Starting /dee2/code/volunteer_pipeline.sh SRR12671635 current disk space = 3052376563712 free memory = 1460884996 SRR12671635 SRAfilesize 2ad0c2d61a9c962fcd07162715420cd8 SRR12671635.sra SRR12671635.sra file validated SRR12671635 is paired end SRR12671635 is conventional basespace SRR12671635 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671635_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.412 37.0 37.0 37.0 37.0 37.0 2 36.1845 37.0 37.0 37.0 37.0 37.0 3 36.4455 37.0 37.0 37.0 37.0 37.0 4 36.493 37.0 37.0 37.0 37.0 37.0 5 36.48 37.0 37.0 37.0 37.0 37.0 6 36.5695 37.0 37.0 37.0 37.0 37.0 7 36.563 37.0 37.0 37.0 37.0 37.0 8 36.527 37.0 37.0 37.0 37.0 37.0 9 36.6005 37.0 37.0 37.0 37.0 37.0 10-14 36.533100000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.5346 37.0 37.0 37.0 37.0 37.0 20-24 36.4904 37.0 37.0 37.0 37.0 37.0 25-29 36.4695 37.0 37.0 37.0 37.0 37.0 30-34 36.4628 37.0 37.0 37.0 37.0 37.0 35-39 36.4123 37.0 37.0 37.0 37.0 37.0 40-44 36.4484 37.0 37.0 37.0 37.0 37.0 45-49 36.3757 37.0 37.0 37.0 37.0 37.0 50-54 36.367200000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.3739 37.0 37.0 37.0 37.0 37.0 60-64 36.3903 37.0 37.0 37.0 37.0 37.0 65-69 36.31420000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.29860000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.303399999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.2933 37.0 37.0 37.0 37.0 37.0 85-89 36.1921 37.0 37.0 37.0 37.0 37.0 90-94 36.18919999999999 37.0 37.0 37.0 37.0 37.0 95-99 36.163 37.0 37.0 37.0 37.0 37.0 100-104 36.179199999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.1244 37.0 37.0 37.0 37.0 37.0 110-114 36.114 37.0 37.0 37.0 37.0 37.0 115-119 36.0692 37.0 37.0 37.0 37.0 37.0 120-124 36.0181 37.0 37.0 37.0 37.0 37.0 125-129 35.993 37.0 37.0 37.0 37.0 37.0 130-134 35.894600000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.893299999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8173 37.0 37.0 37.0 37.0 37.0 145-149 35.747800000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.269999999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 2.0 24 1.0 25 2.0 26 6.0 27 2.0 28 9.0 29 23.0 30 30.0 31 42.0 32 39.0 33 83.0 34 130.0 35 306.0 36 2957.0 37 367.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.799999999999997 14.75 11.65 44.800000000000004 2 19.408224674022065 21.213640922768302 40.99799398194583 18.38014042126379 3 18.099999999999998 26.424999999999997 27.125 28.349999999999998 4 20.674999999999997 33.95 22.7 22.675 5 21.8 36.575 23.05 18.575 6 17.474999999999998 35.475 27.425 19.625 7 13.350000000000001 20.325 46.45 19.875 8 17.75 21.975 30.4 29.875 9 18.075 20.8 33.4 27.725 10-14 19.675 28.494999999999997 27.500000000000004 24.33 15-19 19.645000000000003 27.805000000000003 28.015 24.535 20-24 19.45 28.76 28.035 23.755000000000003 25-29 19.82 27.950000000000003 27.855 24.375 30-34 19.99 28.65 27.575 23.785 35-39 19.7 28.49 27.839999999999996 23.97 40-44 20.044999999999998 28.62 27.515 23.82 45-49 19.78 27.55 28.365000000000002 24.305 50-54 19.675 28.084999999999997 28.165000000000003 24.075 55-59 20.330000000000002 28.189999999999998 28.275 23.205000000000002 60-64 19.85 28.575 27.615000000000002 23.96 65-69 19.634999999999998 28.265 27.71 24.39 70-74 20.155 28.225 27.839999999999996 23.78 75-79 19.36 28.165000000000003 28.494999999999997 23.98 80-84 19.915 28.485 27.744999999999997 23.855 85-89 20.325 28.275 27.735 23.665 90-94 20.46 28.815 27.345000000000002 23.380000000000003 95-99 20.115 28.294999999999998 27.93 23.66 100-104 20.16 28.605000000000004 27.639999999999997 23.595 105-109 20.655 27.525 27.705000000000002 24.115000000000002 110-114 20.91 27.685 28.244999999999997 23.16 115-119 20.195 28.23 27.98 23.595 120-124 20.599999999999998 28.43 27.655 23.315 125-129 20.62 28.485 27.005000000000003 23.89 130-134 20.775 28.51 27.01 23.705000000000002 135-139 20.34 28.23 27.310000000000002 24.12 140-144 21.415 27.98 27.215 23.39 145-149 21.16 27.925 27.005000000000003 23.91 150-151 20.849999999999998 28.025 26.7625 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 0.5 20 2.5 21 4.0 22 3.5 23 3.0 24 3.5 25 5.0 26 6.5 27 7.0 28 9.5 29 12.5 30 19.0 31 32.0 32 34.0 33 35.0 34 52.0 35 71.0 36 96.5 37 120.5 38 147.5 39 171.5 40 183.0 41 216.0 42 240.5 43 241.0 44 258.5 45 279.0 46 265.5 47 226.5 48 220.0 49 211.0 50 175.5 51 143.0 52 115.0 53 89.0 54 66.0 55 55.0 56 51.0 57 36.5 58 22.5 59 21.5 60 14.0 61 11.5 62 9.5 63 4.5 64 2.0 65 1.5 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.325 #Duplication Level Percentage of deduplicated Percentage of total 1 94.54015372382719 89.17500000000001 2 5.009276437847866 9.45 3 0.39756162205141793 1.125 4 0.026504108136761195 0.1 5 0.0 0.0 6 0.026504108136761195 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTAAATAACTCACCAGTATAACTATTTTATATCCACTCATCATA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.15000000000000002 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.65 0.0 0.0 0.0 0.0 108-109 0.7250000000000001 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.55 0.0 0.0 0.0 0.0 120-121 1.6375000000000002 0.0 0.0 0.0 0.0 122-123 1.8125 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.0625 0.0 0.0 0.0 0.0 128-129 2.2375 0.0 0.0 0.0 0.0 130-131 2.4749999999999996 0.0 0.0 0.0 0.0 132-133 2.7 0.0 0.0 0.0 0.0 134-135 2.9375 0.0 0.0 0.0 0.0 136-137 3.175 0.0 0.0 0.0 0.0 138-139 3.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAAAC 10 0.006830828 145.0 6 GCCAAAG 10 0.006830828 145.0 1 >>END_MODULE SRR12671635 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671635_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.036 37.0 37.0 37.0 37.0 37.0 2 35.8695 37.0 37.0 37.0 37.0 37.0 3 35.983 37.0 37.0 37.0 37.0 37.0 4 36.0005 37.0 37.0 37.0 37.0 37.0 5 36.201 37.0 37.0 37.0 37.0 37.0 6 36.128 37.0 37.0 37.0 37.0 37.0 7 36.2135 37.0 37.0 37.0 37.0 37.0 8 36.311 37.0 37.0 37.0 37.0 37.0 9 36.1425 37.0 37.0 37.0 37.0 37.0 10-14 36.226800000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.2035 37.0 37.0 37.0 37.0 37.0 20-24 36.14960000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.157000000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.0988 37.0 37.0 37.0 37.0 37.0 35-39 36.1074 37.0 37.0 37.0 37.0 37.0 40-44 36.059400000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.0151 37.0 37.0 37.0 37.0 37.0 50-54 36.05219999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.008 37.0 37.0 37.0 37.0 37.0 60-64 35.9002 37.0 37.0 37.0 37.0 37.0 65-69 35.944399999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.9225 37.0 37.0 37.0 37.0 37.0 75-79 35.7833 37.0 37.0 37.0 37.0 37.0 80-84 35.8632 37.0 37.0 37.0 37.0 37.0 85-89 35.7941 37.0 37.0 37.0 37.0 37.0 90-94 35.734100000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.8257 37.0 37.0 37.0 37.0 37.0 100-104 35.7534 37.0 37.0 37.0 37.0 37.0 105-109 35.6648 37.0 37.0 37.0 37.0 37.0 110-114 35.620000000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.5983 37.0 37.0 37.0 37.0 37.0 120-124 35.5587 37.0 37.0 37.0 37.0 37.0 125-129 35.5269 37.0 37.0 37.0 37.0 37.0 130-134 35.5159 37.0 37.0 37.0 37.0 37.0 135-139 35.4469 37.0 37.0 37.0 37.0 37.0 140-144 35.2025 37.0 37.0 37.0 32.2 37.0 145-149 35.293400000000005 37.0 37.0 37.0 34.6 37.0 150-151 34.96625 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 2.0 21 2.0 22 2.0 23 2.0 24 3.0 25 5.0 26 16.0 27 14.0 28 12.0 29 29.0 30 36.0 31 51.0 32 71.0 33 137.0 34 225.0 35 604.0 36 2601.0 37 187.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.675 15.35 15.975 36.0 2 23.75 23.25 37.025000000000006 15.975 3 18.95 26.125 32.15 22.775000000000002 4 21.625 34.925 22.7 20.75 5 23.65 37.175000000000004 22.175 17.0 6 16.725 37.925 25.074999999999996 20.275000000000002 7 17.025000000000002 16.05 45.225 21.7 8 19.15 22.35 27.125 31.374999999999996 9 20.025000000000002 24.775 29.5 25.7 10-14 21.925 28.38 27.415 22.28 15-19 21.985 27.825 27.865000000000002 22.325 20-24 22.115000000000002 28.599999999999998 27.750000000000004 21.535 25-29 21.94 28.18 28.18 21.7 30-34 22.235 28.110000000000003 27.900000000000002 21.755 35-39 22.065 27.900000000000002 28.04 21.995 40-44 22.16 27.96 28.005000000000003 21.875 45-49 21.755 28.29 27.779999999999998 22.175 50-54 23.02 27.58 27.765 21.634999999999998 55-59 22.86 27.875 27.800000000000004 21.465 60-64 22.555 27.915 28.21 21.32 65-69 23.21 27.82 28.095 20.875 70-74 22.31 27.55 28.01 22.13 75-79 23.125 27.694999999999997 28.015 21.165 80-84 23.76 27.675 27.415 21.15 85-89 22.755 27.985 27.855 21.404999999999998 90-94 22.595000000000002 27.944999999999997 27.43 22.03 95-99 23.02 27.58 27.98 21.42 100-104 23.11 26.974999999999998 28.439999999999998 21.475 105-109 23.71 27.575 27.63 21.085 110-114 23.48 28.275 27.689999999999998 20.555 115-119 23.655 27.925 27.255000000000003 21.165 120-124 23.36 27.91 27.560000000000002 21.17 125-129 23.745 27.815 27.49 20.95 130-134 23.7 27.694999999999997 27.38 21.224999999999998 135-139 23.625 27.97 27.355 21.05 140-144 24.42 27.389999999999997 27.485 20.705000000000002 145-149 24.865000000000002 27.54 27.384999999999998 20.21 150-151 24.6625 27.1625 27.037499999999998 21.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 2.0 20 2.0 21 0.0 22 0.0 23 2.0 24 4.0 25 4.0 26 4.5 27 5.5 28 11.5 29 15.5 30 13.5 31 22.5 32 34.0 33 43.0 34 49.5 35 68.5 36 88.0 37 110.5 38 132.5 39 161.0 40 198.5 41 217.0 42 223.0 43 239.5 44 262.5 45 272.0 46 267.0 47 246.0 48 219.5 49 206.5 50 179.5 51 133.5 52 113.0 53 104.5 54 88.5 55 61.5 56 47.5 57 40.5 58 24.0 59 16.5 60 19.5 61 14.5 62 8.5 63 6.5 64 5.0 65 3.0 66 1.5 67 2.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.125 #Duplication Level Percentage of deduplicated Percentage of total 1 94.55511288180611 89.0 2 4.940239043824701 9.3 3 0.3452855245683931 0.975 4 0.0796812749003984 0.3 5 0.05312084993359894 0.25 6 0.0 0.0 7 0.02656042496679947 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 7 0.17500000000000002 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit TTTGTTGATGAGTTGTTGGCTATTCTTGCAATGCTTGCTAGCCATCAGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.15000000000000002 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.575 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.8500000000000001 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.125 0.0 0.0 0.0 0.0 116-117 1.3624999999999998 0.0 0.0 0.0 0.0 118-119 1.575 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.8375 0.0 0.0 0.0 0.0 124-125 1.9625 0.0 0.0 0.0 0.0 126-127 2.0875 0.0 0.0 0.0 0.0 128-129 2.25 0.0 0.0 0.0 0.0 130-131 2.4749999999999996 0.0 0.0 0.0 0.0 132-133 2.7 0.0 0.0 0.0 0.0 134-135 2.9625 0.0 0.0 0.0 0.0 136-137 3.2249999999999996 0.0 0.0 0.0 0.0 138-139 3.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAATTGG 10 0.006830828 145.0 3 TTTGATG 10 0.006830828 145.0 2 >>END_MODULE Read 1177486 spots for SRR12671635.sra Written 1177486 spots for SRR12671635.sra Read 1177486 spots for SRR12671635.sra Written 1177486 spots for SRR12671635.sra Read 1177486 spots for SRR12671635.sra Written 1177486 spots for SRR12671635.sra Read 1177486 spots for SRR12671635.sra Written 1177486 spots for SRR12671635.sra Read 1177486 spots for SRR12671635.sra Written 1177486 spots for SRR12671635.sra Read 1177486 spots for SRR12671635.sra Written 1177486 spots for SRR12671635.sra Read 1177486 spots for SRR12671635.sra Written 1177486 spots for SRR12671635.sra Read 1177486 spots for SRR12671635.sra Written 1177486 spots for SRR12671635.sra Read 1177486 spots for SRR12671635.sra Written 1177486 spots for SRR12671635.sra Read 1177486 spots for SRR12671635.sra Written 1177486 spots for SRR12671635.sra Read 1177486 spots for SRR12671635.sra Written 1177486 spots for SRR12671635.sra Read 1177486 spots for SRR12671635.sra Written 1177486 spots for SRR12671635.sra Read 1177501 spots for SRR12671635.sra Written 1177501 spots for SRR12671635.sra Read 1177486 spots for SRR12671635.sra Written 1177486 spots for SRR12671635.sra Read 1177486 spots for SRR12671635.sra Written 1177486 spots for SRR12671635.sra Read 1177486 spots for SRR12671635.sra Written 1177486 spots for SRR12671635.sra Read 1177486 spots for SRR12671635.sra Written 1177486 spots for SRR12671635.sra Read 1177486 spots for SRR12671635.sra Written 1177486 spots for SRR12671635.sra Read 1177486 spots for SRR12671635.sra Written 1177486 spots for SRR12671635.sra Read 1177486 spots for SRR12671635.sra Written 1177486 spots for SRR12671635.sra SRR ids: ['SRR12671635.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ao4j0n5c SRR12671635.sra spots: 23549735 blocks: [[1, 1177486], [1177487, 2354972], [2354973, 3532458], [3532459, 4709944], [4709945, 5887430], [5887431, 7064916], [7064917, 8242402], [8242403, 9419888], [9419889, 10597374], [10597375, 11774860], [11774861, 12952346], [12952347, 14129832], [14129833, 15307318], [15307319, 16484804], [16484805, 17662290], [17662291, 18839776], [18839777, 20017262], [20017263, 21194748], [21194749, 22372234], [22372235, 23549735]] SRR12671635 file size 7981529 SRR12671635 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671635 SRR12671635_1.fastq SRR12671635_2.fastq Input file: SRR12671635_1.fastq Paired file: SRR12671635_2.fastq trimmed: SRR12671635-trimmed-pair1.fastq, SRR12671635-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:10:46 2025 >> started Tue Feb 11 23:11:12 2025 >> done (25.263s) 23549735 read pairs processed; of these: 18 ( 0.00%) short read pairs filtered out after trimming by size control 5206 ( 0.02%) empty read pairs filtered out after trimming by size control 23544511 (99.98%) read pairs available; of these: 1338993 ( 5.69%) trimmed read pairs available after processing 22205518 (94.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 3 0.00% 21 1 0.00% 22 4 0.00% 23 2 0.00% 24 2 0.00% 25 4 0.00% 26 4 0.00% 27 3 0.00% 28 4 0.00% 29 7 0.00% 30 8 0.00% 31 5 0.00% 32 11 0.00% 33 16 0.00% 34 12 0.00% 35 21 0.00% 36 16 0.00% 37 15 0.00% 38 17 0.00% 39 17 0.00% 40 24 0.00% 41 39 0.00% 42 32 0.00% 43 43 0.00% 44 38 0.00% 45 25 0.00% 46 51 0.00% 47 51 0.00% 48 50 0.00% 49 62 0.00% 50 62 0.00% 51 82 0.00% 52 85 0.00% 53 77 0.00% 54 69 0.00% 55 99 0.00% 56 86 0.00% 57 92 0.00% 58 153 0.00% 59 158 0.00% 60 166 0.00% 61 189 0.00% 62 219 0.00% 63 231 0.00% 64 242 0.00% 65 268 0.00% 66 298 0.00% 67 357 0.00% 68 341 0.00% 69 407 0.00% 70 477 0.00% 71 505 0.00% 72 565 0.00% 73 663 0.00% 74 814 0.00% 75 798 0.00% 76 841 0.00% 77 925 0.00% 78 1071 0.00% 79 1230 0.01% 80 1394 0.01% 81 1517 0.01% 82 1663 0.01% 83 1825 0.01% 84 2130 0.01% 85 2290 0.01% 86 2566 0.01% 87 2785 0.01% 88 3116 0.01% 89 3245 0.01% 90 3600 0.02% 91 3877 0.02% 92 4268 0.02% 93 4658 0.02% 94 5141 0.02% 95 5659 0.02% 96 6045 0.03% 97 6321 0.03% 98 6734 0.03% 99 6928 0.03% 100 7560 0.03% 101 8095 0.03% 102 8716 0.04% 103 9257 0.04% 104 9845 0.04% 105 10107 0.04% 106 11023 0.05% 107 11537 0.05% 108 11827 0.05% 109 12722 0.05% 110 13049 0.06% 111 13561 0.06% 112 14316 0.06% 113 14773 0.06% 114 15615 0.07% 115 16443 0.07% 116 17150 0.07% 117 17608 0.07% 118 18499 0.08% 119 18980 0.08% 120 19644 0.08% 121 20409 0.09% 122 21167 0.09% 123 22064 0.09% 124 22968 0.10% 125 23635 0.10% 126 24248 0.10% 127 25332 0.11% 128 26045 0.11% 129 26525 0.11% 130 27165 0.12% 131 28115 0.12% 132 29041 0.12% 133 30143 0.13% 134 31095 0.13% 135 31583 0.13% 136 32848 0.14% 137 33570 0.14% 138 34296 0.15% 139 35385 0.15% 140 35712 0.15% 141 36180 0.15% 142 37897 0.16% 143 38512 0.16% 144 40391 0.17% 145 41011 0.17% 146 42096 0.18% 147 42308 0.18% 148 43309 0.18% 149 43443 0.18% 150 44253 0.19% 151 22205518 94.31% 23544511 reads passed initial QC criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=21 prefix-density=0.57 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=93.04 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=7.2 sequence=TTCATCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=31 prefix-density=0.77 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=44.64 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.3 sequence=CACAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC SRR12671635 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:11:57 Started mapping on | Feb 11 23:11:57 Finished on | Feb 11 23:14:31 Mapping speed, Million of reads per hour | 550.39 Number of input reads | 23544511 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 22223390 Uniquely mapped reads % | 94.39% Average mapped length | 298.21 Number of splices: Total | 22623416 Number of splices: Annotated (sjdb) | 22152368 Number of splices: GT/AG | 22177571 Number of splices: GC/AG | 369190 Number of splices: AT/AC | 13459 Number of splices: Non-canonical | 63196 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 560817 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 178835 % of reads mapped to too many loci | 0.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.31% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 760304 760304 760304 N_multimapping 560817 560817 560817 N_noFeature 826881 21878742 942925 N_ambiguous 360764 1694 131219 UnstrandedReadsAssigned:21035745 PositiveStrandReadsAssigned:342954 NegativeStrandReadsAssigned:21149246 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671635 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671635-trimmed-pair1.fastq SRR12671635-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,544,511 reads, 21,140,762 reads pseudoaligned [quant] estimated average fragment length: 302.879 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,293 rounds 52401 SRR12671635.ke.tsv 34699 SRR12671635.se.tsv 87100 total ==> SRR12671635.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1716.12 727 18.6652 Potri.005G024800.1.v4.1 1035 733.121 321 19.2919 Potri.004G059700.1.v4.1 961 659.8 8 0.534224 Potri.007G009000.2.v4.1 1416 1114.12 0 0 Potri.003G141000.2.v4.1 2943 2641.12 1055.69 17.6115 Potri.016G087400.1.v4.1 270 75.0188 958 562.653 Potri.015G069301.1.v4.1 564 291.693 0 0 Potri.010G195200.1.v4.1 1773 1471.12 53 1.58735 Potri.012G127500.1.v4.1 977 675.496 87 5.67468 ==> SRR12671635.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 629 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 251 Potri.001G212900.v4.1 63 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12671635 completed mapping pipeline successfully