Starting /dee2/code/volunteer_pipeline.sh SRR12671638 current disk space = 3052203339776 free memory = 1460745344 SRR12671638 SRAfilesize 51a8fe137dc459f11768f657001e33aa SRR12671638.sra SRR12671638.sra file validated SRR12671638 is paired end SRR12671638 is conventional basespace SRR12671638 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671638_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3945 37.0 37.0 37.0 37.0 37.0 2 36.206 37.0 37.0 37.0 37.0 37.0 3 36.5305 37.0 37.0 37.0 37.0 37.0 4 36.4925 37.0 37.0 37.0 37.0 37.0 5 36.5515 37.0 37.0 37.0 37.0 37.0 6 36.4585 37.0 37.0 37.0 37.0 37.0 7 36.405 37.0 37.0 37.0 37.0 37.0 8 36.5615 37.0 37.0 37.0 37.0 37.0 9 36.5525 37.0 37.0 37.0 37.0 37.0 10-14 36.5278 37.0 37.0 37.0 37.0 37.0 15-19 36.50189999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.4722 37.0 37.0 37.0 37.0 37.0 25-29 36.4522 37.0 37.0 37.0 37.0 37.0 30-34 36.4612 37.0 37.0 37.0 37.0 37.0 35-39 36.38119999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.3853 37.0 37.0 37.0 37.0 37.0 45-49 36.295 37.0 37.0 37.0 37.0 37.0 50-54 36.3451 37.0 37.0 37.0 37.0 37.0 55-59 36.28829999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.3206 37.0 37.0 37.0 37.0 37.0 65-69 36.253499999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.2101 37.0 37.0 37.0 37.0 37.0 75-79 36.28920000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.2756 37.0 37.0 37.0 37.0 37.0 85-89 36.224900000000005 37.0 37.0 37.0 37.0 37.0 90-94 36.213 37.0 37.0 37.0 37.0 37.0 95-99 36.12089999999999 37.0 37.0 37.0 37.0 37.0 100-104 36.1866 37.0 37.0 37.0 37.0 37.0 105-109 36.14489999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.118700000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.0855 37.0 37.0 37.0 37.0 37.0 120-124 36.035700000000006 37.0 37.0 37.0 37.0 37.0 125-129 36.013999999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.9893 37.0 37.0 37.0 37.0 37.0 135-139 35.929899999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.8473 37.0 37.0 37.0 37.0 37.0 145-149 35.7632 37.0 37.0 37.0 37.0 37.0 150-151 35.32825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 0.0 23 0.0 24 0.0 25 0.0 26 8.0 27 7.0 28 15.0 29 20.0 30 26.0 31 41.0 32 52.0 33 81.0 34 111.0 35 323.0 36 2968.0 37 347.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.675 11.799999999999999 14.95 43.575 2 18.784530386740332 19.939728779507785 37.94575590155701 23.32998493219488 3 18.075 25.424999999999997 27.3 29.2 4 21.6 32.125 22.025 24.25 5 23.150000000000002 34.8 23.825 18.224999999999998 6 17.875 37.05 24.349999999999998 20.724999999999998 7 13.8 22.775000000000002 44.275 19.15 8 19.400000000000002 21.9 30.8 27.900000000000002 9 17.925 22.8 32.6 26.674999999999997 10-14 20.51 28.610000000000003 26.795 24.085 15-19 20.3 27.694999999999997 27.79 24.215 20-24 19.950000000000003 28.555000000000003 27.67 23.825 25-29 19.675 28.555000000000003 27.334999999999997 24.435000000000002 30-34 20.200000000000003 28.249999999999996 27.305 24.245 35-39 19.915 28.15 27.555000000000003 24.38 40-44 20.14 28.925 27.615000000000002 23.32 45-49 20.78 28.144999999999996 27.284999999999997 23.79 50-54 20.595 28.025 27.405 23.974999999999998 55-59 20.48 27.935 27.095000000000002 24.490000000000002 60-64 20.215 27.72 27.87 24.195 65-69 21.26 27.6 27.534999999999997 23.605 70-74 20.380000000000003 27.500000000000004 27.875 24.245 75-79 20.945 28.1 27.405 23.549999999999997 80-84 20.865000000000002 28.15 27.36 23.625 85-89 20.560000000000002 28.389999999999997 26.8 24.25 90-94 21.48 27.534999999999997 26.790000000000003 24.195 95-99 20.65 27.794999999999998 27.37 24.185000000000002 100-104 21.01 27.779999999999998 27.16 24.05 105-109 21.310000000000002 28.005000000000003 26.525 24.16 110-114 21.490000000000002 27.235 27.165 24.11 115-119 21.32 27.77 26.965 23.945 120-124 21.545 27.500000000000004 26.745 24.21 125-129 20.515 28.060000000000002 27.145000000000003 24.279999999999998 130-134 21.224999999999998 26.875 27.74 24.16 135-139 21.455 27.065 27.175 24.305 140-144 21.63 26.825 27.500000000000004 24.044999999999998 145-149 21.93 27.505000000000003 26.695 23.87 150-151 21.2875 26.8125 27.3375 24.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.0 21 1.0 22 1.0 23 1.0 24 1.5 25 4.0 26 6.5 27 6.5 28 10.0 29 12.5 30 14.0 31 26.0 32 32.5 33 28.0 34 41.0 35 77.0 36 98.5 37 113.0 38 134.0 39 149.5 40 175.0 41 194.5 42 204.0 43 236.0 44 255.0 45 232.5 46 231.0 47 237.5 48 234.5 49 233.0 50 195.5 51 171.0 52 148.0 53 124.5 54 101.5 55 63.0 56 53.5 57 44.5 58 29.5 59 20.5 60 13.5 61 11.5 62 10.5 63 5.5 64 3.0 65 4.0 66 3.0 67 2.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.44999999999999996 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.15 #Duplication Level Percentage of deduplicated Percentage of total 1 93.31723027375202 86.925 2 6.092324208266238 11.35 3 0.5099302200751477 1.425 4 0.08051529790660225 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 0.9624999999999999 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.2375 0.0 0.0 0.0 0.0 120-121 1.4125 0.0 0.0 0.0 0.0 122-123 1.5125 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 1.85 0.0 0.0 0.0 0.0 128-129 1.9874999999999998 0.0 0.0 0.0 0.0 130-131 2.0875 0.0 0.0 0.0 0.0 132-133 2.2750000000000004 0.0 0.0 0.0 0.0 134-135 2.4625 0.0 0.0 0.0 0.0 136-137 2.625 0.0 0.0 0.0 0.0 138-139 2.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACTCA 10 0.006830828 145.0 145 GTTTAAA 10 0.006830828 145.0 1 TTAAATT 10 0.006830828 145.0 3 >>END_MODULE SRR12671638 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671638_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.301 37.0 37.0 37.0 37.0 37.0 2 36.1865 37.0 37.0 37.0 37.0 37.0 3 36.2815 37.0 37.0 37.0 37.0 37.0 4 36.134 37.0 37.0 37.0 37.0 37.0 5 36.3455 37.0 37.0 37.0 37.0 37.0 6 36.209 37.0 37.0 37.0 37.0 37.0 7 36.1815 37.0 37.0 37.0 37.0 37.0 8 36.233 37.0 37.0 37.0 37.0 37.0 9 36.1745 37.0 37.0 37.0 37.0 37.0 10-14 36.2524 37.0 37.0 37.0 37.0 37.0 15-19 36.2427 37.0 37.0 37.0 37.0 37.0 20-24 36.2248 37.0 37.0 37.0 37.0 37.0 25-29 36.1596 37.0 37.0 37.0 37.0 37.0 30-34 36.122699999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.1488 37.0 37.0 37.0 37.0 37.0 40-44 36.1001 37.0 37.0 37.0 37.0 37.0 45-49 36.1337 37.0 37.0 37.0 37.0 37.0 50-54 36.109500000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.0775 37.0 37.0 37.0 37.0 37.0 60-64 36.0336 37.0 37.0 37.0 37.0 37.0 65-69 35.9408 37.0 37.0 37.0 37.0 37.0 70-74 35.9327 37.0 37.0 37.0 37.0 37.0 75-79 35.886700000000005 37.0 37.0 37.0 37.0 37.0 80-84 35.9065 37.0 37.0 37.0 37.0 37.0 85-89 35.8625 37.0 37.0 37.0 37.0 37.0 90-94 35.8315 37.0 37.0 37.0 37.0 37.0 95-99 35.851 37.0 37.0 37.0 37.0 37.0 100-104 35.8695 37.0 37.0 37.0 37.0 37.0 105-109 35.8078 37.0 37.0 37.0 37.0 37.0 110-114 35.745200000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.7642 37.0 37.0 37.0 37.0 37.0 120-124 35.678999999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.6845 37.0 37.0 37.0 37.0 37.0 130-134 35.6713 37.0 37.0 37.0 37.0 37.0 135-139 35.593599999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.3691 37.0 37.0 37.0 32.2 37.0 145-149 35.4651 37.0 37.0 37.0 37.0 37.0 150-151 35.15975 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 2.0 15 0.0 16 1.0 17 1.0 18 1.0 19 1.0 20 2.0 21 0.0 22 4.0 23 8.0 24 3.0 25 8.0 26 9.0 27 10.0 28 13.0 29 25.0 30 22.0 31 36.0 32 60.0 33 93.0 34 178.0 35 545.0 36 2802.0 37 174.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.225 16.7 18.825 31.25 2 26.424999999999997 21.3 35.625 16.650000000000002 3 21.975 26.275 31.424999999999997 20.325 4 24.675 32.0 22.375 20.95 5 25.95 34.825 20.849999999999998 18.375 6 19.225 38.4 23.025000000000002 19.35 7 18.95 19.35 39.675 22.025 8 22.75 24.95 25.35 26.950000000000003 9 23.05 24.65 27.775 24.525 10-14 23.555 28.9 25.580000000000002 21.965 15-19 23.31 28.144999999999996 26.810000000000002 21.735 20-24 22.655 28.265 26.82 22.259999999999998 25-29 23.565 28.59 26.009999999999998 21.834999999999997 30-34 22.939999999999998 28.105000000000004 27.025 21.93 35-39 23.330000000000002 27.755000000000003 27.065 21.85 40-44 23.095 28.03 26.900000000000002 21.975 45-49 23.445 27.400000000000002 27.495000000000005 21.66 50-54 23.805 27.63 26.325 22.24 55-59 23.855 27.425 26.790000000000003 21.93 60-64 24.25 27.389999999999997 26.445 21.915000000000003 65-69 23.785 27.139999999999997 27.29 21.785 70-74 24.285 27.200000000000003 26.979999999999997 21.535 75-79 23.47 27.455000000000002 26.724999999999998 22.35 80-84 24.34 27.744999999999997 26.640000000000004 21.275 85-89 24.22 27.994999999999997 26.35 21.435000000000002 90-94 23.86 27.515 26.83 21.795 95-99 23.955000000000002 27.145000000000003 26.884999999999998 22.015 100-104 24.075 27.68 26.950000000000003 21.295 105-109 24.42 27.250000000000004 27.075 21.255 110-114 24.515 26.655 27.21 21.62 115-119 24.39 26.400000000000002 27.560000000000002 21.65 120-124 24.759999999999998 27.275 26.889999999999997 21.075 125-129 24.215 27.29 27.634999999999998 20.86 130-134 24.535 27.700000000000003 26.57 21.195 135-139 24.95 26.889999999999997 27.025 21.135 140-144 24.33 27.365000000000002 26.950000000000003 21.355 145-149 24.41 27.765 26.39 21.435000000000002 150-151 24.8625 27.1375 27.3125 20.6875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 2.5 22 1.5 23 0.5 24 1.5 25 2.5 26 2.0 27 3.0 28 6.0 29 7.0 30 7.0 31 9.0 32 15.0 33 20.0 34 33.5 35 45.5 36 52.0 37 74.0 38 106.5 39 131.5 40 158.5 41 211.0 42 249.0 43 245.0 44 261.0 45 271.0 46 252.0 47 251.5 48 263.5 49 236.5 50 194.0 51 165.5 52 139.5 53 129.5 54 102.0 55 74.0 56 62.0 57 50.0 58 38.0 59 29.5 60 26.5 61 21.5 62 13.5 63 9.0 64 5.5 65 2.0 66 1.5 67 1.0 68 1.5 69 2.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 1.0 77 1.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.29578975596675 86.97500000000001 2 6.248323947438992 11.65 3 0.4022526146419952 1.125 4 0.026816840976133013 0.1 5 0.0 0.0 6 0.026816840976133013 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.07500000000000001 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.5249999999999999 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.0125 0.0 0.0 0.0 0.0 116-117 1.1124999999999998 0.0 0.0 0.0 0.0 118-119 1.2875 0.0 0.0 0.0 0.0 120-121 1.4625 0.0 0.0 0.0 0.0 122-123 1.5625 0.0 0.0 0.0 0.0 124-125 1.7625 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 2.0375 0.0 0.0 0.0 0.0 130-131 2.1375 0.0 0.0 0.0 0.0 132-133 2.325 0.0 0.0 0.0 0.0 134-135 2.4875 0.0 0.0 0.0 0.0 136-137 2.6500000000000004 0.0 0.0 0.0 0.0 138-139 2.7874999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGTAG 10 0.006830828 145.0 7 CTCGCTT 10 0.006830828 145.0 1 >>END_MODULE Read 891297 spots for SRR12671638.sra Written 891297 spots for SRR12671638.sra Read 891297 spots for SRR12671638.sra Written 891297 spots for SRR12671638.sra Read 891297 spots for SRR12671638.sra Written 891297 spots for SRR12671638.sra Read 891311 spots for SRR12671638.sra Written 891311 spots for SRR12671638.sra Read 891297 spots for SRR12671638.sra Written 891297 spots for SRR12671638.sra Read 891297 spots for SRR12671638.sra Written 891297 spots for SRR12671638.sra Read 891297 spots for SRR12671638.sra Written 891297 spots for SRR12671638.sra Read 891297 spots for SRR12671638.sra Written 891297 spots for SRR12671638.sra Read 891297 spots for SRR12671638.sra Written 891297 spots for SRR12671638.sra Read 891297 spots for SRR12671638.sra Written 891297 spots for SRR12671638.sra Read 891297 spots for SRR12671638.sra Written 891297 spots for SRR12671638.sra Read 891297 spots for SRR12671638.sra Written 891297 spots for SRR12671638.sra Read 891297 spots for SRR12671638.sra Written 891297 spots for SRR12671638.sra Read 891297 spots for SRR12671638.sra Written 891297 spots for SRR12671638.sra Read 891297 spots for SRR12671638.sra Written 891297 spots for SRR12671638.sra Read 891297 spots for SRR12671638.sra Written 891297 spots for SRR12671638.sra Read 891297 spots for SRR12671638.sra Written 891297 spots for SRR12671638.sra Read 891297 spots for SRR12671638.sra Written 891297 spots for SRR12671638.sra Read 891297 spots for SRR12671638.sra Written 891297 spots for SRR12671638.sra Read 891297 spots for SRR12671638.sra Written 891297 spots for SRR12671638.sra SRR ids: ['SRR12671638.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_d_sx4h01 SRR12671638.sra spots: 17825954 blocks: [[1, 891297], [891298, 1782594], [1782595, 2673891], [2673892, 3565188], [3565189, 4456485], [4456486, 5347782], [5347783, 6239079], [6239080, 7130376], [7130377, 8021673], [8021674, 8912970], [8912971, 9804267], [9804268, 10695564], [10695565, 11586861], [11586862, 12478158], [12478159, 13369455], [13369456, 14260752], [14260753, 15152049], [15152050, 16043346], [16043347, 16934643], [16934644, 17825954]] SRR12671638 file size 6036338 SRR12671638 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671638 SRR12671638_1.fastq SRR12671638_2.fastq Input file: SRR12671638_1.fastq Paired file: SRR12671638_2.fastq trimmed: SRR12671638-trimmed-pair1.fastq, SRR12671638-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:34:48 2025 >> started Tue Feb 11 23:35:19 2025 >> done (30.558s) 17825954 read pairs processed; of these: 6 ( 0.00%) short read pairs filtered out after trimming by size control 12882 ( 0.07%) empty read pairs filtered out after trimming by size control 17813066 (99.93%) read pairs available; of these: 796365 ( 4.47%) trimmed read pairs available after processing 17016701 (95.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 1 0.00% 22 2 0.00% 23 1 0.00% 24 2 0.00% 25 1 0.00% 26 6 0.00% 27 6 0.00% 28 6 0.00% 29 5 0.00% 30 8 0.00% 31 7 0.00% 32 15 0.00% 33 15 0.00% 34 12 0.00% 35 21 0.00% 36 23 0.00% 37 17 0.00% 38 27 0.00% 39 24 0.00% 40 20 0.00% 41 23 0.00% 42 18 0.00% 43 28 0.00% 44 29 0.00% 45 23 0.00% 46 24 0.00% 47 39 0.00% 48 47 0.00% 49 38 0.00% 50 65 0.00% 51 62 0.00% 52 56 0.00% 53 74 0.00% 54 68 0.00% 55 80 0.00% 56 76 0.00% 57 89 0.00% 58 96 0.00% 59 118 0.00% 60 135 0.00% 61 150 0.00% 62 143 0.00% 63 183 0.00% 64 196 0.00% 65 240 0.00% 66 226 0.00% 67 241 0.00% 68 250 0.00% 69 275 0.00% 70 363 0.00% 71 366 0.00% 72 424 0.00% 73 524 0.00% 74 547 0.00% 75 570 0.00% 76 635 0.00% 77 729 0.00% 78 794 0.00% 79 815 0.00% 80 943 0.01% 81 1020 0.01% 82 1166 0.01% 83 1355 0.01% 84 1467 0.01% 85 1567 0.01% 86 1715 0.01% 87 1872 0.01% 88 1880 0.01% 89 2041 0.01% 90 2314 0.01% 91 2489 0.01% 92 2717 0.02% 93 3061 0.02% 94 3241 0.02% 95 3444 0.02% 96 3546 0.02% 97 3889 0.02% 98 4033 0.02% 99 4232 0.02% 100 4602 0.03% 101 4705 0.03% 102 4935 0.03% 103 5511 0.03% 104 5543 0.03% 105 5888 0.03% 106 6342 0.04% 107 6430 0.04% 108 6771 0.04% 109 6926 0.04% 110 7339 0.04% 111 7485 0.04% 112 8045 0.05% 113 8326 0.05% 114 8659 0.05% 115 9467 0.05% 116 9775 0.05% 117 9983 0.06% 118 10187 0.06% 119 10585 0.06% 120 11092 0.06% 121 11505 0.06% 122 11729 0.07% 123 12451 0.07% 124 13034 0.07% 125 13518 0.08% 126 14104 0.08% 127 14459 0.08% 128 14744 0.08% 129 15437 0.09% 130 15634 0.09% 131 15909 0.09% 132 16696 0.09% 133 17473 0.10% 134 18148 0.10% 135 18650 0.10% 136 19528 0.11% 137 19628 0.11% 138 20426 0.11% 139 21276 0.12% 140 21221 0.12% 141 21745 0.12% 142 22875 0.13% 143 23682 0.13% 144 24660 0.14% 145 25141 0.14% 146 26531 0.15% 147 27034 0.15% 148 27415 0.15% 149 27966 0.16% 150 28077 0.16% 151 17016701 95.53% 17813066 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=21 prefix-density=0.68 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=58.92 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.0 sequence=CAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=23 prefix-density=0.90 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=33.17 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=9.7 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR12671638 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:36:40 Started mapping on | Feb 11 23:36:41 Finished on | Feb 11 23:39:12 Mapping speed, Million of reads per hour | 424.68 Number of input reads | 17813066 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 15976066 Uniquely mapped reads % | 89.69% Average mapped length | 295.50 Number of splices: Total | 16662627 Number of splices: Annotated (sjdb) | 16399808 Number of splices: GT/AG | 16310873 Number of splices: GC/AG | 303174 Number of splices: AT/AC | 9404 Number of splices: Non-canonical | 39176 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 403590 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 248423 % of reads mapped to too many loci | 1.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.40% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1433410 1433410 1433410 N_multimapping 403590 403590 403590 N_noFeature 419242 15715067 475703 N_ambiguous 319583 1321 114692 UnstrandedReadsAssigned:15237241 PositiveStrandReadsAssigned:259678 NegativeStrandReadsAssigned:15385671 Dataset is classified negative stranded MeadianReadLen=147 20thPercentileLength=147 echo kmer=143 SRR12671638 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671638-trimmed-pair1.fastq SRR12671638-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,813,066 reads, 16,021,739 reads pseudoaligned [quant] estimated average fragment length: 284.706 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52401 SRR12671638.ke.tsv 34699 SRR12671638.se.tsv 87100 total ==> SRR12671638.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1734.29 382 11.3119 Potri.005G024800.1.v4.1 1035 751.294 271 18.5249 Potri.004G059700.1.v4.1 961 677.507 2 0.151605 Potri.007G009000.2.v4.1 1416 1132.29 0 0 Potri.003G141000.2.v4.1 2943 2659.29 1032 19.9301 Potri.016G087400.1.v4.1 270 71.4722 731.71 525.774 Potri.015G069301.1.v4.1 564 295.572 0 0 Potri.010G195200.1.v4.1 1773 1489.29 47 1.62074 Potri.012G127500.1.v4.1 977 693.41 133 9.85051 ==> SRR12671638.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 217 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 380 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12671638 completed mapping pipeline successfully