Starting /dee2/code/volunteer_pipeline.sh SRR12671641 current disk space = 3052145508352 free memory = 1462498700 SRR12671641 SRAfilesize e456e2511a60c22272cf14dff053c2f2 SRR12671641.sra SRR12671641.sra file validated SRR12671641 is paired end SRR12671641 is conventional basespace SRR12671641 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671641_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2665 37.0 37.0 37.0 37.0 37.0 2 36.24025 37.0 37.0 37.0 37.0 37.0 3 36.43 37.0 37.0 37.0 37.0 37.0 4 36.4595 37.0 37.0 37.0 37.0 37.0 5 36.54 37.0 37.0 37.0 37.0 37.0 6 36.5055 37.0 37.0 37.0 37.0 37.0 7 36.4955 37.0 37.0 37.0 37.0 37.0 8 36.549 37.0 37.0 37.0 37.0 37.0 9 36.4555 37.0 37.0 37.0 37.0 37.0 10-14 36.5307 37.0 37.0 37.0 37.0 37.0 15-19 36.4779 37.0 37.0 37.0 37.0 37.0 20-24 36.4977 37.0 37.0 37.0 37.0 37.0 25-29 36.5059 37.0 37.0 37.0 37.0 37.0 30-34 36.4328 37.0 37.0 37.0 37.0 37.0 35-39 36.412699999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.3979 37.0 37.0 37.0 37.0 37.0 45-49 36.363800000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.3378 37.0 37.0 37.0 37.0 37.0 55-59 36.321799999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.3861 37.0 37.0 37.0 37.0 37.0 65-69 36.3351 37.0 37.0 37.0 37.0 37.0 70-74 36.3107 37.0 37.0 37.0 37.0 37.0 75-79 36.25449999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.2984 37.0 37.0 37.0 37.0 37.0 85-89 36.2389 37.0 37.0 37.0 37.0 37.0 90-94 36.2014 37.0 37.0 37.0 37.0 37.0 95-99 36.176300000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.168 37.0 37.0 37.0 37.0 37.0 105-109 36.1286 37.0 37.0 37.0 37.0 37.0 110-114 36.115700000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.154700000000005 37.0 37.0 37.0 37.0 37.0 120-124 36.08370000000001 37.0 37.0 37.0 37.0 37.0 125-129 36.007600000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.9371 37.0 37.0 37.0 37.0 37.0 135-139 35.9644 37.0 37.0 37.0 37.0 37.0 140-144 35.85339999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.8028 37.0 37.0 37.0 37.0 37.0 150-151 35.383 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 2.0 25 2.0 26 3.0 27 4.0 28 11.0 29 13.0 30 23.0 31 34.0 32 55.0 33 77.0 34 134.0 35 369.0 36 2912.0 37 359.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.75 17.974999999999998 8.924999999999999 39.35 2 19.44931163954944 22.177722152690862 40.67584480600751 17.69712140175219 3 16.825000000000003 28.799999999999997 28.925 25.45 4 20.974999999999998 35.025 22.875 21.125 5 20.200000000000003 38.574999999999996 23.9 17.325 6 18.175 36.425000000000004 23.974999999999998 21.425 7 12.9 21.775 45.25 20.075000000000003 8 16.875 23.225 30.45 29.45 9 17.8 22.25 31.474999999999998 28.475 10-14 19.56 29.03 27.400000000000002 24.01 15-19 19.650000000000002 28.610000000000003 27.73 24.01 20-24 19.57 29.42 27.37 23.64 25-29 19.56 28.405 27.794999999999998 24.240000000000002 30-34 19.53 29.185 27.855 23.43 35-39 19.79 28.555000000000003 27.505000000000003 24.15 40-44 20.445 28.810000000000002 27.634999999999998 23.11 45-49 19.689999999999998 28.499999999999996 27.71 24.099999999999998 50-54 19.71 28.375 28.355000000000004 23.56 55-59 20.115 28.82 27.584999999999997 23.48 60-64 19.925 28.54 27.515 24.02 65-69 19.555 27.76 28.785 23.9 70-74 20.330000000000002 28.575 27.644999999999996 23.45 75-79 19.715 28.27 28.000000000000004 24.015 80-84 20.5 28.58 27.584999999999997 23.335 85-89 20.015 28.785 27.694999999999997 23.505000000000003 90-94 20.66 28.68 27.38 23.28 95-99 20.31 28.43 27.694999999999997 23.565 100-104 19.805 29.235 27.63 23.330000000000002 105-109 20.525 28.89 27.295 23.29 110-114 20.419999999999998 28.015 27.91 23.655 115-119 19.695 28.485 27.875 23.945 120-124 20.79 28.1 27.71 23.400000000000002 125-129 20.669999999999998 28.265 27.32 23.745 130-134 20.89 28.325 27.77 23.015 135-139 20.380000000000003 28.610000000000003 27.415 23.595 140-144 20.595 28.955 27.08 23.369999999999997 145-149 20.669999999999998 28.345 26.97 24.015 150-151 20.825 28.1625 28.1875 22.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 0.0 24 2.5 25 5.0 26 7.5 27 11.0 28 13.0 29 18.0 30 24.0 31 27.0 32 36.5 33 48.0 34 63.5 35 77.0 36 96.0 37 130.0 38 157.0 39 177.5 40 202.0 41 229.0 42 245.0 43 248.0 44 262.5 45 259.5 46 246.5 47 229.0 48 201.5 49 183.5 50 161.0 51 147.0 52 111.5 53 77.5 54 67.5 55 59.5 56 49.0 57 30.0 58 20.0 59 20.0 60 15.5 61 10.5 62 8.5 63 5.0 64 2.5 65 1.0 66 1.5 67 2.5 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.26751592356688 88.8 2 5.360934182590234 10.100000000000001 3 0.3450106157112527 0.975 4 0.0 0.0 5 0.02653927813163482 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.6000000000000001 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.9375 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.675 0.0 0.0 0.0 0.0 124-125 1.775 0.0 0.0 0.0 0.0 126-127 1.9375 0.0 0.0 0.0 0.0 128-129 2.1500000000000004 0.0 0.0 0.0 0.0 130-131 2.425 0.0 0.0 0.0 0.0 132-133 2.775 0.0 0.0 0.0 0.0 134-135 2.9625000000000004 0.0 0.0 0.0 0.0 136-137 3.1875 0.0 0.0 0.0 0.0 138-139 3.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671641 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671641_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.23 37.0 37.0 37.0 37.0 37.0 2 35.9905 37.0 37.0 37.0 37.0 37.0 3 36.1655 37.0 37.0 37.0 37.0 37.0 4 36.0205 37.0 37.0 37.0 37.0 37.0 5 36.1805 37.0 37.0 37.0 37.0 37.0 6 36.1775 37.0 37.0 37.0 37.0 37.0 7 36.2905 37.0 37.0 37.0 37.0 37.0 8 36.188 37.0 37.0 37.0 37.0 37.0 9 36.257 37.0 37.0 37.0 37.0 37.0 10-14 36.2251 37.0 37.0 37.0 37.0 37.0 15-19 36.205400000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.2279 37.0 37.0 37.0 37.0 37.0 25-29 36.1295 37.0 37.0 37.0 37.0 37.0 30-34 36.1008 37.0 37.0 37.0 37.0 37.0 35-39 36.1132 37.0 37.0 37.0 37.0 37.0 40-44 36.0973 37.0 37.0 37.0 37.0 37.0 45-49 35.9766 37.0 37.0 37.0 37.0 37.0 50-54 36.00070000000001 37.0 37.0 37.0 37.0 37.0 55-59 35.988600000000005 37.0 37.0 37.0 37.0 37.0 60-64 35.9066 37.0 37.0 37.0 37.0 37.0 65-69 35.9294 37.0 37.0 37.0 37.0 37.0 70-74 35.9036 37.0 37.0 37.0 37.0 37.0 75-79 35.7711 37.0 37.0 37.0 37.0 37.0 80-84 35.8044 37.0 37.0 37.0 37.0 37.0 85-89 35.7536 37.0 37.0 37.0 37.0 37.0 90-94 35.77120000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.8621 37.0 37.0 37.0 37.0 37.0 100-104 35.728699999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.73010000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.661899999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.6349 37.0 37.0 37.0 37.0 37.0 120-124 35.685 37.0 37.0 37.0 37.0 37.0 125-129 35.5037 37.0 37.0 37.0 37.0 37.0 130-134 35.5894 37.0 37.0 37.0 37.0 37.0 135-139 35.5835 37.0 37.0 37.0 37.0 37.0 140-144 35.3175 37.0 37.0 37.0 37.0 37.0 145-149 35.3596 37.0 37.0 37.0 34.6 37.0 150-151 35.015 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 1.0 15 0.0 16 1.0 17 0.0 18 0.0 19 1.0 20 0.0 21 2.0 22 4.0 23 8.0 24 7.0 25 11.0 26 5.0 27 16.0 28 17.0 29 14.0 30 30.0 31 51.0 32 66.0 33 135.0 34 190.0 35 577.0 36 2643.0 37 219.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.625 19.0 13.0 30.375000000000004 2 24.349999999999998 24.725 35.425000000000004 15.5 3 18.875 27.625 33.074999999999996 20.424999999999997 4 22.45 35.125 22.650000000000002 19.775000000000002 5 22.1 37.45 21.475 18.975 6 17.45 38.425 24.7 19.425 7 17.599999999999998 17.2 43.8 21.4 8 19.075 23.225 27.800000000000004 29.9 9 21.25 24.349999999999998 29.275000000000002 25.124999999999996 10-14 22.29 28.58 27.435 21.695 15-19 22.005 27.884999999999998 28.645 21.465 20-24 22.2 28.78 28.139999999999997 20.880000000000003 25-29 22.63 28.13 27.889999999999997 21.349999999999998 30-34 22.405 27.975 28.494999999999997 21.125 35-39 22.994999999999997 28.384999999999998 27.685 20.935000000000002 40-44 22.564999999999998 28.46 27.944999999999997 21.029999999999998 45-49 22.264999999999997 28.24 28.105000000000004 21.39 50-54 22.79 27.54 28.115000000000002 21.555 55-59 22.81 27.284999999999997 28.205000000000002 21.7 60-64 22.945 27.33 28.82 20.905 65-69 22.96 27.87 27.52 21.65 70-74 22.63 29.095 27.145000000000003 21.13 75-79 22.915 28.395 27.43 21.26 80-84 23.68 28.015 27.13 21.175 85-89 23.355 27.715 28.15 20.78 90-94 23.369999999999997 28.115000000000002 27.61 20.905 95-99 23.32 27.935 27.534999999999997 21.21 100-104 23.815 28.54 27.134999999999998 20.51 105-109 23.52 28.07 27.775 20.635 110-114 23.835 27.6 27.750000000000004 20.815 115-119 23.46 27.994999999999997 27.38 21.165 120-124 22.86 27.76 27.994999999999997 21.385 125-129 23.715 27.93 27.785 20.57 130-134 24.0 27.744999999999997 27.73 20.525 135-139 24.345 27.49 28.449999999999996 19.715 140-144 24.135 28.625 27.175 20.064999999999998 145-149 24.265 28.65 26.875 20.21 150-151 24.6125 28.262500000000003 26.650000000000002 20.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.5 13 0.5 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 2.5 20 2.5 21 0.5 22 3.0 23 4.0 24 2.0 25 1.5 26 1.5 27 2.5 28 7.0 29 14.5 30 20.0 31 20.5 32 29.5 33 43.0 34 57.0 35 71.5 36 85.0 37 113.0 38 149.0 39 168.5 40 210.0 41 233.5 42 238.5 43 276.0 44 266.5 45 260.0 46 266.5 47 240.0 48 209.5 49 182.5 50 152.5 51 124.0 52 109.5 53 100.5 54 80.0 55 59.5 56 42.0 57 29.0 58 28.0 59 22.0 60 17.5 61 13.0 62 9.0 63 7.0 64 4.5 65 3.0 66 2.0 67 1.0 68 0.5 69 1.0 70 1.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.975 #Duplication Level Percentage of deduplicated Percentage of total 1 94.2803937217345 88.6 2 5.240755520085129 9.85 3 0.37243947858473 1.05 4 0.053205639797818574 0.2 5 0.0 0.0 6 0.053205639797818574 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 6 0.15 No Hit ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0125 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.2875 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.6000000000000001 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.9375 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.3125 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 1.7999999999999998 0.0 0.0 0.0 0.0 126-127 1.9625 0.0 0.0 0.0 0.0 128-129 2.175 0.0 0.0 0.0 0.0 130-131 2.425 0.0 0.0 0.0 0.0 132-133 2.775 0.0 0.0 0.0 0.0 134-135 2.9625000000000004 0.0 0.0 0.0 0.0 136-137 3.1875 0.0 0.0 0.0 0.0 138-139 3.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 785364 spots for SRR12671641.sra Written 785364 spots for SRR12671641.sra Read 785364 spots for SRR12671641.sra Written 785364 spots for SRR12671641.sra Read 785364 spots for SRR12671641.sra Written 785364 spots for SRR12671641.sra Read 785364 spots for SRR12671641.sra Written 785364 spots for SRR12671641.sra Read 785364 spots for SRR12671641.sra Written 785364 spots for SRR12671641.sra Read 785364 spots for SRR12671641.sra Written 785364 spots for SRR12671641.sra Read 785364 spots for SRR12671641.sra Written 785364 spots for SRR12671641.sra Read 785364 spots for SRR12671641.sra Written 785364 spots for SRR12671641.sra Read 785364 spots for SRR12671641.sra Written 785364 spots for SRR12671641.sra Read 785364 spots for SRR12671641.sra Written 785364 spots for SRR12671641.sra Read 785364 spots for SRR12671641.sra Written 785364 spots for SRR12671641.sra Read 785364 spots for SRR12671641.sra Written 785364 spots for SRR12671641.sra Read 785364 spots for SRR12671641.sra Written 785364 spots for SRR12671641.sra Read 785364 spots for SRR12671641.sra Written 785364 spots for SRR12671641.sra Read 785364 spots for SRR12671641.sra Written 785364 spots for SRR12671641.sra Read 785372 spots for SRR12671641.sra Written 785372 spots for SRR12671641.sra Read 785364 spots for SRR12671641.sra Written 785364 spots for SRR12671641.sra Read 785364 spots for SRR12671641.sra Written 785364 spots for SRR12671641.sra Read 785364 spots for SRR12671641.sra Written 785364 spots for SRR12671641.sra Read 785364 spots for SRR12671641.sra Written 785364 spots for SRR12671641.sra SRR ids: ['SRR12671641.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__36e2jz5 SRR12671641.sra spots: 15707288 blocks: [[1, 785364], [785365, 1570728], [1570729, 2356092], [2356093, 3141456], [3141457, 3926820], [3926821, 4712184], [4712185, 5497548], [5497549, 6282912], [6282913, 7068276], [7068277, 7853640], [7853641, 8639004], [8639005, 9424368], [9424369, 10209732], [10209733, 10995096], [10995097, 11780460], [11780461, 12565824], [12565825, 13351188], [13351189, 14136552], [14136553, 14921916], [14921917, 15707288]] SRR12671641 file size 5316323 SRR12671641 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671641 SRR12671641_1.fastq SRR12671641_2.fastq Input file: SRR12671641_1.fastq Paired file: SRR12671641_2.fastq trimmed: SRR12671641-trimmed-pair1.fastq, SRR12671641-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:36:43 2025 >> started Tue Feb 11 23:37:01 2025 >> done (18.258s) 15707288 read pairs processed; of these: 20 ( 0.00%) short read pairs filtered out after trimming by size control 715 ( 0.00%) empty read pairs filtered out after trimming by size control 15706553 (100.00%) read pairs available; of these: 1038917 ( 6.61%) trimmed read pairs available after processing 14667636 (93.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 4 0.00% 21 1 0.00% 22 2 0.00% 23 4 0.00% 24 2 0.00% 25 1 0.00% 26 4 0.00% 27 7 0.00% 28 6 0.00% 29 4 0.00% 30 5 0.00% 31 5 0.00% 32 7 0.00% 33 10 0.00% 34 11 0.00% 35 8 0.00% 36 7 0.00% 37 10 0.00% 38 11 0.00% 39 15 0.00% 40 21 0.00% 41 19 0.00% 42 21 0.00% 43 17 0.00% 44 24 0.00% 45 20 0.00% 46 19 0.00% 47 32 0.00% 48 33 0.00% 49 25 0.00% 50 37 0.00% 51 45 0.00% 52 60 0.00% 53 63 0.00% 54 68 0.00% 55 63 0.00% 56 66 0.00% 57 67 0.00% 58 68 0.00% 59 70 0.00% 60 100 0.00% 61 113 0.00% 62 122 0.00% 63 146 0.00% 64 182 0.00% 65 184 0.00% 66 168 0.00% 67 170 0.00% 68 215 0.00% 69 224 0.00% 70 298 0.00% 71 323 0.00% 72 387 0.00% 73 454 0.00% 74 514 0.00% 75 564 0.00% 76 556 0.00% 77 660 0.00% 78 664 0.00% 79 705 0.00% 80 838 0.01% 81 1023 0.01% 82 1125 0.01% 83 1314 0.01% 84 1418 0.01% 85 1531 0.01% 86 1648 0.01% 87 1844 0.01% 88 1944 0.01% 89 2214 0.01% 90 2418 0.02% 91 2630 0.02% 92 3069 0.02% 93 3370 0.02% 94 3747 0.02% 95 3906 0.02% 96 4204 0.03% 97 4446 0.03% 98 4632 0.03% 99 4930 0.03% 100 5206 0.03% 101 5845 0.04% 102 6336 0.04% 103 6778 0.04% 104 7461 0.05% 105 7870 0.05% 106 8276 0.05% 107 8451 0.05% 108 8854 0.06% 109 9319 0.06% 110 9694 0.06% 111 10099 0.06% 112 10863 0.07% 113 11451 0.07% 114 12210 0.08% 115 12987 0.08% 116 13494 0.09% 117 13819 0.09% 118 14335 0.09% 119 14501 0.09% 120 15027 0.10% 121 15895 0.10% 122 16233 0.10% 123 17383 0.11% 124 18162 0.12% 125 19173 0.12% 126 19529 0.12% 127 20094 0.13% 128 20501 0.13% 129 21103 0.13% 130 21203 0.13% 131 21627 0.14% 132 22642 0.14% 133 23419 0.15% 134 24515 0.16% 135 25598 0.16% 136 26013 0.17% 137 26888 0.17% 138 27321 0.17% 139 27899 0.18% 140 27625 0.18% 141 28547 0.18% 142 29210 0.19% 143 30635 0.20% 144 31754 0.20% 145 32376 0.21% 146 33542 0.21% 147 33989 0.22% 148 34580 0.22% 149 34115 0.22% 150 34506 0.22% 151 14667636 93.39% 15706553 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=31 prefix-density=0.34 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=201.27 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=9.8 sequence=TCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGATATAGCTAGGGACACATCAAGTTCTGGGACGACTTAGACACCTTTCGGCTTGGCGGCAATAAAGCTGATGCACTGCACTTGACG criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=35 prefix-density=0.42 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=47.15 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=14.0 sequence=TGATGTTGTTGCTG SRR12671641 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:37:45 Started mapping on | Feb 11 23:37:45 Finished on | Feb 11 23:39:46 Mapping speed, Million of reads per hour | 467.30 Number of input reads | 15706553 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 14509649 Uniquely mapped reads % | 92.38% Average mapped length | 297.70 Number of splices: Total | 14604867 Number of splices: Annotated (sjdb) | 14278143 Number of splices: GT/AG | 14322527 Number of splices: GC/AG | 222995 Number of splices: AT/AC | 9227 Number of splices: Non-canonical | 50118 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 373586 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 77071 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.62% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 823318 823318 823318 N_multimapping 373586 373586 373586 N_noFeature 581805 14296248 647941 N_ambiguous 245100 1066 97338 UnstrandedReadsAssigned:13682744 PositiveStrandReadsAssigned:212335 NegativeStrandReadsAssigned:13764370 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671641 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671641-trimmed-pair1.fastq SRR12671641-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,706,553 reads, 13,745,951 reads pseudoaligned [quant] estimated average fragment length: 293.326 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,080 rounds 52401 SRR12671641.ke.tsv 34699 SRR12671641.se.tsv 87100 total ==> SRR12671641.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1725.67 931 37.1514 Potri.005G024800.1.v4.1 1035 742.674 560 51.9247 Potri.004G059700.1.v4.1 961 669.139 0 0 Potri.007G009000.2.v4.1 1416 1123.67 0 0 Potri.003G141000.2.v4.1 2943 2650.67 972.885 25.2749 Potri.016G087400.1.v4.1 270 78.7991 876 765.539 Potri.015G069301.1.v4.1 564 298.554 0 0 Potri.010G195200.1.v4.1 1773 1480.67 408 18.9751 Potri.012G127500.1.v4.1 977 684.899 104 10.4566 ==> SRR12671641.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 161 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 160 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR12671641 completed mapping pipeline successfully