Starting /dee2/code/volunteer_pipeline.sh SRR12671640 current disk space = 3052096393216 free memory = 1471628740 SRR12671640 SRAfilesize f552539da0bf7e80dabe38ca2cd98db1 SRR12671640.sra SRR12671640.sra file validated SRR12671640 is paired end SRR12671640 is conventional basespace SRR12671640 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671640_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4215 37.0 37.0 37.0 37.0 37.0 2 36.3 37.0 37.0 37.0 37.0 37.0 3 36.5695 37.0 37.0 37.0 37.0 37.0 4 36.5885 37.0 37.0 37.0 37.0 37.0 5 36.5285 37.0 37.0 37.0 37.0 37.0 6 36.47 37.0 37.0 37.0 37.0 37.0 7 36.5115 37.0 37.0 37.0 37.0 37.0 8 36.5825 37.0 37.0 37.0 37.0 37.0 9 36.5995 37.0 37.0 37.0 37.0 37.0 10-14 36.540299999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.549 37.0 37.0 37.0 37.0 37.0 20-24 36.5471 37.0 37.0 37.0 37.0 37.0 25-29 36.4642 37.0 37.0 37.0 37.0 37.0 30-34 36.4739 37.0 37.0 37.0 37.0 37.0 35-39 36.4794 37.0 37.0 37.0 37.0 37.0 40-44 36.4197 37.0 37.0 37.0 37.0 37.0 45-49 36.414699999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.3854 37.0 37.0 37.0 37.0 37.0 55-59 36.387 37.0 37.0 37.0 37.0 37.0 60-64 36.3504 37.0 37.0 37.0 37.0 37.0 65-69 36.36460000000001 37.0 37.0 37.0 37.0 37.0 70-74 36.3155 37.0 37.0 37.0 37.0 37.0 75-79 36.306 37.0 37.0 37.0 37.0 37.0 80-84 36.3386 37.0 37.0 37.0 37.0 37.0 85-89 36.3238 37.0 37.0 37.0 37.0 37.0 90-94 36.2834 37.0 37.0 37.0 37.0 37.0 95-99 36.18990000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.2791 37.0 37.0 37.0 37.0 37.0 105-109 36.174 37.0 37.0 37.0 37.0 37.0 110-114 36.2344 37.0 37.0 37.0 37.0 37.0 115-119 36.1539 37.0 37.0 37.0 37.0 37.0 120-124 36.0812 37.0 37.0 37.0 37.0 37.0 125-129 36.068799999999996 37.0 37.0 37.0 37.0 37.0 130-134 36.1055 37.0 37.0 37.0 37.0 37.0 135-139 36.0154 37.0 37.0 37.0 37.0 37.0 140-144 35.9139 37.0 37.0 37.0 37.0 37.0 145-149 35.970000000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.53725 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 0.0 25 1.0 26 1.0 27 7.0 28 7.0 29 13.0 30 27.0 31 45.0 32 50.0 33 73.0 34 119.0 35 272.0 36 2985.0 37 398.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.624999999999996 14.000000000000002 13.025 41.349999999999994 2 20.86673346693387 18.286573146292582 37.4749498997996 23.371743486973948 3 17.925 23.75 28.549999999999997 29.775000000000002 4 21.85 31.15 22.675 24.325 5 20.8 36.5 23.025000000000002 19.675 6 18.75 34.699999999999996 26.075 20.474999999999998 7 14.649999999999999 21.65 44.3 19.400000000000002 8 18.85 22.675 29.425 29.049999999999997 9 17.4 23.65 32.475 26.474999999999998 10-14 20.125 28.310000000000002 26.775 24.79 15-19 20.24 27.439999999999998 27.875 24.445 20-24 20.885 27.465 27.48 24.169999999999998 25-29 20.22 28.444999999999997 27.055 24.279999999999998 30-34 20.325 27.084999999999997 27.92 24.67 35-39 20.39 27.375 28.27 23.965 40-44 20.57 27.439999999999998 27.35 24.64 45-49 20.06 27.705000000000002 27.57 24.665 50-54 21.015 27.605 27.11 24.27 55-59 20.62 27.229999999999997 27.38 24.77 60-64 20.355 27.939999999999998 27.325 24.38 65-69 20.465 27.150000000000002 27.99 24.395 70-74 20.5 26.685 27.74 25.074999999999996 75-79 20.48 27.41 27.755000000000003 24.355 80-84 20.45 27.955000000000002 27.315 24.279999999999998 85-89 20.74 27.715 27.38 24.165 90-94 20.880000000000003 26.790000000000003 27.485 24.845 95-99 20.575 26.68 27.87 24.875 100-104 21.21 26.965 27.284999999999997 24.54 105-109 20.77 27.0 27.560000000000002 24.67 110-114 20.855 26.6 28.21 24.335 115-119 21.315 27.235 26.865 24.585 120-124 20.79 27.565 26.979999999999997 24.665 125-129 21.025 26.775 27.884999999999998 24.315 130-134 21.27 27.11 26.47 25.15 135-139 21.645 27.105 27.205000000000002 24.044999999999998 140-144 21.95 26.529999999999998 27.345000000000002 24.175 145-149 20.995 26.779999999999998 27.52 24.705 150-151 20.724999999999998 26.974999999999998 27.750000000000004 24.55 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 3.5 26 6.5 27 5.5 28 4.0 29 9.5 30 16.5 31 15.0 32 23.5 33 34.0 34 42.0 35 60.0 36 78.0 37 98.0 38 112.5 39 124.0 40 153.0 41 181.5 42 223.5 43 259.5 44 256.0 45 261.0 46 256.0 47 251.5 48 260.5 49 228.0 50 197.0 51 180.5 52 145.5 53 114.5 54 96.0 55 75.0 56 55.0 57 47.0 58 37.5 59 26.0 60 18.0 61 12.0 62 11.0 63 8.0 64 3.0 65 1.5 66 0.5 67 1.0 68 2.0 69 1.5 70 2.0 71 1.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.2 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.875 #Duplication Level Percentage of deduplicated Percentage of total 1 94.1145139813582 88.35 2 5.352862849533955 10.05 3 0.4527296937416778 1.275 4 0.05326231691078562 0.2 5 0.02663115845539281 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.6000000000000001 0.0 0.0 0.0 0.0 116-117 0.725 0.0 0.0 0.0 0.0 118-119 0.8374999999999999 0.0 0.0 0.0 0.0 120-121 0.9624999999999999 0.0 0.0 0.0 0.0 122-123 1.1375 0.0 0.0 0.0 0.0 124-125 1.2875 0.0 0.0 0.0 0.0 126-127 1.475 0.0 0.0 0.0 0.0 128-129 1.725 0.0 0.0 0.0 0.0 130-131 1.8250000000000002 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.2375 0.0 0.0 0.0 0.0 136-137 2.475 0.0 0.0 0.0 0.0 138-139 2.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCAAT 10 0.006830828 145.0 6 ATCAATT 10 0.006830828 145.0 7 >>END_MODULE SRR12671640 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671640_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2365 37.0 37.0 37.0 37.0 37.0 2 36.041 37.0 37.0 37.0 37.0 37.0 3 36.0665 37.0 37.0 37.0 37.0 37.0 4 36.0765 37.0 37.0 37.0 37.0 37.0 5 36.162 37.0 37.0 37.0 37.0 37.0 6 36.12 37.0 37.0 37.0 37.0 37.0 7 36.1465 37.0 37.0 37.0 37.0 37.0 8 36.2625 37.0 37.0 37.0 37.0 37.0 9 36.2145 37.0 37.0 37.0 37.0 37.0 10-14 36.229 37.0 37.0 37.0 37.0 37.0 15-19 36.186099999999996 37.0 37.0 37.0 37.0 37.0 20-24 36.1312 37.0 37.0 37.0 37.0 37.0 25-29 36.118199999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.0696 37.0 37.0 37.0 37.0 37.0 35-39 36.080799999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.0936 37.0 37.0 37.0 37.0 37.0 45-49 36.003499999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.0702 37.0 37.0 37.0 37.0 37.0 55-59 35.9638 37.0 37.0 37.0 37.0 37.0 60-64 35.976400000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.93130000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.8981 37.0 37.0 37.0 37.0 37.0 75-79 35.856700000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.90690000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.8198 37.0 37.0 37.0 37.0 37.0 90-94 35.825500000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.850300000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.7949 37.0 37.0 37.0 37.0 37.0 105-109 35.6856 37.0 37.0 37.0 37.0 37.0 110-114 35.7229 37.0 37.0 37.0 37.0 37.0 115-119 35.7582 37.0 37.0 37.0 37.0 37.0 120-124 35.6868 37.0 37.0 37.0 37.0 37.0 125-129 35.560700000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.64829999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.594 37.0 37.0 37.0 37.0 37.0 140-144 35.38620000000001 37.0 37.0 37.0 34.6 37.0 145-149 35.4358 37.0 37.0 37.0 34.6 37.0 150-151 35.11775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 1.0 14 7.0 15 2.0 16 3.0 17 1.0 18 1.0 19 0.0 20 1.0 21 0.0 22 2.0 23 2.0 24 7.0 25 4.0 26 4.0 27 14.0 28 19.0 29 22.0 30 29.0 31 45.0 32 48.0 33 91.0 34 202.0 35 572.0 36 2729.0 37 192.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.675 18.025 16.6 30.7 2 27.325 24.349999999999998 31.624999999999996 16.7 3 23.125 28.050000000000004 28.7 20.125 4 25.324999999999996 35.025 21.224999999999998 18.425 5 25.124999999999996 36.325 21.525 17.025000000000002 6 21.15 37.7 21.099999999999998 20.05 7 19.075 19.275000000000002 39.35 22.3 8 21.55 24.625 26.575 27.250000000000004 9 23.5 23.575 27.675 25.25 10-14 23.794999999999998 28.175 25.650000000000002 22.38 15-19 24.169999999999998 27.355 26.479999999999997 21.995 20-24 23.724999999999998 28.1 26.52 21.654999999999998 25-29 23.53 28.685 26.33 21.455 30-34 23.544999999999998 28.549999999999997 25.97 21.935 35-39 23.68 27.889999999999997 26.515 21.915000000000003 40-44 23.7 27.779999999999998 26.905 21.615000000000002 45-49 24.05 27.625 26.76 21.565 50-54 23.465 28.000000000000004 26.75 21.785 55-59 24.235 27.74 26.369999999999997 21.654999999999998 60-64 24.5 27.384999999999998 26.595000000000002 21.52 65-69 23.635 27.35 27.02 21.995 70-74 24.215 27.325 26.57 21.89 75-79 23.905 27.435 26.345000000000002 22.314999999999998 80-84 24.07 28.005000000000003 26.369999999999997 21.555 85-89 24.060000000000002 27.495000000000005 26.61 21.834999999999997 90-94 24.265 27.49 26.755000000000003 21.490000000000002 95-99 23.87 27.860000000000003 26.314999999999998 21.955 100-104 24.33 28.01 26.695 20.965 105-109 24.015 27.38 26.865 21.740000000000002 110-114 24.705 27.200000000000003 26.575 21.52 115-119 24.46 27.165 26.695 21.68 120-124 23.835 27.52 26.915 21.73 125-129 24.295 27.79 26.735 21.18 130-134 24.385 27.339999999999996 26.724999999999998 21.55 135-139 24.845 27.839999999999996 26.57 20.745 140-144 23.925 28.375 26.13 21.57 145-149 25.580000000000002 27.994999999999997 25.740000000000002 20.685000000000002 150-151 25.4875 27.0875 26.700000000000003 20.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.5 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.0 25 1.0 26 1.5 27 0.5 28 1.5 29 5.5 30 7.5 31 8.0 32 11.0 33 18.0 34 27.0 35 32.0 36 48.5 37 79.0 38 103.5 39 124.5 40 166.0 41 207.5 42 228.5 43 248.0 44 254.5 45 261.0 46 275.5 47 280.5 48 275.5 49 240.0 50 201.0 51 165.0 52 125.5 53 112.5 54 109.5 55 88.0 56 68.5 57 59.5 58 34.5 59 24.5 60 26.5 61 17.0 62 11.0 63 8.0 64 6.0 65 3.0 66 3.0 67 4.5 68 2.5 69 2.5 70 1.5 71 0.5 72 0.5 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.5 84 1.0 85 0.5 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.5 93 0.5 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.3 #Duplication Level Percentage of deduplicated Percentage of total 1 94.40615058324497 89.025 2 5.16967126193001 9.75 3 0.39766702014846234 1.125 4 0.02651113467656416 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.4375 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.75 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 0.9875 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.3125 0.0 0.0 0.0 0.0 126-127 1.5 0.0 0.0 0.0 0.0 128-129 1.7999999999999998 0.0 0.0 0.0 0.0 130-131 1.9 0.0 0.0 0.0 0.0 132-133 2.075 0.0 0.0 0.0 0.0 134-135 2.3125 0.0 0.0 0.0 0.0 136-137 2.5625 0.0 0.0 0.0 0.0 138-139 2.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGACAGC 10 0.006830828 145.0 5 >>END_MODULE Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra Read 803365 spots for SRR12671640.sra Written 803365 spots for SRR12671640.sra SRR ids: ['SRR12671640.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ec9so_gg SRR12671640.sra spots: 16067300 blocks: [[1, 803365], [803366, 1606730], [1606731, 2410095], [2410096, 3213460], [3213461, 4016825], [4016826, 4820190], [4820191, 5623555], [5623556, 6426920], [6426921, 7230285], [7230286, 8033650], [8033651, 8837015], [8837016, 9640380], [9640381, 10443745], [10443746, 11247110], [11247111, 12050475], [12050476, 12853840], [12853841, 13657205], [13657206, 14460570], [14460571, 15263935], [15263936, 16067300]] SRR12671640 file size 5438671 SRR12671640 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671640 SRR12671640_1.fastq SRR12671640_2.fastq Input file: SRR12671640_1.fastq Paired file: SRR12671640_2.fastq trimmed: SRR12671640-trimmed-pair1.fastq, SRR12671640-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:39:30 2025 >> started Tue Feb 11 23:39:49 2025 >> done (19.367s) 16067300 read pairs processed; of these: 8 ( 0.00%) short read pairs filtered out after trimming by size control 2132 ( 0.01%) empty read pairs filtered out after trimming by size control 16065160 (99.99%) read pairs available; of these: 677292 ( 4.22%) trimmed read pairs available after processing 15387868 (95.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 3 0.00% 21 2 0.00% 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 4 0.00% 26 2 0.00% 27 2 0.00% 28 3 0.00% 29 2 0.00% 30 4 0.00% 31 1 0.00% 32 5 0.00% 33 4 0.00% 34 2 0.00% 35 8 0.00% 36 3 0.00% 37 8 0.00% 38 9 0.00% 39 8 0.00% 40 10 0.00% 41 11 0.00% 42 9 0.00% 43 12 0.00% 44 16 0.00% 45 17 0.00% 46 18 0.00% 47 20 0.00% 48 14 0.00% 49 23 0.00% 50 16 0.00% 51 25 0.00% 52 28 0.00% 53 35 0.00% 54 33 0.00% 55 52 0.00% 56 50 0.00% 57 47 0.00% 58 49 0.00% 59 54 0.00% 60 69 0.00% 61 76 0.00% 62 98 0.00% 63 100 0.00% 64 87 0.00% 65 77 0.00% 66 106 0.00% 67 152 0.00% 68 157 0.00% 69 132 0.00% 70 218 0.00% 71 221 0.00% 72 244 0.00% 73 252 0.00% 74 295 0.00% 75 314 0.00% 76 370 0.00% 77 388 0.00% 78 440 0.00% 79 485 0.00% 80 551 0.00% 81 610 0.00% 82 719 0.00% 83 788 0.00% 84 897 0.01% 85 1054 0.01% 86 1142 0.01% 87 1162 0.01% 88 1233 0.01% 89 1324 0.01% 90 1402 0.01% 91 1697 0.01% 92 1861 0.01% 93 2000 0.01% 94 2127 0.01% 95 2350 0.01% 96 2507 0.02% 97 2688 0.02% 98 2806 0.02% 99 3100 0.02% 100 3191 0.02% 101 3467 0.02% 102 3641 0.02% 103 4027 0.03% 104 4316 0.03% 105 4491 0.03% 106 4832 0.03% 107 4877 0.03% 108 5241 0.03% 109 5382 0.03% 110 5802 0.04% 111 5959 0.04% 112 6386 0.04% 113 6970 0.04% 114 7193 0.04% 115 7661 0.05% 116 7978 0.05% 117 8230 0.05% 118 8550 0.05% 119 8683 0.05% 120 9006 0.06% 121 9467 0.06% 122 9781 0.06% 123 10552 0.07% 124 11326 0.07% 125 11786 0.07% 126 12236 0.08% 127 12444 0.08% 128 12732 0.08% 129 12861 0.08% 130 13239 0.08% 131 13662 0.09% 132 14338 0.09% 133 15425 0.10% 134 15938 0.10% 135 16420 0.10% 136 17246 0.11% 137 17781 0.11% 138 18344 0.11% 139 18706 0.12% 140 19073 0.12% 141 19538 0.12% 142 20181 0.13% 143 21185 0.13% 144 22568 0.14% 145 23158 0.14% 146 24033 0.15% 147 24357 0.15% 148 25412 0.16% 149 25055 0.16% 150 25654 0.16% 151 15387868 95.78% 16065160 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=15 prefix-density=0.69 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.15 sequence-density-rank=26 fanout-score=6.62 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=2.5 sequence=ACACCCACAAGCCTAGAAAAGGAATTAGAATTTGTAAGTGCAGCTTCCATCATCACTCCTTGCAGTTGGATCAAAGTTTGCTGCATTTGGATCAGTACAGCCTTCAG criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=22 prefix-density=0.68 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=26.20 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=9.3 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCA SRR12671640 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:40:38 Started mapping on | Feb 11 23:40:39 Finished on | Feb 11 23:42:27 Mapping speed, Million of reads per hour | 535.51 Number of input reads | 16065160 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 14716087 Uniquely mapped reads % | 91.60% Average mapped length | 299.21 Number of splices: Total | 15748279 Number of splices: Annotated (sjdb) | 15506251 Number of splices: GT/AG | 15420197 Number of splices: GC/AG | 286599 Number of splices: AT/AC | 8765 Number of splices: Non-canonical | 32718 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.87 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 394355 % of reads mapped to multiple loci | 2.45% Number of reads mapped to too many loci | 321700 % of reads mapped to too many loci | 2.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.62% % of reads unmapped: other | 0.32% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 954718 954718 954718 N_multimapping 394355 394355 394355 N_noFeature 435961 14447030 495767 N_ambiguous 297166 1388 87007 UnstrandedReadsAssigned:13982960 PositiveStrandReadsAssigned:267669 NegativeStrandReadsAssigned:14133313 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671640 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671640-trimmed-pair1.fastq SRR12671640-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,065,160 reads, 14,351,957 reads pseudoaligned [quant] estimated average fragment length: 288.801 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52401 SRR12671640.ke.tsv 34699 SRR12671640.se.tsv 87100 total ==> SRR12671640.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1730.2 408 12.4148 Potri.005G024800.1.v4.1 1035 747.199 407 28.6769 Potri.004G059700.1.v4.1 961 673.356 0 0 Potri.007G009000.2.v4.1 1416 1128.2 0 0 Potri.003G141000.2.v4.1 2943 2655.2 793.594 15.7353 Potri.016G087400.1.v4.1 270 68.5291 638 490.14 Potri.015G069301.1.v4.1 564 291.205 0 0 Potri.010G195200.1.v4.1 1773 1485.2 67 2.37501 Potri.012G127500.1.v4.1 977 689.273 70 5.34665 ==> SRR12671640.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 133 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 291 Potri.001G212900.v4.1 26 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671640 completed mapping pipeline successfully