Starting /dee2/code/volunteer_pipeline.sh SRR12671634 current disk space = 3052380717056 free memory = 1457833128 SRR12671634 SRAfilesize 08fb6d368dbbe55cde3e2e5ca2927413 SRR12671634.sra SRR12671634.sra file validated SRR12671634 is paired end SRR12671634 is conventional basespace SRR12671634 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671634_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.415 37.0 37.0 37.0 37.0 37.0 2 36.246 37.0 37.0 37.0 37.0 37.0 3 36.484 37.0 37.0 37.0 37.0 37.0 4 36.4275 37.0 37.0 37.0 37.0 37.0 5 36.482 37.0 37.0 37.0 37.0 37.0 6 36.529 37.0 37.0 37.0 37.0 37.0 7 36.507 37.0 37.0 37.0 37.0 37.0 8 36.569 37.0 37.0 37.0 37.0 37.0 9 36.6135 37.0 37.0 37.0 37.0 37.0 10-14 36.5414 37.0 37.0 37.0 37.0 37.0 15-19 36.5264 37.0 37.0 37.0 37.0 37.0 20-24 36.522499999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.476299999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.481899999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.5005 37.0 37.0 37.0 37.0 37.0 40-44 36.468 37.0 37.0 37.0 37.0 37.0 45-49 36.430499999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.4217 37.0 37.0 37.0 37.0 37.0 55-59 36.3734 37.0 37.0 37.0 37.0 37.0 60-64 36.4049 37.0 37.0 37.0 37.0 37.0 65-69 36.349900000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.3435 37.0 37.0 37.0 37.0 37.0 75-79 36.323699999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.323899999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.2832 37.0 37.0 37.0 37.0 37.0 90-94 36.2769 37.0 37.0 37.0 37.0 37.0 95-99 36.215700000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.2541 37.0 37.0 37.0 37.0 37.0 105-109 36.156400000000005 37.0 37.0 37.0 37.0 37.0 110-114 36.184 37.0 37.0 37.0 37.0 37.0 115-119 36.1505 37.0 37.0 37.0 37.0 37.0 120-124 36.112399999999994 37.0 37.0 37.0 37.0 37.0 125-129 36.0862 37.0 37.0 37.0 37.0 37.0 130-134 36.053999999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.956900000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.9695 37.0 37.0 37.0 37.0 37.0 145-149 35.8594 37.0 37.0 37.0 37.0 37.0 150-151 35.322 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 25 1.0 26 3.0 27 5.0 28 8.0 29 21.0 30 28.0 31 33.0 32 52.0 33 70.0 34 110.0 35 294.0 36 2991.0 37 384.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.424999999999997 15.075 12.225 41.275 2 20.572002007024587 22.027094831911693 39.66382338183643 17.737079779227297 3 18.7 26.625 26.174999999999997 28.499999999999996 4 22.125 35.449999999999996 20.95 21.475 5 21.075 36.175000000000004 23.95 18.8 6 17.375 36.0 26.525 20.1 7 13.5 20.95 44.55 21.0 8 17.575 22.3 31.05 29.075 9 16.275000000000002 22.675 33.225 27.825 10-14 19.625 29.485 26.919999999999998 23.97 15-19 19.12 28.134999999999998 27.855 24.89 20-24 19.465 27.955000000000002 28.189999999999998 24.39 25-29 19.470000000000002 28.42 27.955000000000002 24.154999999999998 30-34 19.805 28.405 27.560000000000002 24.23 35-39 19.655 28.58 27.715 24.05 40-44 20.04 28.405 27.155 24.4 45-49 19.595000000000002 28.37 27.725 24.310000000000002 50-54 19.89 28.285 28.144999999999996 23.68 55-59 19.61 28.88 27.700000000000003 23.810000000000002 60-64 19.43 28.325 28.305000000000003 23.94 65-69 20.175 28.384999999999998 27.36 24.08 70-74 20.145 28.925 27.625 23.305 75-79 20.125 28.299999999999997 28.084999999999997 23.49 80-84 20.335 28.23 27.63 23.805 85-89 20.48 28.470000000000002 26.810000000000002 24.240000000000002 90-94 19.744999999999997 28.884999999999998 27.529999999999998 23.84 95-99 20.849999999999998 27.99 27.725 23.435 100-104 20.77 28.610000000000003 27.134999999999998 23.485 105-109 20.175 28.754999999999995 27.889999999999997 23.18 110-114 20.555 28.09 27.715 23.64 115-119 21.38 28.76 26.810000000000002 23.05 120-124 21.15 27.389999999999997 27.735 23.724999999999998 125-129 20.755000000000003 28.15 27.400000000000002 23.695 130-134 20.855 28.425 26.75 23.97 135-139 20.11 28.215 27.865000000000002 23.810000000000002 140-144 21.275 28.139999999999997 26.47 24.115000000000002 145-149 20.385 28.48 27.150000000000002 23.985 150-151 21.2625 28.15 27.250000000000004 23.3375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 1.0 19 1.5 20 2.0 21 2.0 22 2.0 23 3.0 24 4.0 25 7.0 26 7.5 27 4.0 28 8.0 29 16.0 30 20.5 31 28.5 32 33.0 33 32.0 34 52.0 35 78.0 36 95.5 37 112.5 38 135.0 39 172.0 40 193.5 41 207.5 42 229.0 43 255.5 44 276.5 45 276.0 46 258.5 47 249.0 48 229.0 49 187.5 50 164.5 51 136.5 52 113.5 53 101.5 54 75.5 55 57.0 56 52.5 57 39.0 58 24.5 59 20.5 60 12.5 61 5.5 62 5.5 63 3.0 64 0.0 65 1.0 66 1.0 67 2.0 68 2.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.6 #Duplication Level Percentage of deduplicated Percentage of total 1 94.52959830866807 89.425 2 5.2589852008456655 9.950000000000001 3 0.18498942917547567 0.525 4 0.026427061310782242 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.025 0.0 0.0 0.025 0.0 48-49 0.025 0.0 0.0 0.025 0.0 50-51 0.025 0.0 0.0 0.025 0.0 52-53 0.025 0.0 0.0 0.025 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.075 0.0 0.0 0.025 0.0 68-69 0.1 0.0 0.0 0.025 0.0 70-71 0.1 0.0 0.0 0.025 0.0 72-73 0.1 0.0 0.0 0.025 0.0 74-75 0.1125 0.0 0.0 0.025 0.0 76-77 0.125 0.0 0.0 0.025 0.0 78-79 0.125 0.0 0.0 0.025 0.0 80-81 0.15 0.0 0.0 0.025 0.0 82-83 0.2125 0.0 0.0 0.025 0.0 84-85 0.3 0.0 0.0 0.025 0.0 86-87 0.3 0.0 0.0 0.025 0.0 88-89 0.32499999999999996 0.0 0.0 0.025 0.0 90-91 0.4 0.0 0.0 0.025 0.0 92-93 0.45 0.0 0.0 0.025 0.0 94-95 0.5 0.0 0.0 0.025 0.0 96-97 0.5875 0.0 0.0 0.025 0.0 98-99 0.7124999999999999 0.0 0.0 0.025 0.0 100-101 0.85 0.0 0.0 0.025 0.0 102-103 0.925 0.0 0.0 0.025 0.0 104-105 1.0625 0.0 0.0 0.025 0.0 106-107 1.325 0.0 0.0 0.025 0.0 108-109 1.475 0.0 0.0 0.025 0.0 110-111 1.5875 0.0 0.0 0.025 0.0 112-113 1.7125 0.0 0.0 0.025 0.0 114-115 1.85 0.0 0.0 0.025 0.0 116-117 2.1624999999999996 0.0 0.0 0.025 0.0 118-119 2.5999999999999996 0.0 0.0 0.025 0.0 120-121 2.8125 0.0 0.0 0.025 0.0 122-123 3.0625 0.0 0.0 0.025 0.0 124-125 3.3 0.0 0.0 0.025 0.0 126-127 3.55 0.0 0.0 0.025 0.0 128-129 3.8 0.0 0.0 0.025 0.0 130-131 4.050000000000001 0.0 0.0 0.025 0.0 132-133 4.4125 0.0 0.0 0.025 0.0 134-135 4.8 0.0 0.0 0.025 0.0 136-137 5.125 0.0 0.0 0.025 0.0 138-139 5.4375 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCGAAC 10 0.006830828 145.0 145 CCCAAAT 10 0.006830828 145.0 1 >>END_MODULE SRR12671634 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671634_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0265 37.0 37.0 37.0 37.0 37.0 2 35.9835 37.0 37.0 37.0 37.0 37.0 3 36.058 37.0 37.0 37.0 37.0 37.0 4 35.9695 37.0 37.0 37.0 37.0 37.0 5 36.277 37.0 37.0 37.0 37.0 37.0 6 36.1535 37.0 37.0 37.0 37.0 37.0 7 36.2455 37.0 37.0 37.0 37.0 37.0 8 36.279 37.0 37.0 37.0 37.0 37.0 9 36.175 37.0 37.0 37.0 37.0 37.0 10-14 36.1862 37.0 37.0 37.0 37.0 37.0 15-19 36.1576 37.0 37.0 37.0 37.0 37.0 20-24 36.1366 37.0 37.0 37.0 37.0 37.0 25-29 36.0185 37.0 37.0 37.0 37.0 37.0 30-34 36.067899999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.0835 37.0 37.0 37.0 37.0 37.0 40-44 36.0005 37.0 37.0 37.0 37.0 37.0 45-49 35.9856 37.0 37.0 37.0 37.0 37.0 50-54 36.0219 37.0 37.0 37.0 37.0 37.0 55-59 36.0181 37.0 37.0 37.0 37.0 37.0 60-64 35.8897 37.0 37.0 37.0 37.0 37.0 65-69 35.875800000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.8219 37.0 37.0 37.0 37.0 37.0 75-79 35.6998 37.0 37.0 37.0 37.0 37.0 80-84 35.8063 37.0 37.0 37.0 37.0 37.0 85-89 35.767700000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.7519 37.0 37.0 37.0 37.0 37.0 95-99 35.7325 37.0 37.0 37.0 37.0 37.0 100-104 35.7248 37.0 37.0 37.0 37.0 37.0 105-109 35.666599999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.6128 37.0 37.0 37.0 37.0 37.0 115-119 35.5718 37.0 37.0 37.0 37.0 37.0 120-124 35.5658 37.0 37.0 37.0 37.0 37.0 125-129 35.3911 37.0 37.0 37.0 37.0 37.0 130-134 35.4471 37.0 37.0 37.0 37.0 37.0 135-139 35.4317 37.0 37.0 37.0 37.0 37.0 140-144 35.058899999999994 37.0 37.0 37.0 27.4 37.0 145-149 35.25430000000001 37.0 37.0 37.0 32.2 37.0 150-151 34.772499999999994 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 2.0 16 0.0 17 0.0 18 1.0 19 0.0 20 0.0 21 2.0 22 0.0 23 9.0 24 7.0 25 8.0 26 6.0 27 9.0 28 16.0 29 25.0 30 31.0 31 59.0 32 77.0 33 148.0 34 241.0 35 622.0 36 2539.0 37 195.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.925 15.25 16.775000000000002 33.050000000000004 2 24.75 22.1 37.05 16.1 3 20.724999999999998 25.900000000000002 31.674999999999997 21.7 4 22.975 36.55 21.575 18.9 5 23.5 36.425000000000004 22.400000000000002 17.675 6 17.675 39.5 22.8 20.025000000000002 7 17.825 17.150000000000002 43.075 21.95 8 20.599999999999998 21.7 27.975 29.725 9 21.8 24.5 30.125 23.575 10-14 22.650000000000002 28.395 26.919999999999998 22.035 15-19 22.605 27.800000000000004 28.01 21.584999999999997 20-24 23.01 27.73 28.144999999999996 21.115000000000002 25-29 22.835 27.744999999999997 27.61 21.81 30-34 22.305 27.66 28.51 21.525 35-39 22.745 27.915 27.97 21.37 40-44 22.63 28.37 27.544999999999998 21.455 45-49 23.150000000000002 28.225 27.73 20.895 50-54 22.85 28.395 27.485 21.27 55-59 22.865 28.01 27.445000000000004 21.68 60-64 22.395 27.805000000000003 27.855 21.945 65-69 23.119999999999997 27.584999999999997 27.474999999999998 21.82 70-74 22.384999999999998 28.24 27.575 21.8 75-79 22.71 28.16 27.07 22.06 80-84 23.445 26.815 28.044999999999998 21.695 85-89 23.46 28.04 27.18 21.32 90-94 23.235 28.035 27.52 21.21 95-99 23.405 28.175 27.22 21.2 100-104 23.235 27.825 27.810000000000002 21.13 105-109 23.415 27.665 27.855 21.065 110-114 24.295 27.694999999999997 27.615000000000002 20.395 115-119 24.185000000000002 28.075 27.245 20.495 120-124 24.385 27.384999999999998 27.229999999999997 21.0 125-129 24.005000000000003 27.605 27.66 20.73 130-134 24.98 27.375 26.955000000000002 20.69 135-139 24.529999999999998 27.49 27.639999999999997 20.34 140-144 24.295 27.61 27.445000000000004 20.65 145-149 25.535000000000004 28.03 26.865 19.57 150-151 25.0625 27.3625 27.6 19.975 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 0.0 23 0.0 24 1.5 25 4.0 26 5.5 27 6.5 28 6.0 29 14.0 30 19.5 31 22.0 32 31.5 33 37.0 34 42.0 35 63.5 36 89.0 37 102.5 38 117.5 39 146.5 40 180.5 41 217.5 42 248.0 43 262.5 44 286.0 45 273.0 46 248.0 47 249.0 48 216.0 49 193.5 50 176.0 51 147.0 52 128.0 53 104.0 54 82.5 55 60.0 56 47.5 57 40.5 58 31.0 59 22.0 60 17.0 61 16.0 62 16.5 63 10.0 64 2.0 65 2.0 66 2.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.375 #Duplication Level Percentage of deduplicated Percentage of total 1 94.59602649006622 89.275 2 5.086092715231788 9.6 3 0.23841059602649006 0.675 4 0.052980132450331126 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026490066225165563 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 10 0.25 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2125 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.38749999999999996 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.525 0.0 0.0 0.0 0.0 110-111 1.6375 0.0 0.0 0.0 0.0 112-113 1.7625000000000002 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.2125000000000004 0.0 0.0 0.0 0.0 118-119 2.6500000000000004 0.0 0.0 0.0 0.0 120-121 2.8625 0.0 0.0 0.0 0.0 122-123 3.1125 0.0 0.0 0.0 0.0 124-125 3.3625 0.0 0.0 0.0 0.0 126-127 3.65 0.0 0.0 0.0 0.0 128-129 3.9125 0.0 0.0 0.0 0.0 130-131 4.175000000000001 0.0 0.0 0.0 0.0 132-133 4.5375 0.0 0.0 0.0 0.0 134-135 4.925 0.0 0.0 0.0 0.0 136-137 5.25 0.0 0.0 0.0 0.0 138-139 5.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGAACT 10 0.006830828 145.0 145 CTGCATA 10 0.006830828 145.0 9 >>END_MODULE Read 1027615 spots for SRR12671634.sra Written 1027615 spots for SRR12671634.sra Read 1027615 spots for SRR12671634.sra Written 1027615 spots for SRR12671634.sra Read 1027615 spots for SRR12671634.sra Written 1027615 spots for SRR12671634.sra Read 1027615 spots for SRR12671634.sra Written 1027615 spots for SRR12671634.sra Read 1027618 spots for SRR12671634.sra Written 1027618 spots for SRR12671634.sra Read 1027615 spots for SRR12671634.sra Written 1027615 spots for SRR12671634.sra Read 1027615 spots for SRR12671634.sra Written 1027615 spots for SRR12671634.sra Read 1027615 spots for SRR12671634.sra Written 1027615 spots for SRR12671634.sra Read 1027615 spots for SRR12671634.sra Written 1027615 spots for SRR12671634.sra Read 1027615 spots for SRR12671634.sra Written 1027615 spots for SRR12671634.sra Read 1027615 spots for SRR12671634.sra Written 1027615 spots for SRR12671634.sra Read 1027615 spots for SRR12671634.sra Written 1027615 spots for SRR12671634.sra Read 1027615 spots for SRR12671634.sra Written 1027615 spots for SRR12671634.sra Read 1027615 spots for SRR12671634.sra Written 1027615 spots for SRR12671634.sra Read 1027615 spots for SRR12671634.sra Written 1027615 spots for SRR12671634.sra Read 1027615 spots for SRR12671634.sra Written 1027615 spots for SRR12671634.sra Read 1027615 spots for SRR12671634.sra Written 1027615 spots for SRR12671634.sra Read 1027615 spots for SRR12671634.sra Written 1027615 spots for SRR12671634.sra Read 1027615 spots for SRR12671634.sra Written 1027615 spots for SRR12671634.sra Read 1027615 spots for SRR12671634.sra Written 1027615 spots for SRR12671634.sra SRR ids: ['SRR12671634.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ldmxjw29 SRR12671634.sra spots: 20552303 blocks: [[1, 1027615], [1027616, 2055230], [2055231, 3082845], [3082846, 4110460], [4110461, 5138075], [5138076, 6165690], [6165691, 7193305], [7193306, 8220920], [8220921, 9248535], [9248536, 10276150], [10276151, 11303765], [11303766, 12331380], [12331381, 13358995], [13358996, 14386610], [14386611, 15414225], [15414226, 16441840], [16441841, 17469455], [17469456, 18497070], [18497071, 19524685], [19524686, 20552303]] SRR12671634 file size 6962871 SRR12671634 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671634 SRR12671634_1.fastq SRR12671634_2.fastq Input file: SRR12671634_1.fastq Paired file: SRR12671634_2.fastq trimmed: SRR12671634-trimmed-pair1.fastq, SRR12671634-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:06:17 2025 >> started Tue Feb 11 23:06:39 2025 >> done (22.779s) 20552303 read pairs processed; of these: 23 ( 0.00%) short read pairs filtered out after trimming by size control 3701 ( 0.02%) empty read pairs filtered out after trimming by size control 20548579 (99.98%) read pairs available; of these: 1644424 ( 8.00%) trimmed read pairs available after processing 18904155 (92.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 5 0.00% 24 6 0.00% 25 8 0.00% 26 4 0.00% 27 10 0.00% 28 5 0.00% 29 6 0.00% 30 7 0.00% 31 8 0.00% 32 18 0.00% 33 17 0.00% 34 17 0.00% 35 24 0.00% 36 16 0.00% 37 43 0.00% 38 38 0.00% 39 36 0.00% 40 38 0.00% 41 36 0.00% 42 43 0.00% 43 59 0.00% 44 62 0.00% 45 57 0.00% 46 65 0.00% 47 69 0.00% 48 101 0.00% 49 89 0.00% 50 132 0.00% 51 112 0.00% 52 135 0.00% 53 135 0.00% 54 143 0.00% 55 182 0.00% 56 181 0.00% 57 208 0.00% 58 244 0.00% 59 277 0.00% 60 320 0.00% 61 385 0.00% 62 361 0.00% 63 425 0.00% 64 459 0.00% 65 512 0.00% 66 575 0.00% 67 676 0.00% 68 645 0.00% 69 752 0.00% 70 859 0.00% 71 972 0.00% 72 1125 0.01% 73 1271 0.01% 74 1483 0.01% 75 1540 0.01% 76 1713 0.01% 77 1823 0.01% 78 1931 0.01% 79 2276 0.01% 80 2433 0.01% 81 2746 0.01% 82 3132 0.02% 83 3452 0.02% 84 3924 0.02% 85 4235 0.02% 86 4414 0.02% 87 4681 0.02% 88 5408 0.03% 89 5727 0.03% 90 6111 0.03% 91 6695 0.03% 92 7156 0.03% 93 7922 0.04% 94 8562 0.04% 95 9224 0.04% 96 9545 0.05% 97 10094 0.05% 98 10718 0.05% 99 11216 0.05% 100 11636 0.06% 101 12251 0.06% 102 13065 0.06% 103 13954 0.07% 104 14572 0.07% 105 15217 0.07% 106 16011 0.08% 107 16677 0.08% 108 17140 0.08% 109 18070 0.09% 110 18760 0.09% 111 19332 0.09% 112 19824 0.10% 113 20510 0.10% 114 21256 0.10% 115 22428 0.11% 116 22811 0.11% 117 23437 0.11% 118 24264 0.12% 119 24573 0.12% 120 25478 0.12% 121 26417 0.13% 122 26625 0.13% 123 27895 0.14% 124 28677 0.14% 125 29096 0.14% 126 29886 0.15% 127 30978 0.15% 128 31299 0.15% 129 31891 0.16% 130 32564 0.16% 131 33040 0.16% 132 33877 0.16% 133 35660 0.17% 134 35641 0.17% 135 37059 0.18% 136 37765 0.18% 137 38042 0.19% 138 38626 0.19% 139 39466 0.19% 140 39587 0.19% 141 40308 0.20% 142 41917 0.20% 143 41937 0.20% 144 43817 0.21% 145 44297 0.22% 146 44837 0.22% 147 44999 0.22% 148 45302 0.22% 149 45501 0.22% 150 46009 0.22% 151 18904155 92.00% 20548579 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=37 prefix-density=0.43 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=132.82 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=9.3 sequence=TCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGATATAGCTAGGGACACATCAAGTTCTGGGACGACTTAGACACCTTTCGGCTTGGCGGCAATAAAGCTGATGCACTGCACTTGACG criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=36 prefix-density=0.95 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.12 sequence-density-rank=21 fanout-score=43.12 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=14.0 sequence=AAAGAAAAGAAAA SRR12671634 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:07:23 Started mapping on | Feb 11 23:07:23 Finished on | Feb 11 23:09:57 Mapping speed, Million of reads per hour | 480.36 Number of input reads | 20548579 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 19380270 Uniquely mapped reads % | 94.31% Average mapped length | 296.69 Number of splices: Total | 19812345 Number of splices: Annotated (sjdb) | 19379143 Number of splices: GT/AG | 19420828 Number of splices: GC/AG | 316580 Number of splices: AT/AC | 11257 Number of splices: Non-canonical | 63680 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 471293 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 160805 % of reads mapped to too many loci | 0.78% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.46% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 697016 697016 697016 N_multimapping 471293 471293 471293 N_noFeature 761468 19038612 878442 N_ambiguous 347497 1632 121886 UnstrandedReadsAssigned:18271305 PositiveStrandReadsAssigned:340026 NegativeStrandReadsAssigned:18379942 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671634 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671634-trimmed-pair1.fastq SRR12671634-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,548,579 reads, 18,346,914 reads pseudoaligned [quant] estimated average fragment length: 296.645 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR12671634.ke.tsv 34699 SRR12671634.se.tsv 87100 total ==> SRR12671634.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1722.36 839 24.7439 Potri.005G024800.1.v4.1 1035 739.355 399 27.4125 Potri.004G059700.1.v4.1 961 666.091 6 0.457559 Potri.007G009000.2.v4.1 1416 1120.36 0 0 Potri.003G141000.2.v4.1 2943 2647.36 1175.92 22.5628 Potri.016G087400.1.v4.1 270 82.1813 873.395 539.842 Potri.015G069301.1.v4.1 564 300.163 0 0 Potri.010G195200.1.v4.1 1773 1477.36 121 4.16035 Potri.012G127500.1.v4.1 977 681.71 121 9.01603 ==> SRR12671634.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 223 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 214 Potri.001G212900.v4.1 13 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 28 SRR12671634 completed mapping pipeline successfully