Starting /dee2/code/volunteer_pipeline.sh SRR12671633 current disk space = 3052601438208 free memory = 1443085612 SRR12671633 SRAfilesize b47b15a899ac1bb12a175c4f37430f18 SRR12671633.sra SRR12671633.sra file validated SRR12671633 is paired end SRR12671633 is conventional basespace SRR12671633 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671633_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4385 37.0 37.0 37.0 37.0 37.0 2 36.314 37.0 37.0 37.0 37.0 37.0 3 36.58 37.0 37.0 37.0 37.0 37.0 4 36.5355 37.0 37.0 37.0 37.0 37.0 5 36.5535 37.0 37.0 37.0 37.0 37.0 6 36.5055 37.0 37.0 37.0 37.0 37.0 7 36.444 37.0 37.0 37.0 37.0 37.0 8 36.4675 37.0 37.0 37.0 37.0 37.0 9 36.5555 37.0 37.0 37.0 37.0 37.0 10-14 36.568799999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5314 37.0 37.0 37.0 37.0 37.0 20-24 36.5338 37.0 37.0 37.0 37.0 37.0 25-29 36.4895 37.0 37.0 37.0 37.0 37.0 30-34 36.482600000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.4828 37.0 37.0 37.0 37.0 37.0 40-44 36.4611 37.0 37.0 37.0 37.0 37.0 45-49 36.430499999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.433800000000005 37.0 37.0 37.0 37.0 37.0 55-59 36.4145 37.0 37.0 37.0 37.0 37.0 60-64 36.375299999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.3934 37.0 37.0 37.0 37.0 37.0 70-74 36.3086 37.0 37.0 37.0 37.0 37.0 75-79 36.345600000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.3435 37.0 37.0 37.0 37.0 37.0 85-89 36.291399999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.2201 37.0 37.0 37.0 37.0 37.0 95-99 36.2471 37.0 37.0 37.0 37.0 37.0 100-104 36.2356 37.0 37.0 37.0 37.0 37.0 105-109 36.161199999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.195299999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.1442 37.0 37.0 37.0 37.0 37.0 120-124 36.0816 37.0 37.0 37.0 37.0 37.0 125-129 36.122699999999995 37.0 37.0 37.0 37.0 37.0 130-134 36.0409 37.0 37.0 37.0 37.0 37.0 135-139 36.003 37.0 37.0 37.0 37.0 37.0 140-144 35.9966 37.0 37.0 37.0 37.0 37.0 145-149 35.8929 37.0 37.0 37.0 37.0 37.0 150-151 35.601749999999996 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 2.0 24 1.0 25 2.0 26 1.0 27 4.0 28 11.0 29 18.0 30 20.0 31 29.0 32 57.0 33 68.0 34 111.0 35 306.0 36 2976.0 37 392.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.875 15.5 12.2 38.425 2 19.629444166249375 20.28042063094642 36.955433149724584 23.13470205307962 3 18.525 26.575 29.125 25.775 4 21.349999999999998 33.375 23.625 21.65 5 22.175 35.699999999999996 23.125 19.0 6 19.05 34.625 25.8 20.525 7 13.275 22.225 44.35 20.150000000000002 8 19.275000000000002 23.474999999999998 28.525 28.725 9 17.95 22.400000000000002 32.375 27.275 10-14 20.49 28.525 26.395000000000003 24.59 15-19 20.055 27.529999999999998 27.96 24.455 20-24 20.435 28.449999999999996 27.21 23.905 25-29 20.75 28.49 26.815 23.945 30-34 20.330000000000002 27.325 27.555000000000003 24.79 35-39 20.32 28.46 27.16 24.060000000000002 40-44 20.835 27.495000000000005 27.515 24.154999999999998 45-49 20.875 27.615000000000002 27.05 24.46 50-54 20.415 28.915000000000003 26.669999999999998 24.0 55-59 20.24 27.915 27.200000000000003 24.645 60-64 20.599999999999998 27.785 27.045 24.57 65-69 20.549999999999997 27.51 27.38 24.560000000000002 70-74 20.93 27.63 27.389999999999997 24.05 75-79 20.77 27.644999999999996 27.42 24.165 80-84 20.72 27.025 27.37 24.884999999999998 85-89 21.08 27.339999999999996 27.245 24.335 90-94 20.62 27.71 27.245 24.425 95-99 21.04 27.295 27.655 24.01 100-104 21.235 27.089999999999996 27.43 24.245 105-109 20.93 27.495000000000005 27.42 24.154999999999998 110-114 21.295 27.51 27.265 23.93 115-119 21.34 27.88 26.525 24.255 120-124 21.285 27.245 26.415 25.055 125-129 21.41 26.93 27.250000000000004 24.41 130-134 21.709999999999997 27.295 26.900000000000002 24.095 135-139 21.29 27.169999999999998 26.965 24.575 140-144 21.584999999999997 26.555 26.790000000000003 25.069999999999997 145-149 21.529999999999998 27.63 26.72 24.12 150-151 21.337500000000002 27.287499999999998 26.7625 24.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.0 23 2.0 24 1.5 25 3.0 26 4.5 27 6.5 28 8.0 29 9.0 30 15.0 31 22.0 32 35.5 33 41.5 34 41.0 35 59.0 36 80.0 37 94.5 38 119.0 39 143.0 40 158.5 41 172.0 42 198.5 43 234.5 44 246.5 45 255.0 46 261.0 47 260.5 48 253.5 49 221.5 50 199.0 51 177.0 52 144.0 53 119.0 54 98.5 55 79.0 56 62.0 57 52.0 58 35.0 59 25.5 60 20.0 61 13.0 62 9.5 63 3.0 64 1.5 65 2.5 66 2.5 67 1.5 68 2.0 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.65 #Duplication Level Percentage of deduplicated Percentage of total 1 93.53977576081152 87.6 2 6.166577682861719 11.55 3 0.2669514148424987 0.75 4 0.026695141484249865 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.1625 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.42500000000000004 0.0 0.0 0.0 0.0 110-111 0.5249999999999999 0.0 0.0 0.0 0.0 112-113 0.6125 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.9 0.0 0.0 0.0 0.0 120-121 1.0625 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.3250000000000002 0.0 0.0 0.0 0.0 126-127 1.45 0.0 0.0 0.0 0.0 128-129 1.575 0.0 0.0 0.0 0.0 130-131 1.8375 0.0 0.0 0.0 0.0 132-133 2.0999999999999996 0.0 0.0 0.0 0.0 134-135 2.3 0.0 0.0 0.0 0.0 136-137 2.5250000000000004 0.0 0.0 0.0 0.0 138-139 2.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTTAT 10 0.006830828 145.0 6 >>END_MODULE SRR12671633 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671633_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4185 37.0 37.0 37.0 37.0 37.0 2 36.212 37.0 37.0 37.0 37.0 37.0 3 36.2565 37.0 37.0 37.0 37.0 37.0 4 36.2305 37.0 37.0 37.0 37.0 37.0 5 36.427 37.0 37.0 37.0 37.0 37.0 6 36.3355 37.0 37.0 37.0 37.0 37.0 7 36.3465 37.0 37.0 37.0 37.0 37.0 8 36.3765 37.0 37.0 37.0 37.0 37.0 9 36.29 37.0 37.0 37.0 37.0 37.0 10-14 36.385799999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.3433 37.0 37.0 37.0 37.0 37.0 20-24 36.337399999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.234300000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.2976 37.0 37.0 37.0 37.0 37.0 35-39 36.1975 37.0 37.0 37.0 37.0 37.0 40-44 36.178599999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.2321 37.0 37.0 37.0 37.0 37.0 50-54 36.1968 37.0 37.0 37.0 37.0 37.0 55-59 36.1617 37.0 37.0 37.0 37.0 37.0 60-64 36.0814 37.0 37.0 37.0 37.0 37.0 65-69 36.067 37.0 37.0 37.0 37.0 37.0 70-74 36.0911 37.0 37.0 37.0 37.0 37.0 75-79 36.031 37.0 37.0 37.0 37.0 37.0 80-84 36.04690000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.9816 37.0 37.0 37.0 37.0 37.0 90-94 35.954899999999995 37.0 37.0 37.0 37.0 37.0 95-99 36.015100000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.8953 37.0 37.0 37.0 37.0 37.0 105-109 35.8836 37.0 37.0 37.0 37.0 37.0 110-114 35.851800000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.865 37.0 37.0 37.0 37.0 37.0 120-124 35.836200000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.7816 37.0 37.0 37.0 37.0 37.0 130-134 35.750899999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.7134 37.0 37.0 37.0 37.0 37.0 140-144 35.5755 37.0 37.0 37.0 37.0 37.0 145-149 35.6641 37.0 37.0 37.0 37.0 37.0 150-151 35.262 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 4.0 15 3.0 16 2.0 17 2.0 18 2.0 19 0.0 20 1.0 21 0.0 22 2.0 23 1.0 24 9.0 25 6.0 26 2.0 27 13.0 28 14.0 29 10.0 30 16.0 31 33.0 32 46.0 33 87.0 34 166.0 35 463.0 36 2842.0 37 274.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.075 19.375 15.174999999999999 28.375 2 26.575 24.8 31.4 17.224999999999998 3 21.224999999999998 27.85 30.575000000000003 20.349999999999998 4 23.575 35.175 21.6 19.650000000000002 5 26.174999999999997 35.525 18.875 19.425 6 20.549999999999997 37.95 21.325 20.175 7 18.55 18.099999999999998 41.349999999999994 22.0 8 21.349999999999998 24.224999999999998 26.1 28.325 9 22.425 24.775 26.174999999999997 26.625 10-14 24.145 28.715000000000003 24.725 22.415 15-19 23.919999999999998 27.875 26.56 21.645 20-24 23.605 27.55 27.07 21.775 25-29 23.585 27.67 26.950000000000003 21.795 30-34 23.674999999999997 27.229999999999997 26.895000000000003 22.2 35-39 23.06 27.77 27.134999999999998 22.035 40-44 23.674999999999997 27.975 26.215 22.134999999999998 45-49 23.635 27.42 27.075 21.87 50-54 23.974999999999998 27.6 26.35 22.075 55-59 23.68 27.605 26.575 22.14 60-64 23.494999999999997 27.150000000000002 26.72 22.634999999999998 65-69 24.305 27.305 26.169999999999998 22.220000000000002 70-74 23.885 27.49 25.885 22.74 75-79 23.935000000000002 27.845 26.240000000000002 21.98 80-84 23.565 27.084999999999997 27.08 22.27 85-89 24.075 26.865 26.650000000000002 22.41 90-94 23.825 26.685 26.99 22.5 95-99 24.335 27.6 26.22 21.845 100-104 24.02 27.474999999999998 26.534999999999997 21.97 105-109 24.04 27.165 26.795 22.0 110-114 23.865 27.12 27.005000000000003 22.009999999999998 115-119 24.295 27.675 26.534999999999997 21.495 120-124 23.98 27.639999999999997 26.685 21.695 125-129 24.375 27.295 26.805 21.525 130-134 24.395 27.655 26.56 21.39 135-139 24.325 27.584999999999997 26.325 21.765 140-144 24.685000000000002 27.21 26.855 21.25 145-149 24.455 27.169999999999998 26.695 21.68 150-151 25.337500000000002 27.200000000000003 26.400000000000002 21.0625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 0.5 24 1.0 25 1.5 26 0.5 27 1.0 28 3.5 29 3.5 30 4.5 31 11.0 32 14.5 33 17.5 34 24.0 35 34.5 36 53.5 37 74.5 38 94.5 39 118.0 40 154.0 41 187.5 42 212.5 43 236.5 44 259.0 45 280.5 46 276.0 47 264.0 48 261.5 49 242.0 50 206.0 51 176.0 52 149.5 53 119.0 54 101.5 55 97.0 56 79.5 57 60.0 58 48.0 59 35.5 60 28.0 61 20.5 62 12.5 63 6.5 64 6.0 65 4.5 66 1.0 67 0.0 68 0.0 69 2.0 70 3.5 71 1.5 72 0.5 73 0.5 74 0.0 75 0.5 76 0.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.2 #Duplication Level Percentage of deduplicated Percentage of total 1 93.45493562231759 87.1 2 5.9281115879828326 11.05 3 0.5364806866952789 1.5 4 0.02682403433476395 0.1 5 0.0536480686695279 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.1875 0.0 0.0 0.0 0.0 124-125 1.3250000000000002 0.0 0.0 0.0 0.0 126-127 1.45 0.0 0.0 0.0 0.0 128-129 1.575 0.0 0.0 0.0 0.0 130-131 1.8125 0.0 0.0 0.0 0.0 132-133 2.0625 0.0 0.0 0.0 0.0 134-135 2.2875 0.0 0.0 0.0 0.0 136-137 2.5250000000000004 0.0 0.0 0.0 0.0 138-139 2.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACAAT 10 0.006830828 145.0 1 TTTTTTT 30 4.189703E-5 29.000002 50-54 >>END_MODULE Read 721085 spots for SRR12671633.sra Written 721085 spots for SRR12671633.sra Read 721085 spots for SRR12671633.sra Written 721085 spots for SRR12671633.sra Read 721085 spots for SRR12671633.sra Written 721085 spots for SRR12671633.sra Read 721085 spots for SRR12671633.sra Written 721085 spots for SRR12671633.sra Read 721085 spots for SRR12671633.sra Written 721085 spots for SRR12671633.sra Read 721085 spots for SRR12671633.sra Written 721085 spots for SRR12671633.sra Read 721085 spots for SRR12671633.sra Written 721085 spots for SRR12671633.sra Read 721085 spots for SRR12671633.sra Written 721085 spots for SRR12671633.sra Read 721085 spots for SRR12671633.sra Written 721085 spots for SRR12671633.sra Read 721085 spots for SRR12671633.sra Written 721085 spots for SRR12671633.sra Read 721085 spots for SRR12671633.sra Written 721085 spots for SRR12671633.sra Read 721085 spots for SRR12671633.sra Written 721085 spots for SRR12671633.sra Read 721085 spots for SRR12671633.sra Written 721085 spots for SRR12671633.sra Read 721085 spots for SRR12671633.sra Written 721085 spots for SRR12671633.sra Read 721085 spots for SRR12671633.sra Written 721085 spots for SRR12671633.sra Read 721085 spots for SRR12671633.sra Written 721085 spots for SRR12671633.sra Read 721085 spots for SRR12671633.sra Written 721085 spots for SRR12671633.sra Read 721085 spots for SRR12671633.sra Written 721085 spots for SRR12671633.sra Read 721104 spots for SRR12671633.sra Written 721104 spots for SRR12671633.sra Read 721085 spots for SRR12671633.sra Written 721085 spots for SRR12671633.sra SRR ids: ['SRR12671633.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nywvthde SRR12671633.sra spots: 14421719 blocks: [[1, 721085], [721086, 1442170], [1442171, 2163255], [2163256, 2884340], [2884341, 3605425], [3605426, 4326510], [4326511, 5047595], [5047596, 5768680], [5768681, 6489765], [6489766, 7210850], [7210851, 7931935], [7931936, 8653020], [8653021, 9374105], [9374106, 10095190], [10095191, 10816275], [10816276, 11537360], [11537361, 12258445], [12258446, 12979530], [12979531, 13700615], [13700616, 14421719]] SRR12671633 file size 4879430 SRR12671633 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671633 SRR12671633_1.fastq SRR12671633_2.fastq Input file: SRR12671633_1.fastq Paired file: SRR12671633_2.fastq trimmed: SRR12671633-trimmed-pair1.fastq, SRR12671633-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 22:46:03 2025 >> started Tue Feb 11 22:46:19 2025 >> done (16.604s) 14421719 read pairs processed; of these: 6 ( 0.00%) short read pairs filtered out after trimming by size control 2804 ( 0.02%) empty read pairs filtered out after trimming by size control 14418909 (99.98%) read pairs available; of these: 715742 ( 4.96%) trimmed read pairs available after processing 13703167 (95.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 2 0.00% 22 1 0.00% 23 5 0.00% 24 4 0.00% 25 2 0.00% 26 1 0.00% 27 4 0.00% 28 5 0.00% 29 6 0.00% 30 9 0.00% 31 8 0.00% 32 6 0.00% 33 6 0.00% 34 7 0.00% 35 6 0.00% 36 14 0.00% 37 10 0.00% 38 17 0.00% 39 9 0.00% 40 12 0.00% 41 10 0.00% 42 12 0.00% 43 14 0.00% 44 19 0.00% 45 20 0.00% 46 23 0.00% 47 14 0.00% 48 22 0.00% 49 36 0.00% 50 34 0.00% 51 30 0.00% 52 42 0.00% 53 48 0.00% 54 45 0.00% 55 43 0.00% 56 67 0.00% 57 66 0.00% 58 62 0.00% 59 81 0.00% 60 89 0.00% 61 92 0.00% 62 107 0.00% 63 122 0.00% 64 90 0.00% 65 128 0.00% 66 149 0.00% 67 143 0.00% 68 153 0.00% 69 183 0.00% 70 232 0.00% 71 288 0.00% 72 318 0.00% 73 320 0.00% 74 386 0.00% 75 441 0.00% 76 463 0.00% 77 495 0.00% 78 567 0.00% 79 602 0.00% 80 709 0.00% 81 722 0.01% 82 894 0.01% 83 1015 0.01% 84 1136 0.01% 85 1202 0.01% 86 1242 0.01% 87 1343 0.01% 88 1451 0.01% 89 1600 0.01% 90 1704 0.01% 91 1902 0.01% 92 2119 0.01% 93 2465 0.02% 94 2540 0.02% 95 2774 0.02% 96 2820 0.02% 97 3072 0.02% 98 3147 0.02% 99 3370 0.02% 100 3600 0.02% 101 3794 0.03% 102 4262 0.03% 103 4593 0.03% 104 4817 0.03% 105 5133 0.04% 106 5215 0.04% 107 5485 0.04% 108 5526 0.04% 109 5847 0.04% 110 6155 0.04% 111 6385 0.04% 112 7054 0.05% 113 7457 0.05% 114 7770 0.05% 115 8213 0.06% 116 8552 0.06% 117 8636 0.06% 118 9140 0.06% 119 9181 0.06% 120 9860 0.07% 121 10103 0.07% 122 10416 0.07% 123 11530 0.08% 124 11784 0.08% 125 12571 0.09% 126 13047 0.09% 127 13267 0.09% 128 13575 0.09% 129 13668 0.09% 130 13945 0.10% 131 14514 0.10% 132 15017 0.10% 133 16377 0.11% 134 17060 0.12% 135 17709 0.12% 136 18092 0.13% 137 18676 0.13% 138 19013 0.13% 139 19577 0.14% 140 19523 0.14% 141 19944 0.14% 142 20755 0.14% 143 21636 0.15% 144 23072 0.16% 145 23924 0.17% 146 24903 0.17% 147 25179 0.17% 148 25561 0.18% 149 25574 0.18% 150 25636 0.18% 151 13703167 95.04% 14418909 reads passed initial QC criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=18 prefix-density=1.00 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=34.54 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=5.5 sequence=CAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=19 prefix-density=1.01 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=22 fanout-score=45.92 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=9.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR12671633 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 22:47:05 Started mapping on | Feb 11 22:47:05 Finished on | Feb 11 22:48:43 Mapping speed, Million of reads per hour | 529.67 Number of input reads | 14418909 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 13276835 Uniquely mapped reads % | 92.08% Average mapped length | 298.82 Number of splices: Total | 13884834 Number of splices: Annotated (sjdb) | 13671992 Number of splices: GT/AG | 13589679 Number of splices: GC/AG | 257507 Number of splices: AT/AC | 7748 Number of splices: Non-canonical | 29900 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 373424 % of reads mapped to multiple loci | 2.59% Number of reads mapped to too many loci | 130275 % of reads mapped to too many loci | 0.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.25% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 768650 768650 768650 N_multimapping 373424 373424 373424 N_noFeature 288370 13034548 348027 N_ambiguous 269667 847 86605 UnstrandedReadsAssigned:12718798 PositiveStrandReadsAssigned:241440 NegativeStrandReadsAssigned:12842203 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671633 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671633-trimmed-pair1.fastq SRR12671633-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,418,909 reads, 12,928,281 reads pseudoaligned [quant] estimated average fragment length: 287.393 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,103 rounds 52401 SRR12671633.ke.tsv 34699 SRR12671633.se.tsv 87100 total ==> SRR12671633.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1731.61 441 15.1198 Potri.005G024800.1.v4.1 1035 748.607 170 13.482 Potri.004G059700.1.v4.1 961 674.784 7 0.615873 Potri.007G009000.2.v4.1 1416 1129.61 0 0 Potri.003G141000.2.v4.1 2943 2656.61 522 11.6654 Potri.016G087400.1.v4.1 270 71.3325 553 460.252 Potri.015G069301.1.v4.1 564 294.81 0 0 Potri.010G195200.1.v4.1 1773 1486.61 36 1.43769 Potri.012G127500.1.v4.1 977 690.694 169 14.5264 ==> SRR12671633.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 301 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 290 Potri.001G212900.v4.1 134 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12671633 completed mapping pipeline successfully