Starting /dee2/code/volunteer_pipeline.sh SRR12671637 current disk space = 3052300115968 free memory = 1477428696 SRR12671637 SRAfilesize 29482d7fec71fb51466f23d4adcb3385 SRR12671637.sra SRR12671637.sra file validated SRR12671637 is paired end SRR12671637 is conventional basespace SRR12671637 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671637_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4425 37.0 37.0 37.0 37.0 37.0 2 36.417 37.0 37.0 37.0 37.0 37.0 3 36.5255 37.0 37.0 37.0 37.0 37.0 4 36.5725 37.0 37.0 37.0 37.0 37.0 5 36.604 37.0 37.0 37.0 37.0 37.0 6 36.5285 37.0 37.0 37.0 37.0 37.0 7 36.4615 37.0 37.0 37.0 37.0 37.0 8 36.5175 37.0 37.0 37.0 37.0 37.0 9 36.5575 37.0 37.0 37.0 37.0 37.0 10-14 36.602199999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.577299999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.53679999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.5186 37.0 37.0 37.0 37.0 37.0 30-34 36.4972 37.0 37.0 37.0 37.0 37.0 35-39 36.50169999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.4913 37.0 37.0 37.0 37.0 37.0 45-49 36.460300000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.448699999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.4112 37.0 37.0 37.0 37.0 37.0 60-64 36.4157 37.0 37.0 37.0 37.0 37.0 65-69 36.3852 37.0 37.0 37.0 37.0 37.0 70-74 36.422000000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.2995 37.0 37.0 37.0 37.0 37.0 80-84 36.366200000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.3206 37.0 37.0 37.0 37.0 37.0 90-94 36.2716 37.0 37.0 37.0 37.0 37.0 95-99 36.151300000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.2024 37.0 37.0 37.0 37.0 37.0 105-109 36.19799999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.187999999999995 37.0 37.0 37.0 37.0 37.0 115-119 36.1482 37.0 37.0 37.0 37.0 37.0 120-124 36.0831 37.0 37.0 37.0 37.0 37.0 125-129 36.062799999999996 37.0 37.0 37.0 37.0 37.0 130-134 36.0509 37.0 37.0 37.0 37.0 37.0 135-139 35.9876 37.0 37.0 37.0 37.0 37.0 140-144 35.9567 37.0 37.0 37.0 37.0 37.0 145-149 35.923700000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.44725 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 0.0 26 5.0 27 4.0 28 16.0 29 15.0 30 28.0 31 32.0 32 45.0 33 59.0 34 111.0 35 301.0 36 2978.0 37 405.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.849999999999998 12.875 13.975000000000001 43.3 2 19.473684210526315 20.827067669172934 38.94736842105263 20.75187969924812 3 19.8 24.85 25.35 30.0 4 23.400000000000002 32.375 20.974999999999998 23.25 5 20.25 37.25 23.625 18.875 6 17.875 37.35 26.0 18.775 7 13.225000000000001 21.525 45.0 20.25 8 17.625 24.45 29.799999999999997 28.125 9 17.150000000000002 23.325000000000003 32.725 26.8 10-14 19.794999999999998 29.635 27.165 23.405 15-19 19.855 28.335 28.439999999999998 23.369999999999997 20-24 19.965 28.555000000000003 27.884999999999998 23.595 25-29 20.13 28.17 28.125 23.575 30-34 19.564999999999998 28.99 28.084999999999997 23.36 35-39 20.3 28.735 26.834999999999997 24.13 40-44 20.175 28.449999999999996 27.83 23.544999999999998 45-49 20.315 28.935 26.974999999999998 23.775 50-54 20.560000000000002 28.32 27.655 23.465 55-59 19.6 28.110000000000003 27.515 24.775 60-64 20.265 28.499999999999996 27.29 23.945 65-69 20.28 28.515 27.544999999999998 23.66 70-74 19.97 28.754999999999995 27.235 24.04 75-79 20.65 27.77 27.92 23.66 80-84 20.115 28.625 26.729999999999997 24.529999999999998 85-89 20.585 27.639999999999997 27.384999999999998 24.39 90-94 21.085 27.21 27.615000000000002 24.09 95-99 20.695 27.694999999999997 27.439999999999998 24.169999999999998 100-104 19.955000000000002 28.305000000000003 27.694999999999997 24.044999999999998 105-109 20.23 26.825 27.900000000000002 25.045 110-114 20.76 27.725 27.61 23.905 115-119 20.79 27.805000000000003 27.32 24.085 120-124 20.79 27.715 26.845000000000002 24.65 125-129 20.51 27.49 27.3 24.7 130-134 21.26 27.92 26.634999999999998 24.185000000000002 135-139 21.5 27.805000000000003 26.729999999999997 23.965 140-144 21.33 26.974999999999998 27.08 24.615000000000002 145-149 22.11 27.439999999999998 26.224999999999998 24.224999999999998 150-151 21.9 26.75 26.8375 24.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.5 25 6.5 26 7.0 27 5.5 28 10.0 29 13.5 30 17.0 31 25.5 32 37.0 33 46.5 34 59.0 35 79.0 36 100.0 37 118.5 38 138.0 39 163.0 40 164.0 41 189.5 42 235.0 43 256.0 44 258.5 45 249.5 46 241.5 47 239.5 48 233.0 49 206.0 50 188.5 51 156.5 52 125.0 53 103.5 54 84.5 55 72.0 56 53.0 57 34.0 58 25.0 59 19.5 60 11.5 61 7.0 62 5.5 63 4.0 64 2.0 65 1.0 66 0.5 67 1.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.25 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.8 #Duplication Level Percentage of deduplicated Percentage of total 1 93.97654584221749 88.14999999999999 2 5.4904051172707895 10.299999999999999 3 0.4797441364605544 1.35 4 0.053304904051172705 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.0750000000000002 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.6 0.0 0.0 0.0 0.0 116-117 1.8 0.0 0.0 0.0 0.0 118-119 2.075 0.0 0.0 0.0 0.0 120-121 2.2 0.0 0.0 0.0 0.0 122-123 2.3625 0.0 0.0 0.0 0.0 124-125 2.625 0.0 0.0 0.0 0.0 126-127 2.8625 0.0 0.0 0.0 0.0 128-129 3.0875 0.0 0.0 0.0 0.0 130-131 3.35 0.0 0.0 0.0 0.0 132-133 3.7249999999999996 0.0 0.0 0.0 0.0 134-135 3.9749999999999996 0.0 0.0 0.0 0.0 136-137 4.4125 0.0 0.0 0.0 0.0 138-139 4.762499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGTCAC 10 0.006830828 145.0 9 >>END_MODULE SRR12671637 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671637_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3345 37.0 37.0 37.0 37.0 37.0 2 36.167 37.0 37.0 37.0 37.0 37.0 3 36.255 37.0 37.0 37.0 37.0 37.0 4 36.2685 37.0 37.0 37.0 37.0 37.0 5 36.3525 37.0 37.0 37.0 37.0 37.0 6 36.3255 37.0 37.0 37.0 37.0 37.0 7 36.3345 37.0 37.0 37.0 37.0 37.0 8 36.2785 37.0 37.0 37.0 37.0 37.0 9 36.3775 37.0 37.0 37.0 37.0 37.0 10-14 36.3414 37.0 37.0 37.0 37.0 37.0 15-19 36.2995 37.0 37.0 37.0 37.0 37.0 20-24 36.2504 37.0 37.0 37.0 37.0 37.0 25-29 36.242200000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.20020000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.1716 37.0 37.0 37.0 37.0 37.0 40-44 36.2054 37.0 37.0 37.0 37.0 37.0 45-49 36.188 37.0 37.0 37.0 37.0 37.0 50-54 36.157199999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.1425 37.0 37.0 37.0 37.0 37.0 60-64 36.070100000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.063599999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.0299 37.0 37.0 37.0 37.0 37.0 75-79 35.96470000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.0545 37.0 37.0 37.0 37.0 37.0 85-89 35.944399999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.862 37.0 37.0 37.0 37.0 37.0 95-99 35.9577 37.0 37.0 37.0 37.0 37.0 100-104 35.8707 37.0 37.0 37.0 37.0 37.0 105-109 35.8271 37.0 37.0 37.0 37.0 37.0 110-114 35.8324 37.0 37.0 37.0 37.0 37.0 115-119 35.772000000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.8414 37.0 37.0 37.0 37.0 37.0 125-129 35.676199999999994 37.0 37.0 37.0 37.0 37.0 130-134 35.7162 37.0 37.0 37.0 37.0 37.0 135-139 35.677499999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.4251 37.0 37.0 37.0 37.0 37.0 145-149 35.4101 37.0 37.0 37.0 37.0 37.0 150-151 34.98325 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 2.0 16 3.0 17 0.0 18 0.0 19 1.0 20 1.0 21 2.0 22 1.0 23 5.0 24 5.0 25 7.0 26 6.0 27 9.0 28 17.0 29 17.0 30 22.0 31 22.0 32 60.0 33 94.0 34 182.0 35 544.0 36 2764.0 37 233.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.15 16.6 17.9 30.349999999999998 2 27.175 22.25 34.025 16.55 3 20.4 26.924999999999997 31.825 20.849999999999998 4 23.625 34.375 21.6 20.4 5 25.525 35.75 21.025 17.7 6 19.3 37.8 22.25 20.65 7 18.475 16.675 43.125 21.725 8 22.475 23.05 26.424999999999997 28.050000000000004 9 21.825 24.25 28.725 25.2 10-14 23.549999999999997 28.715000000000003 25.845000000000002 21.89 15-19 23.665 28.465 26.47 21.4 20-24 23.330000000000002 28.105000000000004 27.015 21.55 25-29 23.78 27.700000000000003 27.145000000000003 21.375 30-34 23.43 27.97 27.12 21.48 35-39 23.380000000000003 28.075 27.169999999999998 21.375 40-44 23.669999999999998 28.025 27.02 21.285 45-49 23.945 28.144999999999996 26.8 21.11 50-54 24.39 27.435 26.775 21.4 55-59 23.995 27.084999999999997 27.224999999999998 21.695 60-64 23.47 27.505000000000003 27.084999999999997 21.94 65-69 23.830000000000002 28.050000000000004 26.545 21.575 70-74 23.9 27.55 26.96 21.59 75-79 23.9 27.775 26.38 21.945 80-84 24.08 27.6 26.174999999999997 22.145 85-89 24.169999999999998 27.715 26.525 21.59 90-94 23.89 27.889999999999997 26.834999999999997 21.385 95-99 23.735 27.955000000000002 27.095000000000002 21.215 100-104 23.815 27.66 26.534999999999997 21.990000000000002 105-109 23.605 27.27 27.57 21.555 110-114 24.215 27.744999999999997 26.740000000000002 21.3 115-119 24.154999999999998 27.994999999999997 26.605 21.245 120-124 24.884999999999998 27.200000000000003 26.85 21.065 125-129 24.404999999999998 27.91 26.575 21.11 130-134 24.585 27.839999999999996 26.795 20.78 135-139 24.815 27.189999999999998 27.27 20.724999999999998 140-144 25.685000000000002 27.125 26.55 20.64 145-149 24.805 27.279999999999998 27.115000000000002 20.8 150-151 25.2625 27.462500000000002 26.887499999999996 20.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.5 15 1.5 16 1.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.5 22 1.0 23 0.5 24 1.0 25 0.5 26 0.5 27 2.0 28 3.0 29 5.5 30 8.5 31 9.5 32 14.0 33 26.5 34 35.0 35 44.0 36 66.5 37 82.5 38 98.0 39 126.0 40 162.0 41 193.5 42 223.0 43 245.5 44 259.0 45 290.0 46 294.0 47 273.0 48 264.5 49 235.0 50 187.0 51 160.5 52 144.0 53 110.5 54 95.0 55 81.5 56 60.0 57 51.5 58 40.5 59 29.0 60 23.0 61 17.0 62 8.0 63 4.5 64 3.0 65 1.5 66 1.0 67 0.5 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 1.5 74 1.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.075 #Duplication Level Percentage of deduplicated Percentage of total 1 94.20674993356364 88.625 2 5.3149083178315175 10.0 3 0.45176720701567896 1.275 4 0.026574541589157584 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.0750000000000002 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.6125 0.0 0.0 0.0 0.0 116-117 1.825 0.0 0.0 0.0 0.0 118-119 2.0999999999999996 0.0 0.0 0.0 0.0 120-121 2.225 0.0 0.0 0.0 0.0 122-123 2.3875 0.0 0.0 0.0 0.0 124-125 2.6624999999999996 0.0 0.0 0.0 0.0 126-127 2.9125 0.0 0.0 0.0 0.0 128-129 3.1375 0.0 0.0 0.0 0.0 130-131 3.4 0.0 0.0 0.0 0.0 132-133 3.7750000000000004 0.0 0.0 0.0 0.0 134-135 4.025 0.0 0.0 0.0 0.0 136-137 4.4625 0.0 0.0 0.0 0.0 138-139 4.824999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 25 4.977651E-4 29.0 130-134 >>END_MODULE Read 771358 spots for SRR12671637.sra Written 771358 spots for SRR12671637.sra Read 771358 spots for SRR12671637.sra Written 771358 spots for SRR12671637.sra Read 771358 spots for SRR12671637.sra Written 771358 spots for SRR12671637.sra Read 771358 spots for SRR12671637.sra Written 771358 spots for SRR12671637.sra Read 771358 spots for SRR12671637.sra Written 771358 spots for SRR12671637.sra Read 771358 spots for SRR12671637.sra Written 771358 spots for SRR12671637.sra Read 771358 spots for SRR12671637.sra Written 771358 spots for SRR12671637.sra Read 771358 spots for SRR12671637.sra Written 771358 spots for SRR12671637.sra Read 771358 spots for SRR12671637.sra Written 771358 spots for SRR12671637.sra Read 771358 spots for SRR12671637.sra Written 771358 spots for SRR12671637.sra Read 771358 spots for SRR12671637.sra Written 771358 spots for SRR12671637.sra Read 771358 spots for SRR12671637.sra Written 771358 spots for SRR12671637.sra Read 771358 spots for SRR12671637.sra Written 771358 spots for SRR12671637.sra Read 771358 spots for SRR12671637.sra Written 771358 spots for SRR12671637.sra Read 771358 spots for SRR12671637.sra Written 771358 spots for SRR12671637.sra Read 771358 spots for SRR12671637.sra Written 771358 spots for SRR12671637.sra Read 771358 spots for SRR12671637.sra Written 771358 spots for SRR12671637.sra Read 771358 spots for SRR12671637.sra Written 771358 spots for SRR12671637.sra Read 771368 spots for SRR12671637.sra Written 771368 spots for SRR12671637.sra Read 771358 spots for SRR12671637.sra Written 771358 spots for SRR12671637.sra SRR ids: ['SRR12671637.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l1jz1226 SRR12671637.sra spots: 15427170 blocks: [[1, 771358], [771359, 1542716], [1542717, 2314074], [2314075, 3085432], [3085433, 3856790], [3856791, 4628148], [4628149, 5399506], [5399507, 6170864], [6170865, 6942222], [6942223, 7713580], [7713581, 8484938], [8484939, 9256296], [9256297, 10027654], [10027655, 10799012], [10799013, 11570370], [11570371, 12341728], [12341729, 13113086], [13113087, 13884444], [13884445, 14655802], [14655803, 15427170]] SRR12671637 file size 5221126 SRR12671637 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671637 SRR12671637_1.fastq SRR12671637_2.fastq Input file: SRR12671637_1.fastq Paired file: SRR12671637_2.fastq trimmed: SRR12671637-trimmed-pair1.fastq, SRR12671637-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:30:52 2025 >> started Tue Feb 11 23:31:10 2025 >> done (17.908s) 15427170 read pairs processed; of these: 9 ( 0.00%) short read pairs filtered out after trimming by size control 3131 ( 0.02%) empty read pairs filtered out after trimming by size control 15424030 (99.98%) read pairs available; of these: 1125212 ( 7.30%) trimmed read pairs available after processing 14298818 (92.70%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 4 0.00% 27 2 0.00% 28 2 0.00% 29 2 0.00% 30 4 0.00% 31 5 0.00% 32 7 0.00% 33 13 0.00% 34 3 0.00% 35 4 0.00% 36 17 0.00% 37 3 0.00% 38 10 0.00% 39 12 0.00% 40 18 0.00% 41 9 0.00% 42 15 0.00% 43 26 0.00% 44 22 0.00% 45 14 0.00% 46 25 0.00% 47 20 0.00% 48 41 0.00% 49 34 0.00% 50 31 0.00% 51 53 0.00% 52 56 0.00% 53 46 0.00% 54 54 0.00% 55 64 0.00% 56 78 0.00% 57 83 0.00% 58 91 0.00% 59 130 0.00% 60 115 0.00% 61 132 0.00% 62 142 0.00% 63 144 0.00% 64 193 0.00% 65 197 0.00% 66 212 0.00% 67 217 0.00% 68 296 0.00% 69 300 0.00% 70 379 0.00% 71 437 0.00% 72 478 0.00% 73 565 0.00% 74 560 0.00% 75 686 0.00% 76 860 0.01% 77 865 0.01% 78 974 0.01% 79 1041 0.01% 80 1188 0.01% 81 1304 0.01% 82 1511 0.01% 83 1654 0.01% 84 1819 0.01% 85 2099 0.01% 86 2334 0.02% 87 2532 0.02% 88 2622 0.02% 89 2936 0.02% 90 3035 0.02% 91 3485 0.02% 92 3780 0.02% 93 4200 0.03% 94 4571 0.03% 95 4886 0.03% 96 5346 0.03% 97 5623 0.04% 98 5882 0.04% 99 6256 0.04% 100 6662 0.04% 101 7125 0.05% 102 7592 0.05% 103 7808 0.05% 104 8621 0.06% 105 8905 0.06% 106 9416 0.06% 107 9722 0.06% 108 10278 0.07% 109 10577 0.07% 110 11244 0.07% 111 11783 0.08% 112 12155 0.08% 113 12950 0.08% 114 13298 0.09% 115 13991 0.09% 116 14583 0.09% 117 15220 0.10% 118 15420 0.10% 119 16311 0.11% 120 17019 0.11% 121 17242 0.11% 122 18162 0.12% 123 18911 0.12% 124 19521 0.13% 125 20290 0.13% 126 20484 0.13% 127 21394 0.14% 128 21595 0.14% 129 22300 0.14% 130 23078 0.15% 131 23595 0.15% 132 24229 0.16% 133 25187 0.16% 134 25993 0.17% 135 26713 0.17% 136 27454 0.18% 137 27526 0.18% 138 28500 0.18% 139 29364 0.19% 140 29732 0.19% 141 29933 0.19% 142 30877 0.20% 143 31732 0.21% 144 33080 0.21% 145 33809 0.22% 146 34738 0.23% 147 35125 0.23% 148 35527 0.23% 149 35550 0.23% 150 36032 0.23% 151 14298818 92.70% 15424030 reads passed initial QC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=20 prefix-density=0.80 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=75.94 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=7.3 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=19 prefix-density=0.65 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=21 fanout-score=24.87 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.6 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAA SRR12671637 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:31:53 Started mapping on | Feb 11 23:31:53 Finished on | Feb 11 23:33:25 Mapping speed, Million of reads per hour | 603.55 Number of input reads | 15424030 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 14409034 Uniquely mapped reads % | 93.42% Average mapped length | 297.63 Number of splices: Total | 14074820 Number of splices: Annotated (sjdb) | 13834606 Number of splices: GT/AG | 13791108 Number of splices: GC/AG | 242691 Number of splices: AT/AC | 9527 Number of splices: Non-canonical | 31494 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.90 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 446939 % of reads mapped to multiple loci | 2.90% Number of reads mapped to too many loci | 133851 % of reads mapped to too many loci | 0.87% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.66% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 568057 568057 568057 N_multimapping 446939 446939 446939 N_noFeature 307886 14186632 367522 N_ambiguous 255496 999 92247 UnstrandedReadsAssigned:13845652 PositiveStrandReadsAssigned:221403 NegativeStrandReadsAssigned:13949265 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671637 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671637-trimmed-pair1.fastq SRR12671637-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,424,030 reads, 14,132,261 reads pseudoaligned [quant] estimated average fragment length: 279.374 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52401 SRR12671637.ke.tsv 34699 SRR12671637.se.tsv 87100 total ==> SRR12671637.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.63 435 15.4366 Potri.005G024800.1.v4.1 1035 756.626 355 28.9644 Potri.004G059700.1.v4.1 961 682.786 28 2.53158 Potri.007G009000.2.v4.1 1416 1137.63 0 0 Potri.003G141000.2.v4.1 2943 2664.63 531 12.302 Potri.016G087400.1.v4.1 270 77.8377 814.295 645.817 Potri.015G069301.1.v4.1 564 303.416 0 0 Potri.010G195200.1.v4.1 1773 1494.63 75 3.09775 Potri.012G127500.1.v4.1 977 698.692 640 56.5473 ==> SRR12671637.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 222 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 449 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 10 SRR12671637 completed mapping pipeline successfully