Starting /dee2/code/volunteer_pipeline.sh SRR12671636 current disk space = 3052334866432 free memory = 1431023180 SRR12671636 SRAfilesize f24005f1160db928bee65e618ca26663 SRR12671636.sra SRR12671636.sra file validated SRR12671636 is paired end SRR12671636 is conventional basespace SRR12671636 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671636_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.518 37.0 37.0 37.0 37.0 37.0 2 36.24975 37.0 37.0 37.0 37.0 37.0 3 36.514 37.0 37.0 37.0 37.0 37.0 4 36.591 37.0 37.0 37.0 37.0 37.0 5 36.535 37.0 37.0 37.0 37.0 37.0 6 36.509 37.0 37.0 37.0 37.0 37.0 7 36.516 37.0 37.0 37.0 37.0 37.0 8 36.498 37.0 37.0 37.0 37.0 37.0 9 36.496 37.0 37.0 37.0 37.0 37.0 10-14 36.5238 37.0 37.0 37.0 37.0 37.0 15-19 36.515100000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.4971 37.0 37.0 37.0 37.0 37.0 25-29 36.432900000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.4131 37.0 37.0 37.0 37.0 37.0 35-39 36.4217 37.0 37.0 37.0 37.0 37.0 40-44 36.450900000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.358999999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.3805 37.0 37.0 37.0 37.0 37.0 55-59 36.375699999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.355000000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3233 37.0 37.0 37.0 37.0 37.0 70-74 36.3217 37.0 37.0 37.0 37.0 37.0 75-79 36.287400000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.3154 37.0 37.0 37.0 37.0 37.0 85-89 36.259 37.0 37.0 37.0 37.0 37.0 90-94 36.2042 37.0 37.0 37.0 37.0 37.0 95-99 36.1996 37.0 37.0 37.0 37.0 37.0 100-104 36.2171 37.0 37.0 37.0 37.0 37.0 105-109 36.138099999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.168800000000005 37.0 37.0 37.0 37.0 37.0 115-119 36.16030000000001 37.0 37.0 37.0 37.0 37.0 120-124 36.064099999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.089600000000004 37.0 37.0 37.0 37.0 37.0 130-134 36.0578 37.0 37.0 37.0 37.0 37.0 135-139 35.9781 37.0 37.0 37.0 37.0 37.0 140-144 35.886 37.0 37.0 37.0 37.0 37.0 145-149 35.939499999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.530249999999995 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 3.0 23 1.0 24 0.0 25 3.0 26 2.0 27 11.0 28 11.0 29 23.0 30 22.0 31 39.0 32 47.0 33 60.0 34 107.0 35 299.0 36 2969.0 37 401.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.5 13.15 14.575 40.775 2 20.105289546252195 19.177738781649538 37.25244422160942 23.464527450488845 3 19.35 24.85 27.325 28.475 4 22.45 31.8 22.325 23.425 5 20.825 36.925000000000004 24.0 18.25 6 18.575 36.05 25.275 20.1 7 14.000000000000002 22.55 44.45 19.0 8 19.2 23.825 29.025000000000002 27.950000000000003 9 17.4 23.674999999999997 33.1 25.825 10-14 19.98 29.57 26.515 23.935000000000002 15-19 20.185 28.310000000000002 27.685 23.82 20-24 19.45 29.060000000000002 27.685 23.805 25-29 20.150000000000002 28.03 27.63 24.19 30-34 19.994999999999997 28.044999999999998 27.91 24.05 35-39 20.22 28.884999999999998 26.8 24.095 40-44 20.674999999999997 29.049999999999997 26.900000000000002 23.375 45-49 20.32 28.58 27.200000000000003 23.9 50-54 20.05 28.16 27.639999999999997 24.15 55-59 20.225 28.055000000000003 27.74 23.98 60-64 20.765 27.744999999999997 27.639999999999997 23.849999999999998 65-69 20.47 27.639999999999997 27.61 24.279999999999998 70-74 20.32 28.000000000000004 27.505000000000003 24.175 75-79 20.455000000000002 28.17 27.12 24.255 80-84 20.68 28.065 27.084999999999997 24.169999999999998 85-89 20.22 28.244999999999997 26.61 24.925 90-94 20.875 27.474999999999998 27.310000000000002 24.34 95-99 20.685000000000002 26.815 27.639999999999997 24.86 100-104 21.22 27.155 27.400000000000002 24.224999999999998 105-109 20.880000000000003 27.485 27.87 23.765 110-114 21.25 27.33 27.41 24.01 115-119 21.095 27.215 27.12 24.57 120-124 20.825 27.250000000000004 27.18 24.745 125-129 21.44 27.165 27.295 24.099999999999998 130-134 21.33 26.87 27.400000000000002 24.4 135-139 21.195 27.125 27.07 24.610000000000003 140-144 21.490000000000002 26.615 27.41 24.485 145-149 21.29 27.365000000000002 27.075 24.27 150-151 21.5375 26.6125 27.1125 24.7375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.5 23 4.0 24 6.0 25 3.0 26 5.0 27 5.0 28 6.0 29 13.5 30 17.5 31 23.5 32 28.5 33 33.0 34 53.0 35 94.5 36 111.0 37 118.5 38 139.0 39 157.0 40 173.0 41 186.0 42 188.5 43 190.5 44 225.5 45 240.5 46 243.5 47 252.5 48 251.5 49 229.5 50 192.0 51 169.5 52 136.0 53 112.5 54 98.0 55 72.5 56 56.5 57 43.0 58 30.0 59 25.5 60 18.5 61 9.0 62 6.5 63 5.5 64 4.5 65 4.0 66 3.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.425 #Duplication Level Percentage of deduplicated Percentage of total 1 92.80497700838518 85.775 2 6.329456315931836 11.700000000000001 3 0.7573708412226129 2.1 4 0.08114687584527995 0.3 5 0.027048958615093318 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGCTAAGAGCAGCAATTTGTGAATCAAGTGCTTTAATAGTCTCCTCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.5375000000000001 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.1749999999999998 0.0 0.0 0.0 0.0 126-127 1.325 0.0 0.0 0.0 0.0 128-129 1.5 0.0 0.0 0.0 0.0 130-131 1.625 0.0 0.0 0.0 0.0 132-133 1.7999999999999998 0.0 0.0 0.0 0.0 134-135 1.9125 0.0 0.0 0.0 0.0 136-137 2.075 0.0 0.0 0.0 0.0 138-139 2.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCATA 10 0.006830828 145.0 2 >>END_MODULE SRR12671636 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671636_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.902 37.0 37.0 37.0 37.0 37.0 2 35.871 37.0 37.0 37.0 37.0 37.0 3 35.84 37.0 37.0 37.0 37.0 37.0 4 35.952 37.0 37.0 37.0 37.0 37.0 5 35.999 37.0 37.0 37.0 37.0 37.0 6 35.9395 37.0 37.0 37.0 37.0 37.0 7 35.949 37.0 37.0 37.0 37.0 37.0 8 35.9665 37.0 37.0 37.0 37.0 37.0 9 35.984 37.0 37.0 37.0 37.0 37.0 10-14 36.0498 37.0 37.0 37.0 37.0 37.0 15-19 35.9965 37.0 37.0 37.0 37.0 37.0 20-24 35.9971 37.0 37.0 37.0 37.0 37.0 25-29 35.9348 37.0 37.0 37.0 37.0 37.0 30-34 35.8906 37.0 37.0 37.0 37.0 37.0 35-39 35.901 37.0 37.0 37.0 37.0 37.0 40-44 35.867 37.0 37.0 37.0 37.0 37.0 45-49 35.852 37.0 37.0 37.0 37.0 37.0 50-54 35.806400000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.73180000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.7495 37.0 37.0 37.0 37.0 37.0 65-69 35.709500000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.7018 37.0 37.0 37.0 37.0 37.0 75-79 35.635000000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.6473 37.0 37.0 37.0 37.0 37.0 85-89 35.620799999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.5708 37.0 37.0 37.0 37.0 37.0 95-99 35.6044 37.0 37.0 37.0 37.0 37.0 100-104 35.5495 37.0 37.0 37.0 37.0 37.0 105-109 35.499 37.0 37.0 37.0 37.0 37.0 110-114 35.47160000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.39889999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.393699999999995 37.0 37.0 37.0 34.6 37.0 125-129 35.3447 37.0 37.0 37.0 37.0 37.0 130-134 35.3281 37.0 37.0 37.0 34.6 37.0 135-139 35.376999999999995 37.0 37.0 37.0 34.6 37.0 140-144 35.149 37.0 37.0 37.0 29.8 37.0 145-149 35.2083 37.0 37.0 37.0 32.2 37.0 150-151 34.827 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 4.0 14 2.0 15 3.0 16 4.0 17 1.0 18 3.0 19 0.0 20 3.0 21 4.0 22 4.0 23 9.0 24 11.0 25 9.0 26 10.0 27 12.0 28 16.0 29 22.0 30 27.0 31 50.0 32 77.0 33 123.0 34 231.0 35 685.0 36 2544.0 37 143.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.275 16.725 19.525000000000002 28.475 2 28.425 23.150000000000002 31.075000000000003 17.349999999999998 3 21.625 26.775 31.05 20.549999999999997 4 24.075 35.0 20.95 19.975 5 24.375 36.5 21.4 17.724999999999998 6 21.675 36.725 23.150000000000002 18.45 7 19.475 17.875 40.150000000000006 22.5 8 22.525000000000002 24.0 25.55 27.925 9 22.15 25.025 27.175 25.650000000000002 10-14 23.57 28.21 25.674999999999997 22.545 15-19 23.105 27.639999999999997 27.139999999999997 22.115000000000002 20-24 23.235 28.144999999999996 26.534999999999997 22.085 25-29 23.52 28.03 26.6 21.85 30-34 23.14 28.43 26.745 21.685 35-39 23.72 27.485 27.334999999999997 21.46 40-44 23.525 28.33 26.615 21.529999999999998 45-49 23.34 28.139999999999997 26.575 21.945 50-54 24.01 28.37 26.155 21.465 55-59 23.76 28.055000000000003 26.755000000000003 21.43 60-64 23.985 28.205000000000002 26.58 21.23 65-69 24.654999999999998 27.365000000000002 26.040000000000003 21.94 70-74 24.19 27.825 26.27 21.715 75-79 23.895 27.884999999999998 26.35 21.87 80-84 24.2 28.18 25.985000000000003 21.634999999999998 85-89 24.695 27.775 26.14 21.39 90-94 23.97 28.34 26.424999999999997 21.265 95-99 23.150000000000002 27.515 26.77 22.564999999999998 100-104 24.09 27.48 26.490000000000002 21.94 105-109 23.785 27.92 26.825 21.47 110-114 24.73 28.084999999999997 25.919999999999998 21.265 115-119 24.55 27.500000000000004 26.57 21.38 120-124 24.005000000000003 28.07 26.75 21.175 125-129 23.955000000000002 27.810000000000002 26.755000000000003 21.48 130-134 24.005000000000003 27.634999999999998 27.295 21.065 135-139 24.7 27.67 26.729999999999997 20.9 140-144 24.52 27.58 26.705000000000002 21.195 145-149 24.565 27.83 26.86 20.745 150-151 24.3125 27.800000000000004 26.987499999999997 20.9 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.5 8 1.0 9 1.5 10 3.0 11 1.5 12 0.0 13 0.0 14 2.0 15 2.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 2.0 24 2.0 25 1.5 26 2.5 27 4.0 28 4.5 29 5.0 30 9.0 31 12.0 32 16.5 33 18.5 34 19.0 35 35.0 36 52.5 37 63.5 38 93.5 39 135.5 40 172.0 41 199.5 42 234.5 43 257.0 44 261.0 45 279.0 46 283.0 47 261.0 48 252.5 49 240.0 50 194.5 51 152.0 52 132.0 53 125.0 54 105.5 55 80.5 56 69.5 57 57.5 58 39.5 59 28.0 60 20.5 61 15.5 62 11.5 63 8.0 64 6.0 65 3.0 66 1.0 67 0.0 68 1.0 69 1.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 1.0 87 1.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.5 96 0.5 97 0.0 98 0.5 99 0.5 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.30000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.06608884073673 85.9 2 5.90465872156013 10.9 3 0.7583965330444203 2.1 4 0.16251354279523295 0.6 5 0.10834236186348861 0.5 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCTTTGACTTCAACTTAACACTTCCAATAATCATGGTTGAGTTCTTGGT 5 0.125 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 5 0.125 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.36250000000000004 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.5874999999999999 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.8625 0.0 0.0 0.0 0.0 122-123 1.0625 0.0 0.0 0.0 0.0 124-125 1.2000000000000002 0.0 0.0 0.0 0.0 126-127 1.35 0.0 0.0 0.0 0.0 128-129 1.525 0.0 0.0 0.0 0.0 130-131 1.65 0.0 0.0 0.0 0.0 132-133 1.7999999999999998 0.0 0.0 0.0 0.0 134-135 1.9125 0.0 0.0 0.0 0.0 136-137 2.075 0.0 0.0 0.0 0.0 138-139 2.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGATC 10 0.006830828 145.0 8 >>END_MODULE Read 971452 spots for SRR12671636.sra Written 971452 spots for SRR12671636.sra Read 971452 spots for SRR12671636.sra Written 971452 spots for SRR12671636.sra Read 971452 spots for SRR12671636.sra Written 971452 spots for SRR12671636.sra Read 971452 spots for SRR12671636.sra Written 971452 spots for SRR12671636.sra Read 971452 spots for SRR12671636.sra Written 971452 spots for SRR12671636.sra Read 971452 spots for SRR12671636.sra Written 971452 spots for SRR12671636.sra Read 971452 spots for SRR12671636.sra Written 971452 spots for SRR12671636.sra Read 971452 spots for SRR12671636.sra Written 971452 spots for SRR12671636.sra Read 971452 spots for SRR12671636.sra Written 971452 spots for SRR12671636.sra Read 971452 spots for SRR12671636.sra Written 971452 spots for SRR12671636.sra Read 971470 spots for SRR12671636.sra Written 971470 spots for SRR12671636.sra Read 971452 spots for SRR12671636.sra Written 971452 spots for SRR12671636.sra Read 971452 spots for SRR12671636.sra Written 971452 spots for SRR12671636.sra Read 971452 spots for SRR12671636.sra Written 971452 spots for SRR12671636.sra Read 971452 spots for SRR12671636.sra Written 971452 spots for SRR12671636.sra Read 971452 spots for SRR12671636.sra Written 971452 spots for SRR12671636.sra Read 971452 spots for SRR12671636.sra Written 971452 spots for SRR12671636.sra Read 971452 spots for SRR12671636.sra Written 971452 spots for SRR12671636.sra Read 971452 spots for SRR12671636.sra Written 971452 spots for SRR12671636.sra Read 971452 spots for SRR12671636.sra Written 971452 spots for SRR12671636.sra SRR ids: ['SRR12671636.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oel3dwjb SRR12671636.sra spots: 19429058 blocks: [[1, 971452], [971453, 1942904], [1942905, 2914356], [2914357, 3885808], [3885809, 4857260], [4857261, 5828712], [5828713, 6800164], [6800165, 7771616], [7771617, 8743068], [8743069, 9714520], [9714521, 10685972], [10685973, 11657424], [11657425, 12628876], [12628877, 13600328], [13600329, 14571780], [14571781, 15543232], [15543233, 16514684], [16514685, 17486136], [17486137, 18457588], [18457589, 19429058]] SRR12671636 file size 6581143 SRR12671636 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671636 SRR12671636_1.fastq SRR12671636_2.fastq Input file: SRR12671636_1.fastq Paired file: SRR12671636_2.fastq trimmed: SRR12671636-trimmed-pair1.fastq, SRR12671636-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:07:33 2025 >> started Tue Feb 11 23:07:56 2025 >> done (22.158s) 19429058 read pairs processed; of these: 7 ( 0.00%) short read pairs filtered out after trimming by size control 5734 ( 0.03%) empty read pairs filtered out after trimming by size control 19423317 (99.97%) read pairs available; of these: 695483 ( 3.58%) trimmed read pairs available after processing 18727834 (96.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 1 0.00% 23 5 0.00% 24 2 0.00% 25 3 0.00% 26 5 0.00% 27 4 0.00% 28 3 0.00% 29 3 0.00% 30 16 0.00% 31 9 0.00% 32 7 0.00% 33 9 0.00% 34 11 0.00% 35 11 0.00% 36 15 0.00% 37 15 0.00% 38 18 0.00% 39 25 0.00% 40 27 0.00% 41 17 0.00% 42 23 0.00% 43 17 0.00% 44 18 0.00% 45 17 0.00% 46 24 0.00% 47 28 0.00% 48 32 0.00% 49 36 0.00% 50 38 0.00% 51 29 0.00% 52 47 0.00% 53 58 0.00% 54 42 0.00% 55 68 0.00% 56 84 0.00% 57 69 0.00% 58 80 0.00% 59 88 0.00% 60 96 0.00% 61 106 0.00% 62 104 0.00% 63 127 0.00% 64 141 0.00% 65 154 0.00% 66 144 0.00% 67 182 0.00% 68 202 0.00% 69 252 0.00% 70 302 0.00% 71 282 0.00% 72 347 0.00% 73 409 0.00% 74 470 0.00% 75 483 0.00% 76 509 0.00% 77 562 0.00% 78 545 0.00% 79 676 0.00% 80 745 0.00% 81 899 0.00% 82 908 0.00% 83 999 0.01% 84 1167 0.01% 85 1242 0.01% 86 1328 0.01% 87 1427 0.01% 88 1571 0.01% 89 1704 0.01% 90 1838 0.01% 91 2042 0.01% 92 2152 0.01% 93 2381 0.01% 94 2652 0.01% 95 2791 0.01% 96 2862 0.01% 97 3063 0.02% 98 3183 0.02% 99 3370 0.02% 100 3478 0.02% 101 3746 0.02% 102 4043 0.02% 103 4266 0.02% 104 4673 0.02% 105 4937 0.03% 106 5174 0.03% 107 5178 0.03% 108 5308 0.03% 109 5589 0.03% 110 5937 0.03% 111 6162 0.03% 112 6701 0.03% 113 6790 0.03% 114 7310 0.04% 115 7932 0.04% 116 8071 0.04% 117 8298 0.04% 118 8620 0.04% 119 8725 0.04% 120 9210 0.05% 121 9618 0.05% 122 10158 0.05% 123 10446 0.05% 124 11234 0.06% 125 11637 0.06% 126 12044 0.06% 127 12309 0.06% 128 12918 0.07% 129 13127 0.07% 130 13531 0.07% 131 13944 0.07% 132 14532 0.07% 133 15481 0.08% 134 15865 0.08% 135 16744 0.09% 136 17562 0.09% 137 17871 0.09% 138 18293 0.09% 139 18596 0.10% 140 19111 0.10% 141 19648 0.10% 142 20560 0.11% 143 21331 0.11% 144 23108 0.12% 145 23497 0.12% 146 24762 0.13% 147 24884 0.13% 148 25313 0.13% 149 25861 0.13% 150 25919 0.13% 151 18727834 96.42% 19423317 reads passed initial QC criterion=sequence-density sequence-density=1.21 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=30 prefix-density=1.19 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=212.26 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=9.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=1.02 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=21 prefix-density=1.05 prefix-fanout=2.3 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=41.30 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=1.7 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGGCCTCTCTGCTGACCCAGAGACCTTTGCCAAGAACCGTGAGCTTGAAGTCATCCATTCCAGGTGGGCCATGCTTGGAGCTCTTGGATGCGTCTTCCCCGAGCTCTTGTCCCGCAACGGTGTCAAGTTCGGCGAGGCTGTATGGTTCAAGGCTGGAGCCCAGA SRR12671636 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:08:47 Started mapping on | Feb 11 23:08:48 Finished on | Feb 11 23:11:14 Mapping speed, Million of reads per hour | 478.93 Number of input reads | 19423317 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 17646791 Uniquely mapped reads % | 90.85% Average mapped length | 299.24 Number of splices: Total | 18169750 Number of splices: Annotated (sjdb) | 17852636 Number of splices: GT/AG | 17784373 Number of splices: GC/AG | 325609 Number of splices: AT/AC | 11374 Number of splices: Non-canonical | 48394 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 443753 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 91798 % of reads mapped to too many loci | 0.47% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.22% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1332773 1332773 1332773 N_multimapping 443753 443753 443753 N_noFeature 371570 17213177 451104 N_ambiguous 466772 1512 111955 UnstrandedReadsAssigned:16808449 PositiveStrandReadsAssigned:432102 NegativeStrandReadsAssigned:17083732 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671636 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671636-trimmed-pair1.fastq SRR12671636-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,423,317 reads, 17,108,263 reads pseudoaligned [quant] estimated average fragment length: 291.675 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52401 SRR12671636.ke.tsv 34699 SRR12671636.se.tsv 87100 total ==> SRR12671636.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1727.32 695 15.8697 Potri.005G024800.1.v4.1 1035 744.325 235 12.4527 Potri.004G059700.1.v4.1 961 670.454 3 0.176485 Potri.007G009000.2.v4.1 1416 1125.32 0 0 Potri.003G141000.2.v4.1 2943 2652.32 797 11.8519 Potri.016G087400.1.v4.1 270 66.3463 839.133 498.851 Potri.015G069301.1.v4.1 564 287.172 0 0 Potri.010G195200.1.v4.1 1773 1482.32 116 3.08653 Potri.012G127500.1.v4.1 977 686.417 95 5.45874 ==> SRR12671636.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 208 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 580 Potri.001G212900.v4.1 84 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR12671636 completed mapping pipeline successfully