Starting /dee2/code/volunteer_pipeline.sh SRR12671415 current disk space = 3052397408256 free memory = 1476490200 SRR12671415 SRAfilesize 81c81c858e4c46bfa7958eee03cb668e SRR12671415.sra SRR12671415.sra file validated SRR12671415 is paired end SRR12671415 is conventional basespace SRR12671415 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671415_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5695 37.0 37.0 37.0 37.0 37.0 2 36.389 37.0 37.0 37.0 37.0 37.0 3 36.5445 37.0 37.0 37.0 37.0 37.0 4 36.5845 37.0 37.0 37.0 37.0 37.0 5 36.6225 37.0 37.0 37.0 37.0 37.0 6 36.635 37.0 37.0 37.0 37.0 37.0 7 36.542 37.0 37.0 37.0 37.0 37.0 8 36.6715 37.0 37.0 37.0 37.0 37.0 9 36.5945 37.0 37.0 37.0 37.0 37.0 10-14 36.6321 37.0 37.0 37.0 37.0 37.0 15-19 36.5641 37.0 37.0 37.0 37.0 37.0 20-24 36.5495 37.0 37.0 37.0 37.0 37.0 25-29 36.535199999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.492900000000006 37.0 37.0 37.0 37.0 37.0 35-39 36.4514 37.0 37.0 37.0 37.0 37.0 40-44 36.4472 37.0 37.0 37.0 37.0 37.0 45-49 36.4317 37.0 37.0 37.0 37.0 37.0 50-54 36.436 37.0 37.0 37.0 37.0 37.0 55-59 36.4079 37.0 37.0 37.0 37.0 37.0 60-64 36.3855 37.0 37.0 37.0 37.0 37.0 65-69 36.3272 37.0 37.0 37.0 37.0 37.0 70-74 36.340700000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.297700000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.3039 37.0 37.0 37.0 37.0 37.0 85-89 36.2816 37.0 37.0 37.0 37.0 37.0 90-94 36.2642 37.0 37.0 37.0 37.0 37.0 95-99 36.24300000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.2654 37.0 37.0 37.0 37.0 37.0 105-109 36.2271 37.0 37.0 37.0 37.0 37.0 110-114 36.096500000000006 37.0 37.0 37.0 37.0 37.0 115-119 36.143299999999996 37.0 37.0 37.0 37.0 37.0 120-124 36.1044 37.0 37.0 37.0 37.0 37.0 125-129 36.1074 37.0 37.0 37.0 37.0 37.0 130-134 36.007600000000004 37.0 37.0 37.0 37.0 37.0 135-139 36.0319 37.0 37.0 37.0 37.0 37.0 140-144 35.9453 37.0 37.0 37.0 37.0 37.0 145-149 35.919 37.0 37.0 37.0 37.0 37.0 150-151 35.769999999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 5.0 24 1.0 25 6.0 26 5.0 27 8.0 28 9.0 29 12.0 30 23.0 31 25.0 32 41.0 33 75.0 34 121.0 35 249.0 36 2928.0 37 488.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.225 9.925 5.7250000000000005 38.125 2 20.415831663326653 13.627254509018035 36.122244488977955 29.834669338677354 3 20.075000000000003 18.15 25.25 36.525 4 23.7 25.4 21.725 29.175 5 22.95 33.125 24.825 19.1 6 19.45 35.525 23.674999999999997 21.349999999999998 7 14.549999999999999 25.7 42.875 16.875 8 16.2 23.674999999999997 35.0 25.124999999999996 9 17.45 23.175 34.2 25.174999999999997 10-14 19.355 30.345 27.52 22.78 15-19 20.035 27.72 28.13 24.115000000000002 20-24 20.155 27.685 28.015 24.145 25-29 19.685 28.494999999999997 28.035 23.785 30-34 20.06 28.485 27.73 23.724999999999998 35-39 19.475 28.37 27.905 24.25 40-44 20.080000000000002 28.335 28.21 23.375 45-49 19.259999999999998 28.73 28.02 23.990000000000002 50-54 19.89 28.83 27.16 24.12 55-59 19.85 28.265 27.71 24.175 60-64 19.744999999999997 28.62 27.884999999999998 23.75 65-69 20.255000000000003 28.475 27.615000000000002 23.655 70-74 19.915 27.785 27.98 24.32 75-79 20.23 28.560000000000002 27.37 23.84 80-84 20.285 28.105000000000004 27.765 23.845 85-89 20.0 28.92 27.150000000000002 23.93 90-94 20.41 28.315 27.365000000000002 23.91 95-99 20.005 28.08 27.92 23.995 100-104 20.580000000000002 28.425 27.825 23.169999999999998 105-109 20.1 27.884999999999998 27.605 24.41 110-114 20.47 28.27 27.775 23.485 115-119 20.62 28.475 27.485 23.419999999999998 120-124 20.875 27.950000000000003 28.244999999999997 22.93 125-129 21.13 27.005000000000003 27.975 23.89 130-134 20.965 27.900000000000002 28.04 23.095 135-139 21.325 27.800000000000004 26.77 24.104999999999997 140-144 21.634999999999998 27.644999999999996 27.62 23.1 145-149 20.76 28.355000000000004 27.529999999999998 23.355 150-151 21.0375 28.375 27.487499999999997 23.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.5 15 1.0 16 0.0 17 0.0 18 0.0 19 1.5 20 1.5 21 0.5 22 1.0 23 1.0 24 3.5 25 6.0 26 7.0 27 6.5 28 6.5 29 11.0 30 19.5 31 26.5 32 38.0 33 46.0 34 63.0 35 76.5 36 89.5 37 104.0 38 120.5 39 158.0 40 179.0 41 186.0 42 208.0 43 239.5 44 259.0 45 276.0 46 265.0 47 250.5 48 239.0 49 206.0 50 172.5 51 142.0 52 129.0 53 113.0 54 89.5 55 69.0 56 54.0 57 37.5 58 25.5 59 23.0 60 15.0 61 8.0 62 7.0 63 5.0 64 4.0 65 3.5 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 81.85 #Duplication Level Percentage of deduplicated Percentage of total 1 82.62064752596213 67.625 2 13.775198533903483 22.55 3 2.8405620036652413 6.9750000000000005 4 0.4581551618814905 1.5 5 0.1832620647525962 0.75 6 0.12217470983506415 0.6 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAAGACGAAGAAACGCTGTGGCTAAGGGACTGAGAGGGGTAGCTGCTG 6 0.15 No Hit CACCAACTCAATTTTTTGTCTGTGTTCTGCACAGCAAAGAACAATAGAAC 6 0.15 No Hit GCCACACGTGAAACTTGCATGAAATCATTGGATGCTCCAGTAGTCACATT 6 0.15 No Hit GGCCAGATTCCACCATCAGATCCCAAACCAAATGCATCCTCTCCTCAATA 6 0.15 No Hit TGCAGAGCTAGACAAAATAGAGTTGGCTATTGGCAAATAGCCTGGCAGTG 5 0.125 No Hit GCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAA 5 0.125 No Hit CTCTATCAATGGAATCTTGATTGGCTTCACCAAGAGAAGCCTCGCTCAGG 5 0.125 No Hit CGCAATATTTGTAAGTTGAAATGTGTTACATTTATCAATTCAAGGCAAGT 5 0.125 No Hit CTCACATAATCATTTCCAGTAATTAATATATCGTCAACATATATCAGGAG 5 0.125 No Hit AAAACACAAACAAAAGTTTCAAAATTTACAATGGCAGCATCTGTGTAATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.7124999999999999 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.5875 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.05 0.0 0.0 0.0 0.0 124-125 2.2125 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.0 0.0 128-129 2.6 0.0 0.0 0.0 0.0 130-131 2.6875 0.0 0.0 0.0 0.0 132-133 2.8875 0.0 0.0 0.0 0.0 134-135 3.0375 0.0 0.0 0.0 0.0 136-137 3.2125 0.0 0.0 0.0 0.0 138-139 3.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCTGC 10 0.006830828 145.0 8 GCTACTT 10 0.006830828 145.0 1 CTACTTC 20 3.5877043E-4 108.75 2 >>END_MODULE SRR12671415 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671415_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.05 37.0 37.0 37.0 37.0 37.0 2 35.648 37.0 37.0 37.0 37.0 37.0 3 35.8965 37.0 37.0 37.0 37.0 37.0 4 36.0235 37.0 37.0 37.0 37.0 37.0 5 36.089 37.0 37.0 37.0 37.0 37.0 6 35.9445 37.0 37.0 37.0 37.0 37.0 7 35.935 37.0 37.0 37.0 37.0 37.0 8 36.0245 37.0 37.0 37.0 37.0 37.0 9 36.159 37.0 37.0 37.0 37.0 37.0 10-14 36.052099999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.0929 37.0 37.0 37.0 37.0 37.0 20-24 35.9914 37.0 37.0 37.0 37.0 37.0 25-29 35.98199999999999 37.0 37.0 37.0 37.0 37.0 30-34 35.913599999999995 37.0 37.0 37.0 37.0 37.0 35-39 35.932900000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.9 37.0 37.0 37.0 37.0 37.0 45-49 35.8574 37.0 37.0 37.0 37.0 37.0 50-54 35.808 37.0 37.0 37.0 37.0 37.0 55-59 35.730399999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.7432 37.0 37.0 37.0 37.0 37.0 65-69 35.7062 37.0 37.0 37.0 37.0 37.0 70-74 35.6653 37.0 37.0 37.0 37.0 37.0 75-79 35.717999999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.6746 37.0 37.0 37.0 37.0 37.0 85-89 35.676700000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.6373 37.0 37.0 37.0 37.0 37.0 95-99 35.560900000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.58200000000001 37.0 37.0 37.0 37.0 37.0 105-109 35.5038 37.0 37.0 37.0 37.0 37.0 110-114 35.414300000000004 37.0 37.0 37.0 34.6 37.0 115-119 35.501 37.0 37.0 37.0 37.0 37.0 120-124 35.4905 37.0 37.0 37.0 37.0 37.0 125-129 35.428900000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.38549999999999 37.0 37.0 37.0 34.6 37.0 135-139 35.2883 37.0 37.0 37.0 29.8 37.0 140-144 35.3617 37.0 37.0 37.0 34.6 37.0 145-149 35.2588 37.0 37.0 37.0 32.2 37.0 150-151 35.116749999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 5.0 15 1.0 16 1.0 17 3.0 18 3.0 19 0.0 20 0.0 21 3.0 22 2.0 23 7.0 24 8.0 25 9.0 26 10.0 27 13.0 28 12.0 29 20.0 30 42.0 31 40.0 32 84.0 33 146.0 34 264.0 35 638.0 36 2477.0 37 207.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.775 21.2 9.8 25.224999999999998 2 25.35 25.124999999999996 32.5 17.025000000000002 3 22.2 26.974999999999998 32.05 18.775 4 24.5 34.0 22.275 19.225 5 25.674999999999997 38.9 19.875 15.55 6 19.875 39.95 22.275 17.9 7 19.7 21.6 40.0 18.7 8 19.775000000000002 25.474999999999998 29.225 25.525 9 22.7 23.974999999999998 29.4 23.925 10-14 23.57 28.51 26.045 21.875 15-19 22.62 27.92 27.894999999999996 21.565 20-24 23.285 27.950000000000003 27.57 21.195 25-29 22.875 28.249999999999996 27.939999999999998 20.935000000000002 30-34 22.79 28.92 27.63 20.66 35-39 22.759999999999998 27.884999999999998 27.97 21.385 40-44 22.86 28.34 27.63 21.17 45-49 22.895 28.1 28.189999999999998 20.815 50-54 22.945 27.775 28.134999999999998 21.145 55-59 22.975 27.67 27.589999999999996 21.765 60-64 22.869999999999997 27.32 28.08 21.73 65-69 23.36 27.275 28.17 21.195 70-74 23.275000000000002 27.284999999999997 27.639999999999997 21.8 75-79 23.205000000000002 28.285 26.775 21.735 80-84 22.939999999999998 29.01 26.33 21.72 85-89 23.549999999999997 27.99 27.065 21.395 90-94 23.244999999999997 28.395 27.839999999999996 20.52 95-99 23.535 27.71 28.060000000000002 20.695 100-104 23.285 27.79 28.050000000000004 20.875 105-109 23.625 27.47 27.83 21.075 110-114 23.39 28.13 27.200000000000003 21.279999999999998 115-119 23.895 28.13 27.389999999999997 20.585 120-124 24.83 27.77 26.985 20.415 125-129 23.34 28.084999999999997 27.71 20.865000000000002 130-134 23.71 26.939999999999998 28.185 21.165 135-139 24.16 27.725 27.365000000000002 20.75 140-144 23.51 27.584999999999997 27.884999999999998 21.02 145-149 24.29228768630589 28.43853155946784 27.11813544063219 20.15104531359408 150-151 25.0 27.987499999999997 26.7625 20.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 1.5 16 1.5 17 0.0 18 0.5 19 1.5 20 2.0 21 2.0 22 2.0 23 2.5 24 2.5 25 2.0 26 4.5 27 6.5 28 9.0 29 10.5 30 13.5 31 23.5 32 29.0 33 33.0 34 46.0 35 61.0 36 75.5 37 100.5 38 123.5 39 158.5 40 198.5 41 221.0 42 244.0 43 259.0 44 271.5 45 294.0 46 272.0 47 239.5 48 241.0 49 215.5 50 155.5 51 125.0 52 111.5 53 80.0 54 62.5 55 61.0 56 61.0 57 48.0 58 30.5 59 16.5 60 11.5 61 12.0 62 9.5 63 12.0 64 10.0 65 3.0 66 1.5 67 1.5 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 1.0 94 2.0 95 1.0 96 0.0 97 0.5 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.03 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 82.45 #Duplication Level Percentage of deduplicated Percentage of total 1 83.35354760460886 68.72500000000001 2 13.28077622801698 21.9 3 2.668283808368708 6.6000000000000005 4 0.3941782898726501 1.3 5 0.1516070345664039 0.625 6 0.1212856276531231 0.6 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.030321406913280776 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGGAGCACTGCATAGCTTACAAGCTTGTAAGAGATGGCTTCCTCCTCTA 10 0.25 No Hit CCTAAGTACCGAGTTACTTTCGATGCTTCTGTAATCTGGGGCCTCATTGG 6 0.15 No Hit CAGCAACTTTCATTTCTCTCCAAGGAATTCATCTTCTTGCTCAGCTTGAT 6 0.15 No Hit TGATCATTGTGTATTTAATTCCACACAAAAAGCCTCTGGGATTGATGATT 6 0.15 No Hit ATCATAACGATGAGATCGAGGGTGTTTCGTGGTTGTTGCACGGTAATCAC 6 0.15 No Hit TGTCATCATACAGTTGGTTTTCCTCGAGGAGGAATCATCAGTCATGAAGC 5 0.125 No Hit TGAGATCGACGGCTTCCTCTTCATCAACAACACTCTCCTTTTTTTCCCGT 5 0.125 No Hit CAGTGATCAGGATTTTGATAGAATATTTCATATTCATGTAAATGCTTATT 5 0.125 No Hit GGGAGCACTGCATAGCTTACAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit GCCATTCTCTGAAAGAACATCAATATGGCTCCTAAACTTTCCTGTCTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 0.8875 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.5875 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.05 0.0 0.0 0.0 0.0 124-125 2.2 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.0 0.0 128-129 2.6 0.0 0.0 0.0 0.0 130-131 2.6875 0.0 0.0 0.0 0.0 132-133 2.8875 0.0 0.0 0.0 0.0 134-135 3.0375 0.0 0.0 0.0 0.0 136-137 3.2125 0.0 0.0 0.0 0.0 138-139 3.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGACCCT 10 0.006830828 145.0 145 CAAAGCT 10 0.006830828 145.0 8 GCTTATG 10 0.006830828 145.0 4 ATTTCAA 35 0.0033124194 62.14286 4 >>END_MODULE Read 740599 spots for SRR12671415.sra Written 740599 spots for SRR12671415.sra Read 740599 spots for SRR12671415.sra Written 740599 spots for SRR12671415.sra Read 740599 spots for SRR12671415.sra Written 740599 spots for SRR12671415.sra Read 740599 spots for SRR12671415.sra Written 740599 spots for SRR12671415.sra Read 740599 spots for SRR12671415.sra Written 740599 spots for SRR12671415.sra Read 740599 spots for SRR12671415.sra Written 740599 spots for SRR12671415.sra Read 740599 spots for SRR12671415.sra Written 740599 spots for SRR12671415.sra Read 740599 spots for SRR12671415.sra Written 740599 spots for SRR12671415.sra Read 740599 spots for SRR12671415.sra Written 740599 spots for SRR12671415.sra Read 740599 spots for SRR12671415.sra Written 740599 spots for SRR12671415.sra Read 740599 spots for SRR12671415.sra Written 740599 spots for SRR12671415.sra Read 740599 spots for SRR12671415.sra Written 740599 spots for SRR12671415.sra Read 740613 spots for SRR12671415.sra Written 740613 spots for SRR12671415.sra Read 740599 spots for SRR12671415.sra Written 740599 spots for SRR12671415.sra Read 740599 spots for SRR12671415.sra Written 740599 spots for SRR12671415.sra Read 740599 spots for SRR12671415.sra Written 740599 spots for SRR12671415.sra Read 740599 spots for SRR12671415.sra Written 740599 spots for SRR12671415.sra Read 740599 spots for SRR12671415.sra Written 740599 spots for SRR12671415.sra Read 740599 spots for SRR12671415.sra Written 740599 spots for SRR12671415.sra Read 740599 spots for SRR12671415.sra Written 740599 spots for SRR12671415.sra SRR ids: ['SRR12671415.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9t8vp2wt SRR12671415.sra spots: 14811994 blocks: [[1, 740599], [740600, 1481198], [1481199, 2221797], [2221798, 2962396], [2962397, 3702995], [3702996, 4443594], [4443595, 5184193], [5184194, 5924792], [5924793, 6665391], [6665392, 7405990], [7405991, 8146589], [8146590, 8887188], [8887189, 9627787], [9627788, 10368386], [10368387, 11108985], [11108986, 11849584], [11849585, 12590183], [12590184, 13330782], [13330783, 14071381], [14071382, 14811994]] SRR12671415 file size 5012063 SRR12671415 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671415 SRR12671415_1.fastq SRR12671415_2.fastq Input file: SRR12671415_1.fastq Paired file: SRR12671415_2.fastq trimmed: SRR12671415-trimmed-pair1.fastq, SRR12671415-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:03:58 2025 >> started Tue Feb 11 23:04:15 2025 >> done (16.742s) 14811994 read pairs processed; of these: 51 ( 0.00%) short read pairs filtered out after trimming by size control 1027 ( 0.01%) empty read pairs filtered out after trimming by size control 14810916 (99.99%) read pairs available; of these: 832742 ( 5.62%) trimmed read pairs available after processing 13978174 (94.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 8 0.00% 20 7 0.00% 21 6 0.00% 22 3 0.00% 23 4 0.00% 24 1 0.00% 25 10 0.00% 26 9 0.00% 27 4 0.00% 28 5 0.00% 29 17 0.00% 30 5 0.00% 31 5 0.00% 32 2 0.00% 33 11 0.00% 34 3 0.00% 35 11 0.00% 36 5 0.00% 37 8 0.00% 38 8 0.00% 39 8 0.00% 40 17 0.00% 41 14 0.00% 42 10 0.00% 43 18 0.00% 44 19 0.00% 45 18 0.00% 46 29 0.00% 47 35 0.00% 48 38 0.00% 49 36 0.00% 50 31 0.00% 51 46 0.00% 52 31 0.00% 53 34 0.00% 54 53 0.00% 55 65 0.00% 56 64 0.00% 57 93 0.00% 58 94 0.00% 59 103 0.00% 60 140 0.00% 61 134 0.00% 62 139 0.00% 63 225 0.00% 64 217 0.00% 65 226 0.00% 66 276 0.00% 67 311 0.00% 68 339 0.00% 69 370 0.00% 70 475 0.00% 71 514 0.00% 72 589 0.00% 73 735 0.00% 74 705 0.00% 75 773 0.01% 76 930 0.01% 77 957 0.01% 78 1061 0.01% 79 1226 0.01% 80 1336 0.01% 81 1549 0.01% 82 1645 0.01% 83 1779 0.01% 84 1911 0.01% 85 2036 0.01% 86 2227 0.02% 87 2471 0.02% 88 2559 0.02% 89 2786 0.02% 90 3017 0.02% 91 3189 0.02% 92 3306 0.02% 93 3480 0.02% 94 3880 0.03% 95 3978 0.03% 96 4419 0.03% 97 4489 0.03% 98 4634 0.03% 99 4934 0.03% 100 5203 0.04% 101 5364 0.04% 102 5602 0.04% 103 5981 0.04% 104 6429 0.04% 105 6448 0.04% 106 6870 0.05% 107 7306 0.05% 108 7447 0.05% 109 7929 0.05% 110 8112 0.05% 111 8203 0.06% 112 8674 0.06% 113 8928 0.06% 114 9405 0.06% 115 9747 0.07% 116 10192 0.07% 117 10956 0.07% 118 10971 0.07% 119 11106 0.07% 120 11838 0.08% 121 12195 0.08% 122 12735 0.09% 123 13279 0.09% 124 13781 0.09% 125 14110 0.10% 126 14842 0.10% 127 15141 0.10% 128 15481 0.10% 129 15997 0.11% 130 16517 0.11% 131 17036 0.12% 132 17458 0.12% 133 17992 0.12% 134 18000 0.12% 135 19148 0.13% 136 19559 0.13% 137 20172 0.14% 138 20510 0.14% 139 21706 0.15% 140 21521 0.15% 141 22583 0.15% 142 22828 0.15% 143 23140 0.16% 144 24471 0.17% 145 24742 0.17% 146 25453 0.17% 147 26185 0.18% 148 27082 0.18% 149 27308 0.18% 150 28102 0.19% 151 13978174 94.38% 14810916 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=37 prefix-density=0.61 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCATGTTGGCTTGTACCGGGGTGCGGTTGACGGTGGCAACGGCTGCCGATGAGATCATAGAGGAGGAAGCCAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=31.89 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.8 sequence=CAGTTTCATTTGAGACTACAAATGAAGGAAGAAAAACTTGGGACAAATTAAATTACATGCTCAGTAACAGTAGAGATAACAATCATAAAATCCACCCCCCCTGCCGGAACACCACCGACGACACAAACAGAAAGAGATCTTATTTAACCGCTAAACTCTTCCTCTTTGTGTGTCTCGATGACAACATCAGACGTAGGATAAGCAACACAGGTGAGAACCCAGCCTTCCTCTATCTGGTCATCATCAAGGAAGCTAGCATCAGACTGATCCACAGTCCCCTTCACAATCTTGCCAAGACATGAAGAGCATGAGCCAGCCCTGCATGAGTAGGGGAGGTCAATCTCTTCTGCCTCCTCAGCATGGTCAAGGATGTAGATGTCATCGGGGCATGCAAACTCCTTCTCACCATCAGGAGTGATGAGCTTCACCGTGTATGCTGCCATTGCTTTAACACGTCCTCCTCGACTGGCTTTCAAGCCAAGAAGAGACTCCCCCACGTTGGGAAGTGCCC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=27 prefix-density=0.80 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=20.08 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.0 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12671415 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:04:57 Started mapping on | Feb 11 23:04:57 Finished on | Feb 11 23:06:44 Mapping speed, Million of reads per hour | 498.31 Number of input reads | 14810916 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 13726806 Uniquely mapped reads % | 92.68% Average mapped length | 297.73 Number of splices: Total | 13801718 Number of splices: Annotated (sjdb) | 13527034 Number of splices: GT/AG | 13521658 Number of splices: GC/AG | 234127 Number of splices: AT/AC | 7402 Number of splices: Non-canonical | 38531 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 361526 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 97613 % of reads mapped to too many loci | 0.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.01% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 722584 722584 722584 N_multimapping 361526 361526 361526 N_noFeature 531553 13526114 598368 N_ambiguous 227535 1045 92917 UnstrandedReadsAssigned:12967718 PositiveStrandReadsAssigned:199647 NegativeStrandReadsAssigned:13035521 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671415 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671415-trimmed-pair1.fastq SRR12671415-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,810,916 reads, 13,077,668 reads pseudoaligned [quant] estimated average fragment length: 290.398 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,068 rounds 52401 SRR12671415.ke.tsv 34699 SRR12671415.se.tsv 87100 total ==> SRR12671415.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1728.6 414 16.5825 Potri.005G024800.1.v4.1 1035 745.602 98 9.10048 Potri.004G059700.1.v4.1 961 671.886 3 0.309151 Potri.007G009000.2.v4.1 1416 1126.6 0 0 Potri.003G141000.2.v4.1 2943 2653.6 727.977 18.9945 Potri.016G087400.1.v4.1 270 74.7165 503 466.119 Potri.015G069301.1.v4.1 564 295.87 0 0 Potri.010G195200.1.v4.1 1773 1483.6 51 2.38012 Potri.012G127500.1.v4.1 977 687.741 17 1.71147 ==> SRR12671415.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 54 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 157 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR12671415 completed mapping pipeline successfully