Starting /dee2/code/volunteer_pipeline.sh SRR12671632 current disk space = 3052355895296 free memory = 1473252316 SRR12671632 SRAfilesize bbf71d520e0a9f692e8ee929c94f00a5 SRR12671632.sra SRR12671632.sra file validated SRR12671632 is paired end SRR12671632 is conventional basespace SRR12671632 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671632_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3985 37.0 37.0 37.0 37.0 37.0 2 36.356 37.0 37.0 37.0 37.0 37.0 3 36.4665 37.0 37.0 37.0 37.0 37.0 4 36.499 37.0 37.0 37.0 37.0 37.0 5 36.499 37.0 37.0 37.0 37.0 37.0 6 36.502 37.0 37.0 37.0 37.0 37.0 7 36.4305 37.0 37.0 37.0 37.0 37.0 8 36.583 37.0 37.0 37.0 37.0 37.0 9 36.5655 37.0 37.0 37.0 37.0 37.0 10-14 36.51209999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.5207 37.0 37.0 37.0 37.0 37.0 20-24 36.525099999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.4991 37.0 37.0 37.0 37.0 37.0 30-34 36.4703 37.0 37.0 37.0 37.0 37.0 35-39 36.41 37.0 37.0 37.0 37.0 37.0 40-44 36.4105 37.0 37.0 37.0 37.0 37.0 45-49 36.3916 37.0 37.0 37.0 37.0 37.0 50-54 36.3685 37.0 37.0 37.0 37.0 37.0 55-59 36.3808 37.0 37.0 37.0 37.0 37.0 60-64 36.3755 37.0 37.0 37.0 37.0 37.0 65-69 36.352199999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.337599999999995 37.0 37.0 37.0 37.0 37.0 75-79 36.325100000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.321600000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.2804 37.0 37.0 37.0 37.0 37.0 90-94 36.202 37.0 37.0 37.0 37.0 37.0 95-99 36.1648 37.0 37.0 37.0 37.0 37.0 100-104 36.1796 37.0 37.0 37.0 37.0 37.0 105-109 36.172000000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.197900000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.1779 37.0 37.0 37.0 37.0 37.0 120-124 36.0881 37.0 37.0 37.0 37.0 37.0 125-129 36.0469 37.0 37.0 37.0 37.0 37.0 130-134 36.03060000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.974799999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.896899999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.886700000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.528 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 2.0 27 7.0 28 9.0 29 12.0 30 28.0 31 46.0 32 49.0 33 70.0 34 119.0 35 328.0 36 2973.0 37 356.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.499999999999996 17.275 12.2 42.025 2 21.812248995983936 20.55722891566265 37.65060240963856 19.979919678714857 3 17.45 28.65 26.875 27.025 4 20.8 34.4 23.525 21.275 5 20.3 35.75 24.625 19.325 6 18.0 34.475 26.924999999999997 20.599999999999998 7 14.249999999999998 20.4 44.4 20.95 8 18.4 22.650000000000002 28.375 30.575000000000003 9 16.775000000000002 22.775000000000002 32.175 28.275 10-14 19.400000000000002 28.98 26.91 24.709999999999997 15-19 19.91 28.28 27.525 24.285 20-24 19.555 28.38 28.060000000000002 24.005000000000003 25-29 19.744999999999997 28.535 27.33 24.39 30-34 19.585 27.975 28.12 24.32 35-39 19.495 28.349999999999998 27.62 24.535 40-44 20.305 28.199999999999996 27.750000000000004 23.745 45-49 19.585 28.1 28.32 23.995 50-54 19.865 27.93 28.4 23.805 55-59 20.369999999999997 28.28 27.615000000000002 23.735 60-64 21.12 28.7 27.37 22.81 65-69 20.13 28.015 28.299999999999997 23.555 70-74 20.005 28.110000000000003 27.694999999999997 24.19 75-79 19.905 27.85 28.244999999999997 24.0 80-84 20.11 28.410000000000004 27.474999999999998 24.005000000000003 85-89 20.06 29.21 27.060000000000002 23.669999999999998 90-94 20.43 28.305000000000003 27.655 23.61 95-99 21.055 28.49 27.284999999999997 23.169999999999998 100-104 20.57 27.939999999999998 27.87 23.62 105-109 20.095 27.79 27.83 24.285 110-114 20.615 27.944999999999997 27.825 23.615 115-119 20.674999999999997 28.395 27.205000000000002 23.724999999999998 120-124 20.849999999999998 27.41 27.63 24.11 125-129 20.599999999999998 28.610000000000003 27.284999999999997 23.505000000000003 130-134 20.880000000000003 28.1 26.72 24.3 135-139 20.925 27.36 27.515 24.2 140-144 20.215 27.944999999999997 27.83 24.01 145-149 20.72 28.16 27.295 23.825 150-151 21.6125 27.437499999999996 27.0625 23.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 1.5 24 3.0 25 4.5 26 6.0 27 6.0 28 13.0 29 17.0 30 17.0 31 23.5 32 31.0 33 45.5 34 56.5 35 73.0 36 93.5 37 116.0 38 141.0 39 153.0 40 184.0 41 220.5 42 235.5 43 242.0 44 257.0 45 263.0 46 250.5 47 244.5 48 245.5 49 215.0 50 185.0 51 155.0 52 111.5 53 84.5 54 71.5 55 64.0 56 44.5 57 32.0 58 25.0 59 20.5 60 15.0 61 9.5 62 7.5 63 3.5 64 2.5 65 3.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.0 #Duplication Level Percentage of deduplicated Percentage of total 1 93.30645161290323 86.775 2 6.155913978494624 11.450000000000001 3 0.3763440860215054 1.05 4 0.08064516129032258 0.3 5 0.053763440860215055 0.25 6 0.0 0.0 7 0.026881720430107527 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 7 0.17500000000000002 No Hit GCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTT 5 0.125 No Hit CGAACACATATCTTAATGCATCATTCTCTACAACATACATATACAATAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.9875 0.0 0.0 0.0 0.0 122-123 1.15 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.6875 0.0 0.0 0.0 0.0 128-129 1.825 0.0 0.0 0.0 0.0 130-131 2.0374999999999996 0.0 0.0 0.0 0.0 132-133 2.1 0.0 0.0 0.0 0.0 134-135 2.4 0.0 0.0 0.0 0.0 136-137 2.6125 0.0 0.0 0.0 0.0 138-139 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTGAG 10 0.006830828 145.0 4 AAACACT 10 0.006830828 145.0 3 >>END_MODULE SRR12671632 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671632_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1255 37.0 37.0 37.0 37.0 37.0 2 35.9435 37.0 37.0 37.0 37.0 37.0 3 36.1195 37.0 37.0 37.0 37.0 37.0 4 36.06 37.0 37.0 37.0 37.0 37.0 5 36.151 37.0 37.0 37.0 37.0 37.0 6 36.128 37.0 37.0 37.0 37.0 37.0 7 36.2215 37.0 37.0 37.0 37.0 37.0 8 36.216 37.0 37.0 37.0 37.0 37.0 9 36.184 37.0 37.0 37.0 37.0 37.0 10-14 36.2054 37.0 37.0 37.0 37.0 37.0 15-19 36.171800000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.139399999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.12670000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.1493 37.0 37.0 37.0 37.0 37.0 35-39 36.0112 37.0 37.0 37.0 37.0 37.0 40-44 35.9899 37.0 37.0 37.0 37.0 37.0 45-49 36.0382 37.0 37.0 37.0 37.0 37.0 50-54 36.0013 37.0 37.0 37.0 37.0 37.0 55-59 35.958800000000004 37.0 37.0 37.0 37.0 37.0 60-64 35.915299999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.898700000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.88620000000001 37.0 37.0 37.0 37.0 37.0 75-79 35.734899999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.86579999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.7922 37.0 37.0 37.0 37.0 37.0 90-94 35.7203 37.0 37.0 37.0 37.0 37.0 95-99 35.7664 37.0 37.0 37.0 37.0 37.0 100-104 35.7179 37.0 37.0 37.0 37.0 37.0 105-109 35.6859 37.0 37.0 37.0 37.0 37.0 110-114 35.579899999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.606700000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.665499999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.46900000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.6091 37.0 37.0 37.0 37.0 37.0 135-139 35.5229 37.0 37.0 37.0 37.0 37.0 140-144 35.268299999999996 37.0 37.0 37.0 29.8 37.0 145-149 35.3728 37.0 37.0 37.0 34.6 37.0 150-151 34.9885 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 4.0 13 2.0 14 0.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 4.0 22 4.0 23 8.0 24 4.0 25 14.0 26 7.0 27 17.0 28 13.0 29 19.0 30 32.0 31 55.0 32 75.0 33 107.0 34 220.0 35 535.0 36 2653.0 37 225.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.824999999999996 21.475 14.549999999999999 31.15 2 26.174999999999997 25.025 34.475 14.325 3 17.4 30.75 31.574999999999996 20.275000000000002 4 20.849999999999998 36.875 22.5 19.775000000000002 5 23.799999999999997 37.325 21.025 17.849999999999998 6 19.125 38.75 22.825 19.3 7 17.675 18.325 42.5 21.5 8 20.775 23.625 26.825 28.775000000000002 9 20.974999999999998 23.200000000000003 30.675 25.15 10-14 22.46 28.060000000000002 27.42 22.06 15-19 23.355 27.55 27.32 21.775 20-24 22.259999999999998 28.645 27.365000000000002 21.73 25-29 22.165000000000003 28.475 27.750000000000004 21.61 30-34 22.29 28.1 28.02 21.59 35-39 22.63 28.02 27.96 21.39 40-44 22.1 27.944999999999997 28.134999999999998 21.82 45-49 23.22 27.305 27.99 21.485000000000003 50-54 22.095000000000002 28.38 27.965 21.560000000000002 55-59 22.645 27.575 28.035 21.745 60-64 22.895 27.325 27.615000000000002 22.165000000000003 65-69 22.295 27.765 27.935 22.005 70-74 22.75 27.845 27.405 22.0 75-79 22.725 27.675 27.57 22.03 80-84 23.48 27.255000000000003 27.215 22.05 85-89 23.3 27.529999999999998 27.805000000000003 21.365000000000002 90-94 23.200000000000003 27.365000000000002 27.62 21.815 95-99 22.845 27.815 27.79 21.55 100-104 22.965 27.384999999999998 27.935 21.715 105-109 22.770000000000003 28.34 27.72 21.17 110-114 23.715 28.01 27.29 20.985 115-119 23.54 28.455000000000002 26.815 21.19 120-124 23.595 27.775 27.755000000000003 20.875 125-129 23.45 28.07 27.529999999999998 20.95 130-134 23.815 27.279999999999998 27.04 21.865000000000002 135-139 23.445 27.700000000000003 27.675 21.18 140-144 24.66 27.215 27.1 21.025 145-149 24.075 28.63 26.56 20.735 150-151 24.65 27.1375 27.400000000000002 20.8125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 1.0 18 1.5 19 0.5 20 1.0 21 1.5 22 2.0 23 1.5 24 1.0 25 1.5 26 3.5 27 8.0 28 9.5 29 8.5 30 12.5 31 23.5 32 27.0 33 33.0 34 50.0 35 66.5 36 83.0 37 102.5 38 129.5 39 151.5 40 180.5 41 222.5 42 233.0 43 254.0 44 282.5 45 285.0 46 281.0 47 261.5 48 230.0 49 190.5 50 158.0 51 135.0 52 109.0 53 97.5 54 89.0 55 70.5 56 55.0 57 37.0 58 25.5 59 21.0 60 18.0 61 12.0 62 8.0 63 6.5 64 2.5 65 0.5 66 1.5 67 1.0 68 0.0 69 1.0 70 1.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.15 #Duplication Level Percentage of deduplicated Percentage of total 1 93.50509930220076 87.1 2 5.8239398819108965 10.85 3 0.5099302200751477 1.425 4 0.13419216317767044 0.5 5 0.026838432635534086 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.9875 0.0 0.0 0.0 0.0 122-123 1.15 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.6875 0.0 0.0 0.0 0.0 128-129 1.8 0.0 0.0 0.0 0.0 130-131 2.0125 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.3625 0.0 0.0 0.0 0.0 136-137 2.5625 0.0 0.0 0.0 0.0 138-139 2.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTTGGA 10 0.006830828 145.0 5 >>END_MODULE Read 1108016 spots for SRR12671632.sra Written 1108016 spots for SRR12671632.sra Read 1108016 spots for SRR12671632.sra Written 1108016 spots for SRR12671632.sra Read 1108016 spots for SRR12671632.sra Written 1108016 spots for SRR12671632.sra Read 1108016 spots for SRR12671632.sra Written 1108016 spots for SRR12671632.sra Read 1108016 spots for SRR12671632.sra Written 1108016 spots for SRR12671632.sra Read 1108016 spots for SRR12671632.sra Written 1108016 spots for SRR12671632.sra Read 1108016 spots for SRR12671632.sra Written 1108016 spots for SRR12671632.sra Read 1108016 spots for SRR12671632.sra Written 1108016 spots for SRR12671632.sra Read 1108019 spots for SRR12671632.sra Written 1108019 spots for SRR12671632.sra Read 1108016 spots for SRR12671632.sra Written 1108016 spots for SRR12671632.sra Read 1108016 spots for SRR12671632.sra Written 1108016 spots for SRR12671632.sra Read 1108016 spots for SRR12671632.sra Written 1108016 spots for SRR12671632.sra Read 1108016 spots for SRR12671632.sra Written 1108016 spots for SRR12671632.sra Read 1108016 spots for SRR12671632.sra Written 1108016 spots for SRR12671632.sra Read 1108016 spots for SRR12671632.sra Written 1108016 spots for SRR12671632.sra Read 1108016 spots for SRR12671632.sra Written 1108016 spots for SRR12671632.sra Read 1108016 spots for SRR12671632.sra Written 1108016 spots for SRR12671632.sra Read 1108016 spots for SRR12671632.sra Written 1108016 spots for SRR12671632.sra Read 1108016 spots for SRR12671632.sra Written 1108016 spots for SRR12671632.sra Read 1108016 spots for SRR12671632.sra Written 1108016 spots for SRR12671632.sra SRR ids: ['SRR12671632.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o8lfehw6 SRR12671632.sra spots: 22160323 blocks: [[1, 1108016], [1108017, 2216032], [2216033, 3324048], [3324049, 4432064], [4432065, 5540080], [5540081, 6648096], [6648097, 7756112], [7756113, 8864128], [8864129, 9972144], [9972145, 11080160], [11080161, 12188176], [12188177, 13296192], [13296193, 14404208], [14404209, 15512224], [15512225, 16620240], [16620241, 17728256], [17728257, 18836272], [18836273, 19944288], [19944289, 21052304], [21052305, 22160323]] SRR12671632 file size 7509346 SRR12671632 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671632 SRR12671632_1.fastq SRR12671632_2.fastq Input file: SRR12671632_1.fastq Paired file: SRR12671632_2.fastq trimmed: SRR12671632-trimmed-pair1.fastq, SRR12671632-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:20:13 2025 >> started Tue Feb 11 23:20:38 2025 >> done (24.783s) 22160323 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 1256 ( 0.01%) empty read pairs filtered out after trimming by size control 22159044 (99.99%) read pairs available; of these: 991093 ( 4.47%) trimmed read pairs available after processing 21167951 (95.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 1 0.00% 21 3 0.00% 22 3 0.00% 23 5 0.00% 24 3 0.00% 25 6 0.00% 26 1 0.00% 27 7 0.00% 28 4 0.00% 29 4 0.00% 30 10 0.00% 31 10 0.00% 32 7 0.00% 33 9 0.00% 34 8 0.00% 35 5 0.00% 36 9 0.00% 37 16 0.00% 38 15 0.00% 39 20 0.00% 40 20 0.00% 41 19 0.00% 42 27 0.00% 43 16 0.00% 44 20 0.00% 45 30 0.00% 46 36 0.00% 47 23 0.00% 48 26 0.00% 49 36 0.00% 50 38 0.00% 51 42 0.00% 52 48 0.00% 53 66 0.00% 54 65 0.00% 55 59 0.00% 56 67 0.00% 57 61 0.00% 58 64 0.00% 59 75 0.00% 60 84 0.00% 61 127 0.00% 62 113 0.00% 63 154 0.00% 64 156 0.00% 65 152 0.00% 66 181 0.00% 67 181 0.00% 68 181 0.00% 69 226 0.00% 70 293 0.00% 71 309 0.00% 72 377 0.00% 73 438 0.00% 74 486 0.00% 75 495 0.00% 76 548 0.00% 77 540 0.00% 78 613 0.00% 79 653 0.00% 80 787 0.00% 81 934 0.00% 82 1119 0.01% 83 1235 0.01% 84 1377 0.01% 85 1485 0.01% 86 1675 0.01% 87 1735 0.01% 88 1836 0.01% 89 1891 0.01% 90 2090 0.01% 91 2446 0.01% 92 2772 0.01% 93 3211 0.01% 94 3462 0.02% 95 3735 0.02% 96 4057 0.02% 97 3937 0.02% 98 4306 0.02% 99 4345 0.02% 100 4863 0.02% 101 5397 0.02% 102 5797 0.03% 103 6289 0.03% 104 6850 0.03% 105 7168 0.03% 106 7554 0.03% 107 7738 0.03% 108 7823 0.04% 109 8066 0.04% 110 8505 0.04% 111 9076 0.04% 112 9784 0.04% 113 10288 0.05% 114 11203 0.05% 115 11680 0.05% 116 12489 0.06% 117 12545 0.06% 118 12648 0.06% 119 12867 0.06% 120 13461 0.06% 121 14030 0.06% 122 14727 0.07% 123 16072 0.07% 124 16935 0.08% 125 17688 0.08% 126 18430 0.08% 127 18796 0.08% 128 18873 0.09% 129 19099 0.09% 130 19441 0.09% 131 20400 0.09% 132 21291 0.10% 133 22429 0.10% 134 23658 0.11% 135 24567 0.11% 136 25582 0.12% 137 26097 0.12% 138 26238 0.12% 139 26937 0.12% 140 26654 0.12% 141 27417 0.12% 142 28455 0.13% 143 29751 0.13% 144 32243 0.15% 145 32929 0.15% 146 34758 0.16% 147 34681 0.16% 148 35000 0.16% 149 34747 0.16% 150 35342 0.16% 151 21167951 95.53% 22159044 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=27 prefix-density=0.51 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATT criterion=fanout-score sequence-density=0.11 sequence-density-rank=22 fanout-score=35.32 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=10.3 sequence=CTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=17 prefix-density=0.61 prefix-fanout=2.6 sequence=ACCAGAAAGGCTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=52.56 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=2.5 sequence=ACACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC SRR12671632 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:21:26 Started mapping on | Feb 11 23:21:26 Finished on | Feb 11 23:23:49 Mapping speed, Million of reads per hour | 557.85 Number of input reads | 22159044 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 20743697 Uniquely mapped reads % | 93.61% Average mapped length | 298.83 Number of splices: Total | 21566517 Number of splices: Annotated (sjdb) | 21123613 Number of splices: GT/AG | 21134289 Number of splices: GC/AG | 359747 Number of splices: AT/AC | 13512 Number of splices: Non-canonical | 58969 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 535068 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 102435 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.33% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 880279 880279 880279 N_multimapping 535068 535068 535068 N_noFeature 678708 20406417 765944 N_ambiguous 386080 1537 135199 UnstrandedReadsAssigned:19678909 PositiveStrandReadsAssigned:335743 NegativeStrandReadsAssigned:19842554 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671632 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671632-trimmed-pair1.fastq SRR12671632-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,159,044 reads, 19,799,816 reads pseudoaligned [quant] estimated average fragment length: 303.944 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,195 rounds 52401 SRR12671632.ke.tsv 34699 SRR12671632.se.tsv 87100 total ==> SRR12671632.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1715.06 806 20.5379 Potri.005G024800.1.v4.1 1035 732.056 306 18.2674 Potri.004G059700.1.v4.1 961 658.43 3 0.199118 Potri.007G009000.2.v4.1 1416 1113.06 0 0 Potri.003G141000.2.v4.1 2943 2640.06 1118 18.5066 Potri.016G087400.1.v4.1 270 70.8963 652 401.905 Potri.015G069301.1.v4.1 564 286.255 0 0 Potri.010G195200.1.v4.1 1773 1470.06 35 1.04048 Potri.012G127500.1.v4.1 977 674.261 64 4.14812 ==> SRR12671632.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 137 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 302 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671632 completed mapping pipeline successfully