Starting /dee2/code/volunteer_pipeline.sh SRR12671639 current disk space = 3052198113280 free memory = 1510357916 SRR12671639 SRAfilesize d2ce45989307968f5628e92c7a439ff1 SRR12671639.sra SRR12671639.sra file validated SRR12671639 is paired end SRR12671639 is conventional basespace SRR12671639 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671639_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.563 37.0 37.0 37.0 37.0 37.0 2 36.31775 37.0 37.0 37.0 37.0 37.0 3 36.5215 37.0 37.0 37.0 37.0 37.0 4 36.574 37.0 37.0 37.0 37.0 37.0 5 36.4915 37.0 37.0 37.0 37.0 37.0 6 36.5075 37.0 37.0 37.0 37.0 37.0 7 36.4145 37.0 37.0 37.0 37.0 37.0 8 36.544 37.0 37.0 37.0 37.0 37.0 9 36.578 37.0 37.0 37.0 37.0 37.0 10-14 36.5585 37.0 37.0 37.0 37.0 37.0 15-19 36.5364 37.0 37.0 37.0 37.0 37.0 20-24 36.52990000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.457499999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.467699999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.3972 37.0 37.0 37.0 37.0 37.0 40-44 36.427 37.0 37.0 37.0 37.0 37.0 45-49 36.409499999999994 37.0 37.0 37.0 37.0 37.0 50-54 36.3854 37.0 37.0 37.0 37.0 37.0 55-59 36.397400000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.397800000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3335 37.0 37.0 37.0 37.0 37.0 70-74 36.331 37.0 37.0 37.0 37.0 37.0 75-79 36.2499 37.0 37.0 37.0 37.0 37.0 80-84 36.2958 37.0 37.0 37.0 37.0 37.0 85-89 36.3 37.0 37.0 37.0 37.0 37.0 90-94 36.240500000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.228 37.0 37.0 37.0 37.0 37.0 100-104 36.240199999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.20700000000001 37.0 37.0 37.0 37.0 37.0 110-114 36.19540000000001 37.0 37.0 37.0 37.0 37.0 115-119 36.1545 37.0 37.0 37.0 37.0 37.0 120-124 36.13439999999999 37.0 37.0 37.0 37.0 37.0 125-129 36.050200000000004 37.0 37.0 37.0 37.0 37.0 130-134 36.0473 37.0 37.0 37.0 37.0 37.0 135-139 35.9807 37.0 37.0 37.0 37.0 37.0 140-144 35.9869 37.0 37.0 37.0 37.0 37.0 145-149 35.861000000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.53675 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 0.0 23 0.0 24 1.0 25 2.0 26 3.0 27 4.0 28 15.0 29 19.0 30 28.0 31 41.0 32 48.0 33 66.0 34 104.0 35 283.0 36 2987.0 37 397.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.8 12.325 12.425 43.45 2 19.19318466549737 19.268353796041094 38.71210223001754 22.826359308444 3 18.4 24.95 25.775 30.875000000000004 4 22.400000000000002 32.35 21.55 23.7 5 21.025 33.225 25.275 20.474999999999998 6 16.675 36.35 26.125 20.849999999999998 7 13.525 20.325 45.525 20.625 8 18.825 22.925 30.45 27.800000000000004 9 18.45 21.975 32.7 26.875 10-14 19.93 28.575 26.875 24.62 15-19 20.36 27.1 28.1 24.44 20-24 20.25 28.205000000000002 27.495000000000005 24.05 25-29 20.47 28.660000000000004 27.26 23.61 30-34 20.119999999999997 27.994999999999997 28.095 23.79 35-39 20.349999999999998 27.73 28.18 23.74 40-44 20.575 29.17 26.305 23.95 45-49 20.200000000000003 27.965 27.134999999999998 24.7 50-54 20.474999999999998 27.35 27.395000000000003 24.779999999999998 55-59 20.544999999999998 27.139999999999997 27.975 24.34 60-64 20.54 28.000000000000004 27.425 24.035 65-69 21.025 27.295 27.705000000000002 23.974999999999998 70-74 20.97 27.575 27.375 24.08 75-79 20.21 27.815 27.52 24.455 80-84 20.74 27.650000000000002 27.07 24.54 85-89 21.005 27.68 27.24 24.075 90-94 19.99 28.000000000000004 27.46 24.55 95-99 20.805 27.165 27.51 24.52 100-104 21.17 27.055 27.435 24.34 105-109 20.365 27.13 27.655 24.85 110-114 20.979999999999997 27.0 27.515 24.505 115-119 20.77 28.065 26.75 24.415 120-124 21.18 27.384999999999998 27.16 24.275 125-129 21.17 27.195000000000004 27.43 24.205 130-134 21.385 27.229999999999997 27.08 24.305 135-139 21.08 26.584999999999997 27.61 24.725 140-144 21.135 27.155 27.205000000000002 24.505 145-149 21.490000000000002 27.27 26.995 24.245 150-151 20.9375 28.1875 26.125 24.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 2.0 23 3.5 24 2.5 25 2.0 26 4.0 27 4.0 28 7.5 29 13.5 30 17.5 31 26.5 32 36.0 33 42.5 34 59.5 35 72.5 36 83.0 37 99.0 38 113.0 39 136.5 40 158.5 41 183.5 42 217.5 43 227.5 44 232.5 45 245.0 46 251.5 47 256.5 48 235.5 49 220.5 50 199.0 51 162.0 52 139.5 53 124.0 54 107.0 55 69.5 56 49.0 57 55.5 58 43.0 59 23.0 60 19.5 61 16.0 62 10.0 63 6.5 64 3.0 65 3.0 66 3.0 67 3.0 68 2.5 69 2.0 70 2.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.95 #Duplication Level Percentage of deduplicated Percentage of total 1 94.11921234699308 88.425 2 5.348589675359234 10.05 3 0.5055880787653007 1.425 4 0.026609898882384245 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.275 0.0 0.0 0.0 0.0 118-119 1.3250000000000002 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 1.8625 0.0 0.0 0.0 0.0 126-127 2.1125 0.0 0.0 0.0 0.0 128-129 2.2875 0.0 0.0 0.0 0.0 130-131 2.5 0.0 0.0 0.0 0.0 132-133 2.8 0.0 0.0 0.0 0.0 134-135 3.2375 0.0 0.0 0.0 0.0 136-137 3.6625 0.0 0.0 0.0 0.0 138-139 4.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGGTG 10 0.006830828 145.0 2 TTCCATT 10 0.006830828 145.0 6 ATTCCAT 10 0.006830828 145.0 5 TTAGAGT 10 0.006830828 145.0 7 >>END_MODULE SRR12671639 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671639_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.355 37.0 37.0 37.0 37.0 37.0 2 36.0995 37.0 37.0 37.0 37.0 37.0 3 36.207 37.0 37.0 37.0 37.0 37.0 4 36.102 37.0 37.0 37.0 37.0 37.0 5 36.2905 37.0 37.0 37.0 37.0 37.0 6 36.236 37.0 37.0 37.0 37.0 37.0 7 36.3725 37.0 37.0 37.0 37.0 37.0 8 36.2955 37.0 37.0 37.0 37.0 37.0 9 36.352 37.0 37.0 37.0 37.0 37.0 10-14 36.327000000000005 37.0 37.0 37.0 37.0 37.0 15-19 36.314 37.0 37.0 37.0 37.0 37.0 20-24 36.246300000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.1845 37.0 37.0 37.0 37.0 37.0 30-34 36.2232 37.0 37.0 37.0 37.0 37.0 35-39 36.1822 37.0 37.0 37.0 37.0 37.0 40-44 36.202200000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.161300000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.1375 37.0 37.0 37.0 37.0 37.0 55-59 36.0848 37.0 37.0 37.0 37.0 37.0 60-64 36.067099999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.0587 37.0 37.0 37.0 37.0 37.0 70-74 36.0433 37.0 37.0 37.0 37.0 37.0 75-79 35.9566 37.0 37.0 37.0 37.0 37.0 80-84 36.0027 37.0 37.0 37.0 37.0 37.0 85-89 35.9249 37.0 37.0 37.0 37.0 37.0 90-94 35.929899999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.952200000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.879599999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.8301 37.0 37.0 37.0 37.0 37.0 110-114 35.815999999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.730000000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.7829 37.0 37.0 37.0 37.0 37.0 125-129 35.6746 37.0 37.0 37.0 37.0 37.0 130-134 35.7638 37.0 37.0 37.0 37.0 37.0 135-139 35.6905 37.0 37.0 37.0 37.0 37.0 140-144 35.4619 37.0 37.0 37.0 37.0 37.0 145-149 35.502500000000005 37.0 37.0 37.0 34.6 37.0 150-151 35.233000000000004 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 2.0 17 5.0 18 0.0 19 1.0 20 1.0 21 3.0 22 4.0 23 9.0 24 4.0 25 5.0 26 8.0 27 11.0 28 10.0 29 18.0 30 27.0 31 40.0 32 61.0 33 75.0 34 138.0 35 521.0 36 2812.0 37 243.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.175 18.4 17.224999999999998 31.2 2 26.424999999999997 23.150000000000002 34.0 16.425 3 21.4 27.400000000000002 28.999999999999996 22.2 4 23.075000000000003 33.675 22.075 21.175 5 24.349999999999998 37.574999999999996 21.25 16.825000000000003 6 20.200000000000003 35.949999999999996 23.799999999999997 20.05 7 19.35 17.075000000000003 41.05 22.525000000000002 8 22.025 23.25 26.75 27.975 9 21.25 24.25 29.75 24.75 10-14 23.32 28.38 26.26 22.040000000000003 15-19 23.745 27.634999999999998 26.784999999999997 21.834999999999997 20-24 23.990000000000002 28.16 26.515 21.335 25-29 24.26 27.71 27.310000000000002 20.72 30-34 23.275000000000002 27.779999999999998 27.3 21.645 35-39 23.355 27.93 26.87 21.845 40-44 23.685000000000002 27.505000000000003 27.089999999999996 21.72 45-49 23.715 27.485 27.58 21.22 50-54 23.605 28.08 26.77 21.545 55-59 23.200000000000003 27.779999999999998 27.11 21.91 60-64 24.345 27.555000000000003 26.6 21.5 65-69 24.135 27.384999999999998 26.419999999999998 22.06 70-74 23.535 28.63 25.96 21.875 75-79 23.165 27.125 27.500000000000004 22.21 80-84 23.305 27.49 26.995 22.21 85-89 23.849999999999998 28.095 26.3 21.755 90-94 23.91 27.32 26.840000000000003 21.93 95-99 24.01 28.01 26.825 21.154999999999998 100-104 23.785 28.155 26.765 21.295 105-109 24.32 27.889999999999997 26.75 21.04 110-114 24.825 27.83 26.405 20.94 115-119 23.91 28.244999999999997 26.685 21.16 120-124 24.555 28.155 26.465 20.825 125-129 24.68 27.529999999999998 27.235 20.555 130-134 24.765 27.529999999999998 26.834999999999997 20.87 135-139 25.040000000000003 27.18 26.665 21.115000000000002 140-144 24.884999999999998 28.000000000000004 26.91 20.205000000000002 145-149 25.185000000000002 27.43 26.665 20.72 150-151 25.525 28.0875 26.3125 20.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 1.0 24 1.5 25 4.0 26 4.0 27 3.5 28 4.0 29 4.5 30 10.0 31 13.5 32 16.5 33 18.0 34 23.0 35 44.5 36 58.0 37 73.0 38 104.0 39 142.0 40 176.0 41 189.0 42 222.5 43 264.0 44 285.0 45 269.0 46 267.5 47 282.5 48 253.5 49 219.5 50 180.5 51 161.0 52 147.5 53 121.5 54 96.5 55 66.0 56 60.5 57 57.5 58 41.0 59 28.0 60 19.0 61 15.5 62 12.5 63 12.0 64 6.5 65 1.5 66 1.0 67 2.5 68 2.5 69 1.5 70 2.0 71 1.0 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.375 #Duplication Level Percentage of deduplicated Percentage of total 1 94.43708609271523 89.125 2 5.245033112582782 9.9 3 0.26490066225165565 0.75 4 0.026490066225165563 0.1 5 0.026490066225165563 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.42500000000000004 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.275 0.0 0.0 0.0 0.0 118-119 1.3250000000000002 0.0 0.0 0.0 0.0 120-121 1.475 0.0 0.0 0.0 0.0 122-123 1.6625 0.0 0.0 0.0 0.0 124-125 1.8375 0.0 0.0 0.0 0.0 126-127 2.0875000000000004 0.0 0.0 0.0 0.0 128-129 2.2625 0.0 0.0 0.0 0.0 130-131 2.4749999999999996 0.0 0.0 0.0 0.0 132-133 2.775 0.0 0.0 0.0 0.0 134-135 3.2125 0.0 0.0 0.0 0.0 136-137 3.6375 0.0 0.0 0.0 0.0 138-139 3.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra Read 875998 spots for SRR12671639.sra Written 875998 spots for SRR12671639.sra SRR ids: ['SRR12671639.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rd9b3erx SRR12671639.sra spots: 17519960 blocks: [[1, 875998], [875999, 1751996], [1751997, 2627994], [2627995, 3503992], [3503993, 4379990], [4379991, 5255988], [5255989, 6131986], [6131987, 7007984], [7007985, 7883982], [7883983, 8759980], [8759981, 9635978], [9635979, 10511976], [10511977, 11387974], [11387975, 12263972], [12263973, 13139970], [13139971, 14015968], [14015969, 14891966], [14891967, 15767964], [15767965, 16643962], [16643963, 17519960]] SRR12671639 file size 5932348 SRR12671639 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671639 SRR12671639_1.fastq SRR12671639_2.fastq Input file: SRR12671639_1.fastq Paired file: SRR12671639_2.fastq trimmed: SRR12671639-trimmed-pair1.fastq, SRR12671639-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:34:53 2025 >> started Tue Feb 11 23:35:21 2025 >> done (28.140s) 17519960 read pairs processed; of these: 31 ( 0.00%) short read pairs filtered out after trimming by size control 2615 ( 0.01%) empty read pairs filtered out after trimming by size control 17517314 (99.98%) read pairs available; of these: 1310862 ( 7.48%) trimmed read pairs available after processing 16206452 (92.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 1 0.00% 21 4 0.00% 22 0 0.00% 23 3 0.00% 24 1 0.00% 25 3 0.00% 26 1 0.00% 27 4 0.00% 28 2 0.00% 29 3 0.00% 30 1 0.00% 31 3 0.00% 32 8 0.00% 33 10 0.00% 34 4 0.00% 35 7 0.00% 36 13 0.00% 37 11 0.00% 38 8 0.00% 39 11 0.00% 40 9 0.00% 41 19 0.00% 42 20 0.00% 43 31 0.00% 44 16 0.00% 45 27 0.00% 46 30 0.00% 47 34 0.00% 48 30 0.00% 49 31 0.00% 50 51 0.00% 51 61 0.00% 52 59 0.00% 53 55 0.00% 54 70 0.00% 55 75 0.00% 56 91 0.00% 57 89 0.00% 58 83 0.00% 59 106 0.00% 60 144 0.00% 61 134 0.00% 62 177 0.00% 63 183 0.00% 64 172 0.00% 65 223 0.00% 66 218 0.00% 67 267 0.00% 68 315 0.00% 69 349 0.00% 70 429 0.00% 71 454 0.00% 72 591 0.00% 73 598 0.00% 74 708 0.00% 75 817 0.00% 76 944 0.01% 77 969 0.01% 78 1083 0.01% 79 1194 0.01% 80 1246 0.01% 81 1526 0.01% 82 1739 0.01% 83 1964 0.01% 84 2125 0.01% 85 2399 0.01% 86 2470 0.01% 87 2692 0.02% 88 3080 0.02% 89 3143 0.02% 90 3599 0.02% 91 3827 0.02% 92 4187 0.02% 93 4617 0.03% 94 5072 0.03% 95 5605 0.03% 96 5904 0.03% 97 6219 0.04% 98 6476 0.04% 99 6792 0.04% 100 7445 0.04% 101 7670 0.04% 102 8357 0.05% 103 8952 0.05% 104 9397 0.05% 105 10109 0.06% 106 10431 0.06% 107 10908 0.06% 108 11288 0.06% 109 11828 0.07% 110 12210 0.07% 111 12891 0.07% 112 13674 0.08% 113 14418 0.08% 114 15168 0.09% 115 15818 0.09% 116 16601 0.09% 117 17206 0.10% 118 17557 0.10% 119 18063 0.10% 120 18844 0.11% 121 19619 0.11% 122 20456 0.12% 123 21621 0.12% 124 22353 0.13% 125 23107 0.13% 126 24141 0.14% 127 24411 0.14% 128 25170 0.14% 129 25740 0.15% 130 26080 0.15% 131 27482 0.16% 132 28172 0.16% 133 29913 0.17% 134 30567 0.17% 135 31519 0.18% 136 32455 0.19% 137 32966 0.19% 138 33813 0.19% 139 34749 0.20% 140 35087 0.20% 141 35659 0.20% 142 36845 0.21% 143 38330 0.22% 144 39869 0.23% 145 40965 0.23% 146 42043 0.24% 147 42411 0.24% 148 43293 0.25% 149 43510 0.25% 150 43940 0.25% 151 16206452 92.52% 17517314 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=25 prefix-density=0.70 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=88.89 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=7.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=14 prefix-density=0.59 prefix-fanout=2.2 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=44.30 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=1.9 sequence=GGAACTCAAACGCATAGCTTCCTACAAATACCCCAGCTAGCCAATACTCTCAACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCGTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGGCCTCTCTGCTGACCCAGAGACCTTTGCCAAGAACCGTGAGCTTGAAGTCATCCATTCCAGGTGGGCCATGCTTGGAGCTCTTGGATGCGTCTTCCCCGAGCTCTTGTCCCGCAACGGTGTCAAGTTCGGCGAGGCTGTATGGTTCAAGGCTGGAGCCCAGA SRR12671639 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:36:04 Started mapping on | Feb 11 23:36:04 Finished on | Feb 11 23:38:08 Mapping speed, Million of reads per hour | 508.57 Number of input reads | 17517314 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 16233735 Uniquely mapped reads % | 92.67% Average mapped length | 297.67 Number of splices: Total | 16774107 Number of splices: Annotated (sjdb) | 16496449 Number of splices: GT/AG | 16422715 Number of splices: GC/AG | 301053 Number of splices: AT/AC | 10214 Number of splices: Non-canonical | 40125 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.97 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 422009 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 259794 % of reads mapped to too many loci | 1.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.20% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 861570 861570 861570 N_multimapping 422009 422009 422009 N_noFeature 439275 15968919 506499 N_ambiguous 292983 1393 94600 UnstrandedReadsAssigned:15501477 PositiveStrandReadsAssigned:263423 NegativeStrandReadsAssigned:15632636 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671639 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671639-trimmed-pair1.fastq SRR12671639-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,517,314 reads, 15,817,952 reads pseudoaligned [quant] estimated average fragment length: 266.152 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,223 rounds 52401 SRR12671639.ke.tsv 34699 SRR12671639.se.tsv 87100 total ==> SRR12671639.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.85 619 18.4415 Potri.005G024800.1.v4.1 1035 769.848 336 22.7921 Potri.004G059700.1.v4.1 961 695.955 3 0.225107 Potri.007G009000.2.v4.1 1416 1150.85 0 0 Potri.003G141000.2.v4.1 2943 2677.85 1002 19.5403 Potri.016G087400.1.v4.1 270 77.1086 1514 1025.35 Potri.015G069301.1.v4.1 564 309.904 0 0 Potri.010G195200.1.v4.1 1773 1507.85 112 3.87891 Potri.012G127500.1.v4.1 977 711.895 163 11.957 ==> SRR12671639.se.tsv <== Potri.001G166300.v4.1 3 Potri.001G448400.v4.1 167 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 339 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 8 SRR12671639 completed mapping pipeline successfully