written 798907 spots for SRR12671413.sra SRR ids: ['SRR12671413.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oyv8or9n SRR12671413.sra spots: 15978102 blocks: [[1, 798905], [798906, 1597810], [1597811, 2396715], [2396716, 3195620], [3195621, 3994525], [3994526, 4793430], [4793431, 5592335], [5592336, 6391240], [6391241, 7190145], [7190146, 7989050], [7989051, 8787955], [8787956, 9586860], [9586861, 10385765], [10385766, 11184670], [11184671, 11983575], [11983576, 12782480], [12782481, 13581385], [13581386, 14380290], [14380291, 15179195], [15179196, 15978102]] SRR12671413 file size 5408357 SRR12671413 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671413 SRR12671413_1.fastq SRR12671413_2.fastq Input file: SRR12671413_1.fastq Paired file: SRR12671413_2.fastq trimmed: SRR12671413-trimmed-pair1.fastq, SRR12671413-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:59:10 2025 >> started Tue Feb 11 22:59:39 2025 >> done (28.671s) 15978102 read pairs processed; of these: 72 ( 0.00%) short read pairs filtered out after trimming by size control 2647 ( 0.02%) empty read pairs filtered out after trimming by size control 15975383 (99.98%) read pairs available; of these: 1258460 ( 7.88%) trimmed read pairs available after processing 14716923 (92.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 1 0.00% 20 9 0.00% 21 2 0.00% 22 7 0.00% 23 7 0.00% 24 11 0.00% 25 16 0.00% 26 8 0.00% 27 19 0.00% 28 11 0.00% 29 12 0.00% 30 13 0.00% 31 13 0.00% 32 20 0.00% 33 14 0.00% 34 16 0.00% 35 19 0.00% 36 17 0.00% 37 19 0.00% 38 25 0.00% 39 22 0.00% 40 28 0.00% 41 28 0.00% 42 33 0.00% 43 32 0.00% 44 45 0.00% 45 40 0.00% 46 33 0.00% 47 40 0.00% 48 68 0.00% 49 62 0.00% 50 91 0.00% 51 84 0.00% 52 114 0.00% 53 93 0.00% 54 129 0.00% 55 123 0.00% 56 149 0.00% 57 153 0.00% 58 182 0.00% 59 238 0.00% 60 272 0.00% 61 327 0.00% 62 290 0.00% 63 347 0.00% 64 408 0.00% 65 454 0.00% 66 506 0.00% 67 547 0.00% 68 667 0.00% 69 728 0.00% 70 846 0.01% 71 985 0.01% 72 1114 0.01% 73 1258 0.01% 74 1369 0.01% 75 1515 0.01% 76 1665 0.01% 77 1808 0.01% 78 1993 0.01% 79 2184 0.01% 80 2378 0.01% 81 2824 0.02% 82 3035 0.02% 83 3161 0.02% 84 3580 0.02% 85 3971 0.02% 86 4171 0.03% 87 4536 0.03% 88 4690 0.03% 89 4994 0.03% 90 5270 0.03% 91 5867 0.04% 92 5979 0.04% 93 6661 0.04% 94 6987 0.04% 95 7370 0.05% 96 7615 0.05% 97 8014 0.05% 98 8538 0.05% 99 8848 0.06% 100 8993 0.06% 101 9377 0.06% 102 10186 0.06% 103 10465 0.07% 104 10763 0.07% 105 11348 0.07% 106 11879 0.07% 107 12446 0.08% 108 12447 0.08% 109 13039 0.08% 110 13490 0.08% 111 13985 0.09% 112 14737 0.09% 113 14752 0.09% 114 15403 0.10% 115 15871 0.10% 116 16780 0.11% 117 17293 0.11% 118 17738 0.11% 119 17901 0.11% 120 18839 0.12% 121 19293 0.12% 122 19841 0.12% 123 20251 0.13% 124 21065 0.13% 125 21513 0.13% 126 22623 0.14% 127 22969 0.14% 128 23191 0.15% 129 24218 0.15% 130 24923 0.16% 131 24724 0.15% 132 25316 0.16% 133 26302 0.16% 134 26624 0.17% 135 27394 0.17% 136 28237 0.18% 137 28770 0.18% 138 29429 0.18% 139 30768 0.19% 140 30950 0.19% 141 31651 0.20% 142 31796 0.20% 143 32513 0.20% 144 33176 0.21% 145 33887 0.21% 146 34635 0.22% 147 35167 0.22% 148 36080 0.23% 149 35937 0.22% 150 37661 0.24% 151 14716923 92.12% 15975383 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=20 prefix-density=0.60 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=653.74 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=17.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=30 prefix-density=0.92 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=56.84 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=6.1 sequence=GAGAGGAGAGGCGACAGAAGACAATCAAAATTCAAAAGAAAAGAAAA SRR12671413 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:00:27 Started mapping on | Feb 11 23:00:27 Finished on | Feb 11 23:03:54 Mapping speed, Million of reads per hour | 277.83 Number of input reads | 15975383 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14794130 Uniquely mapped reads % | 92.61% Average mapped length | 296.40 Number of splices: Total | 14744886 Number of splices: Annotated (sjdb) | 14439634 Number of splices: GT/AG | 14449822 Number of splices: GC/AG | 240757 Number of splices: AT/AC | 8046 Number of splices: Non-canonical | 46261 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 348996 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 16216 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.00% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 832257 832257 832257 N_multimapping 348996 348996 348996 N_noFeature 562079 14568812 645433 N_ambiguous 236234 905 93838 UnstrandedReadsAssigned:13995817 PositiveStrandReadsAssigned:224413 NegativeStrandReadsAssigned:14054859 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671413 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671413-trimmed-pair1.fastq SRR12671413-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,975,383 reads, 14,053,918 reads pseudoaligned [quant] estimated average fragment length: 275.632 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 958 rounds 52401 SRR12671413.ke.tsv 34699 SRR12671413.se.tsv 87100 total ==> SRR12671413.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.37 418 15.6893 Potri.005G024800.1.v4.1 1035 760.368 262 22.5473 Potri.004G059700.1.v4.1 961 686.57 0 0 Potri.007G009000.2.v4.1 1416 1141.37 0 0 Potri.003G141000.2.v4.1 2943 2668.37 789 19.3486 Potri.016G087400.1.v4.1 270 80.7238 456 369.642 Potri.015G069301.1.v4.1 564 307.449 0 0 Potri.010G195200.1.v4.1 1773 1498.37 123 5.37161 Potri.012G127500.1.v4.1 977 702.464 83 7.73164 ==> SRR12671413.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 230 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 173 Potri.001G212900.v4.1 30 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12671413 completed mapping pipeline successfully