Starting /dee2/code/volunteer_pipeline.sh SRR12671642 current disk space = 3051409522688 free memory = 1580088088 SRR12671642 SRAfilesize 6474be2bc977d1a80394249d7f0e2597 SRR12671642.sra SRR12671642.sra file validated SRR12671642 is paired end SRR12671642 is conventional basespace SRR12671642 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671642_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2335 37.0 37.0 37.0 37.0 37.0 2 36.126 37.0 37.0 37.0 37.0 37.0 3 36.4835 37.0 37.0 37.0 37.0 37.0 4 36.4685 37.0 37.0 37.0 37.0 37.0 5 36.4575 37.0 37.0 37.0 37.0 37.0 6 36.497 37.0 37.0 37.0 37.0 37.0 7 36.565 37.0 37.0 37.0 37.0 37.0 8 36.5105 37.0 37.0 37.0 37.0 37.0 9 36.498 37.0 37.0 37.0 37.0 37.0 10-14 36.5579 37.0 37.0 37.0 37.0 37.0 15-19 36.514300000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.504599999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.4618 37.0 37.0 37.0 37.0 37.0 30-34 36.4225 37.0 37.0 37.0 37.0 37.0 35-39 36.4443 37.0 37.0 37.0 37.0 37.0 40-44 36.4163 37.0 37.0 37.0 37.0 37.0 45-49 36.3909 37.0 37.0 37.0 37.0 37.0 50-54 36.4015 37.0 37.0 37.0 37.0 37.0 55-59 36.3343 37.0 37.0 37.0 37.0 37.0 60-64 36.3899 37.0 37.0 37.0 37.0 37.0 65-69 36.302099999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.298 37.0 37.0 37.0 37.0 37.0 75-79 36.289 37.0 37.0 37.0 37.0 37.0 80-84 36.264799999999994 37.0 37.0 37.0 37.0 37.0 85-89 36.242999999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.2354 37.0 37.0 37.0 37.0 37.0 95-99 36.129599999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.1774 37.0 37.0 37.0 37.0 37.0 105-109 36.0967 37.0 37.0 37.0 37.0 37.0 110-114 36.126799999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.1135 37.0 37.0 37.0 37.0 37.0 120-124 36.0784 37.0 37.0 37.0 37.0 37.0 125-129 36.072500000000005 37.0 37.0 37.0 37.0 37.0 130-134 36.0651 37.0 37.0 37.0 37.0 37.0 135-139 35.9808 37.0 37.0 37.0 37.0 37.0 140-144 35.9114 37.0 37.0 37.0 37.0 37.0 145-149 35.874300000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.3455 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 1.0 25 2.0 26 1.0 27 4.0 28 9.0 29 21.0 30 25.0 31 43.0 32 52.0 33 79.0 34 126.0 35 326.0 36 2949.0 37 360.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.875 15.024999999999999 11.125 40.975 2 20.01005530417295 21.116138763197586 38.738059326294625 20.13574660633484 3 18.4 26.400000000000002 28.299999999999997 26.900000000000002 4 21.925 34.849999999999994 22.575 20.65 5 21.099999999999998 36.075 24.525 18.3 6 17.525 35.025 26.450000000000003 21.0 7 13.55 22.475 43.974999999999994 20.0 8 17.8 21.85 30.175 30.175 9 17.125 22.825 31.374999999999996 28.675 10-14 19.405 29.365000000000002 26.945000000000004 24.285 15-19 19.575 28.175 28.110000000000003 24.14 20-24 19.655 29.080000000000002 27.305 23.96 25-29 19.88 28.28 28.07 23.77 30-34 19.57 28.265 28.38 23.785 35-39 19.605 28.749999999999996 27.32 24.325 40-44 19.625 28.925 28.115000000000002 23.335 45-49 19.865 28.494999999999997 27.6 24.04 50-54 19.725 28.53 27.62 24.125 55-59 19.759999999999998 28.08 28.199999999999996 23.96 60-64 19.935 28.505000000000003 27.625 23.935000000000002 65-69 20.665 27.91 27.42 24.005000000000003 70-74 19.59 29.304999999999996 27.584999999999997 23.52 75-79 19.88 28.735 27.589999999999996 23.794999999999998 80-84 20.28 28.67 27.495000000000005 23.555 85-89 20.21 28.294999999999998 27.325 24.169999999999998 90-94 19.71 28.794999999999998 27.400000000000002 24.095 95-99 19.744999999999997 28.455000000000002 27.87 23.93 100-104 20.325 28.754999999999995 27.57 23.35 105-109 20.765 27.944999999999997 27.875 23.415 110-114 20.53 28.055000000000003 27.49 23.925 115-119 20.9 28.439999999999998 27.165 23.494999999999997 120-124 19.93 27.99 28.125 23.955000000000002 125-129 20.485 27.97 27.785 23.76 130-134 20.325 28.645 27.205000000000002 23.825 135-139 20.46 28.125 27.439999999999998 23.974999999999998 140-144 20.880000000000003 27.884999999999998 27.095000000000002 24.14 145-149 20.09 28.194999999999997 27.295 24.42 150-151 20.525 28.1625 26.787499999999998 24.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 2.0 17 2.5 18 2.0 19 1.0 20 0.5 21 1.0 22 0.5 23 1.0 24 3.0 25 4.5 26 5.0 27 5.0 28 11.5 29 15.0 30 18.5 31 29.5 32 39.0 33 53.5 34 69.0 35 78.5 36 100.5 37 127.0 38 143.0 39 171.0 40 180.5 41 201.5 42 242.0 43 253.0 44 249.5 45 245.0 46 241.0 47 227.5 48 224.5 49 208.5 50 173.5 51 147.0 52 120.5 53 99.0 54 75.0 55 60.5 56 53.0 57 34.0 58 20.0 59 16.5 60 14.5 61 10.5 62 6.5 63 2.0 64 0.5 65 2.0 66 1.5 67 0.0 68 1.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.5499999999999999 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.575 #Duplication Level Percentage of deduplicated Percentage of total 1 93.7750467539407 87.75 2 5.6104728827144 10.5 3 0.5877638258081752 1.6500000000000001 4 0.02671653753673524 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.6375 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 0.9375 0.0 0.0 0.0 0.0 118-119 1.05 0.0 0.0 0.0 0.0 120-121 1.15 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.5875 0.0 0.0 0.0 0.0 128-129 1.7125 0.0 0.0 0.0 0.0 130-131 1.8375 0.0 0.0 0.0 0.0 132-133 2.0375 0.0 0.0 0.0 0.0 134-135 2.175 0.0 0.0 0.0 0.0 136-137 2.45 0.0 0.0 0.0 0.0 138-139 2.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCATTG 10 0.006830828 145.0 2 CTAAGTA 10 0.006830828 145.0 8 GCATTGT 10 0.006830828 145.0 3 >>END_MODULE SRR12671642 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671642_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.174 37.0 37.0 37.0 37.0 37.0 2 36.0335 37.0 37.0 37.0 37.0 37.0 3 36.0555 37.0 37.0 37.0 37.0 37.0 4 36.1115 37.0 37.0 37.0 37.0 37.0 5 36.2985 37.0 37.0 37.0 37.0 37.0 6 36.193 37.0 37.0 37.0 37.0 37.0 7 36.19 37.0 37.0 37.0 37.0 37.0 8 36.2585 37.0 37.0 37.0 37.0 37.0 9 36.2865 37.0 37.0 37.0 37.0 37.0 10-14 36.238099999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.2199 37.0 37.0 37.0 37.0 37.0 20-24 36.182599999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.178000000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.1486 37.0 37.0 37.0 37.0 37.0 35-39 36.0622 37.0 37.0 37.0 37.0 37.0 40-44 36.0943 37.0 37.0 37.0 37.0 37.0 45-49 36.049400000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.041399999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.0082 37.0 37.0 37.0 37.0 37.0 60-64 35.958000000000006 37.0 37.0 37.0 37.0 37.0 65-69 35.9108 37.0 37.0 37.0 37.0 37.0 70-74 35.900999999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.8562 37.0 37.0 37.0 37.0 37.0 80-84 35.8712 37.0 37.0 37.0 37.0 37.0 85-89 35.834599999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.7185 37.0 37.0 37.0 37.0 37.0 95-99 35.7802 37.0 37.0 37.0 37.0 37.0 100-104 35.754599999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.688300000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.627100000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.6393 37.0 37.0 37.0 37.0 37.0 120-124 35.604 37.0 37.0 37.0 37.0 37.0 125-129 35.54279999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.538599999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.5126 37.0 37.0 37.0 37.0 37.0 140-144 35.2517 37.0 37.0 37.0 29.8 37.0 145-149 35.442899999999995 37.0 37.0 37.0 34.6 37.0 150-151 35.01175 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 2.0 15 1.0 16 2.0 17 0.0 18 1.0 19 1.0 20 1.0 21 1.0 22 1.0 23 5.0 24 2.0 25 8.0 26 14.0 27 11.0 28 17.0 29 23.0 30 34.0 31 45.0 32 66.0 33 117.0 34 186.0 35 608.0 36 2654.0 37 198.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.825 18.125 14.95 31.1 2 27.275 24.6 32.800000000000004 15.325 3 20.974999999999998 27.200000000000003 32.175 19.650000000000002 4 22.5 37.475 22.725 17.299999999999997 5 24.125 36.25 20.599999999999998 19.025 6 18.6 38.1 23.724999999999998 19.575 7 17.974999999999998 17.299999999999997 42.449999999999996 22.275 8 20.275000000000002 23.925 26.400000000000002 29.4 9 21.8 24.3 29.099999999999998 24.8 10-14 22.475 28.23 27.11 22.185 15-19 22.39 27.810000000000002 28.54 21.26 20-24 22.915 27.855 27.650000000000002 21.58 25-29 22.695 28.02 27.775 21.51 30-34 22.435 28.595 27.534999999999997 21.435000000000002 35-39 22.515 28.12 28.375 20.990000000000002 40-44 22.39 27.85 28.035 21.725 45-49 22.63 27.43 28.24 21.7 50-54 22.53 27.794999999999998 28.205000000000002 21.47 55-59 22.195 27.279999999999998 28.535 21.990000000000002 60-64 23.09 27.955000000000002 27.43 21.525 65-69 23.11 27.58 27.595 21.715 70-74 22.925 27.66 28.08 21.335 75-79 23.565 27.245 28.33 20.86 80-84 23.380000000000003 28.075 27.235 21.310000000000002 85-89 23.47 27.92 27.935 20.674999999999997 90-94 23.705000000000002 27.955000000000002 27.815 20.525 95-99 22.965 28.79 27.38 20.865000000000002 100-104 23.53 27.88 27.455000000000002 21.135 105-109 23.294999999999998 27.655 27.955000000000002 21.095 110-114 23.355 28.04 27.98 20.625 115-119 24.365000000000002 27.755000000000003 27.35 20.53 120-124 23.785 28.249999999999996 27.87 20.095 125-129 23.325000000000003 27.97 27.725 20.979999999999997 130-134 23.485 27.37 28.165000000000003 20.979999999999997 135-139 24.13 27.015 28.34 20.515 140-144 23.98 27.755000000000003 27.49 20.775 145-149 24.085 28.1 27.560000000000002 20.255000000000003 150-151 24.8125 27.1 27.537499999999998 20.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.5 22 2.5 23 2.5 24 3.5 25 5.5 26 4.0 27 3.5 28 8.0 29 16.5 30 17.0 31 19.0 32 32.5 33 45.0 34 56.5 35 58.0 36 70.5 37 101.5 38 136.5 39 168.0 40 190.0 41 205.0 42 230.5 43 258.5 44 271.0 45 263.5 46 260.5 47 245.5 48 239.0 49 217.5 50 166.0 51 144.0 52 113.5 53 87.0 54 74.5 55 67.0 56 60.5 57 45.5 58 31.0 59 24.0 60 15.0 61 10.0 62 9.0 63 5.0 64 3.0 65 2.5 66 1.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.30000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.67631296891747 87.4 2 5.57341907824223 10.4 3 0.669882100750268 1.875 4 0.05359056806002144 0.2 5 0.02679528403001072 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.7124999999999999 0.0 0.0 0.0 0.0 112-113 0.775 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.8875 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.1 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.3625 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.6625 0.0 0.0 0.0 0.0 130-131 1.7999999999999998 0.0 0.0 0.0 0.0 132-133 2.0125 0.0 0.0 0.0 0.0 134-135 2.1500000000000004 0.0 0.0 0.0 0.0 136-137 2.425 0.0 0.0 0.0 0.0 138-139 2.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCACAA 10 0.006830828 145.0 8 TTGCACA 10 0.006830828 145.0 7 CAACGTT 10 0.006830828 145.0 145 >>END_MODULE Read 1101283 spots for SRR12671642.sra Written 1101283 spots for SRR12671642.sra Read 1101283 spots for SRR12671642.sra Written 1101283 spots for SRR12671642.sra Read 1101283 spots for SRR12671642.sra Written 1101283 spots for SRR12671642.sra Read 1101283 spots for SRR12671642.sra Written 1101283 spots for SRR12671642.sra Read 1101283 spots for SRR12671642.sra Written 1101283 spots for SRR12671642.sra Read 1101283 spots for SRR12671642.sra Written 1101283 spots for SRR12671642.sra Read 1101283 spots for SRR12671642.sra Written 1101283 spots for SRR12671642.sra Read 1101283 spots for SRR12671642.sra Written 1101283 spots for SRR12671642.sra Read 1101283 spots for SRR12671642.sra Written 1101283 spots for SRR12671642.sra Read 1101283 spots for SRR12671642.sra Written 1101283 spots for SRR12671642.sra Read 1101283 spots for SRR12671642.sra Written 1101283 spots for SRR12671642.sra Read 1101283 spots for SRR12671642.sra Written 1101283 spots for SRR12671642.sra Read 1101283 spots for SRR12671642.sra Written 1101283 spots for SRR12671642.sra Read 1101283 spots for SRR12671642.sra Written 1101283 spots for SRR12671642.sra Read 1101284 spots for SRR12671642.sra Written 1101284 spots for SRR12671642.sra Read 1101283 spots for SRR12671642.sra Written 1101283 spots for SRR12671642.sra Read 1101283 spots for SRR12671642.sra Written 1101283 spots for SRR12671642.sra Read 1101283 spots for SRR12671642.sra Written 1101283 spots for SRR12671642.sra Read 1101283 spots for SRR12671642.sra Written 1101283 spots for SRR12671642.sra Read 1101283 spots for SRR12671642.sra Written 1101283 spots for SRR12671642.sra SRR ids: ['SRR12671642.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8yd7w_c4 SRR12671642.sra spots: 22025661 blocks: [[1, 1101283], [1101284, 2202566], [2202567, 3303849], [3303850, 4405132], [4405133, 5506415], [5506416, 6607698], [6607699, 7708981], [7708982, 8810264], [8810265, 9911547], [9911548, 11012830], [11012831, 12114113], [12114114, 13215396], [13215397, 14316679], [14316680, 15417962], [15417963, 16519245], [16519246, 17620528], [17620529, 18721811], [18721812, 19823094], [19823095, 20924377], [20924378, 22025661]] SRR12671642 file size 7463582 SRR12671642 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671642 SRR12671642_1.fastq SRR12671642_2.fastq Input file: SRR12671642_1.fastq Paired file: SRR12671642_2.fastq trimmed: SRR12671642-trimmed-pair1.fastq, SRR12671642-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:30:09 2025 >> started Wed Feb 12 00:30:34 2025 >> done (25.838s) 22025661 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 1630 ( 0.01%) empty read pairs filtered out after trimming by size control 22024004 (99.99%) read pairs available; of these: 1001609 ( 4.55%) trimmed read pairs available after processing 21022395 (95.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 2 0.00% 21 3 0.00% 22 6 0.00% 23 5 0.00% 24 9 0.00% 25 9 0.00% 26 3 0.00% 27 9 0.00% 28 8 0.00% 29 7 0.00% 30 9 0.00% 31 7 0.00% 32 16 0.00% 33 9 0.00% 34 18 0.00% 35 13 0.00% 36 21 0.00% 37 14 0.00% 38 20 0.00% 39 22 0.00% 40 21 0.00% 41 15 0.00% 42 28 0.00% 43 28 0.00% 44 38 0.00% 45 37 0.00% 46 42 0.00% 47 59 0.00% 48 33 0.00% 49 49 0.00% 50 40 0.00% 51 60 0.00% 52 59 0.00% 53 60 0.00% 54 64 0.00% 55 72 0.00% 56 85 0.00% 57 73 0.00% 58 87 0.00% 59 82 0.00% 60 133 0.00% 61 140 0.00% 62 150 0.00% 63 170 0.00% 64 191 0.00% 65 217 0.00% 66 200 0.00% 67 210 0.00% 68 267 0.00% 69 295 0.00% 70 300 0.00% 71 377 0.00% 72 387 0.00% 73 483 0.00% 74 569 0.00% 75 626 0.00% 76 629 0.00% 77 682 0.00% 78 743 0.00% 79 838 0.00% 80 896 0.00% 81 1086 0.00% 82 1311 0.01% 83 1399 0.01% 84 1596 0.01% 85 1740 0.01% 86 1768 0.01% 87 1919 0.01% 88 2061 0.01% 89 2220 0.01% 90 2426 0.01% 91 2705 0.01% 92 3209 0.01% 93 3423 0.02% 94 3828 0.02% 95 3953 0.02% 96 4398 0.02% 97 4334 0.02% 98 4640 0.02% 99 4712 0.02% 100 5246 0.02% 101 5589 0.03% 102 5992 0.03% 103 6529 0.03% 104 6958 0.03% 105 7530 0.03% 106 7772 0.04% 107 7976 0.04% 108 8131 0.04% 109 8573 0.04% 110 8716 0.04% 111 9414 0.04% 112 10095 0.05% 113 10683 0.05% 114 11387 0.05% 115 12062 0.05% 116 12359 0.06% 117 12822 0.06% 118 12949 0.06% 119 13423 0.06% 120 13623 0.06% 121 14494 0.07% 122 14838 0.07% 123 16022 0.07% 124 16854 0.08% 125 17519 0.08% 126 18037 0.08% 127 18936 0.09% 128 19050 0.09% 129 19700 0.09% 130 19853 0.09% 131 20505 0.09% 132 21215 0.10% 133 22523 0.10% 134 23693 0.11% 135 24685 0.11% 136 25432 0.12% 137 25761 0.12% 138 26454 0.12% 139 26929 0.12% 140 26855 0.12% 141 27537 0.13% 142 28723 0.13% 143 29725 0.13% 144 31397 0.14% 145 32552 0.15% 146 33374 0.15% 147 34117 0.15% 148 34988 0.16% 149 34561 0.16% 150 34973 0.16% 151 21022395 95.45% 22024004 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=33 prefix-density=0.50 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=40 fanout-score=187.22 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=14.7 sequence=TCATCTCCAAAAACCCAATAAAAAAGGAAGAGGTAAAGCATTTTGCCAAGGTCTAAGTACAATTTAAACAAACCACCCCTAAGGCCCTAACAGATATAGCTAGGGACACATCAAGTTCTGGGACGACTTAGACACCTTTCGGCTTGGCGGCAATAAAGCTGATGCACTGCACTTGACG criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=24 prefix-density=0.59 prefix-fanout=2.4 sequence=ATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=29.91 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.2 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR12671642 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:31:21 Started mapping on | Feb 12 00:31:21 Finished on | Feb 12 00:33:50 Mapping speed, Million of reads per hour | 532.12 Number of input reads | 22024004 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 20383474 Uniquely mapped reads % | 92.55% Average mapped length | 298.70 Number of splices: Total | 21001415 Number of splices: Annotated (sjdb) | 20592810 Number of splices: GT/AG | 20583538 Number of splices: GC/AG | 344905 Number of splices: AT/AC | 12636 Number of splices: Non-canonical | 60336 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 515487 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 231308 % of reads mapped to too many loci | 1.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.85% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1125043 1125043 1125043 N_multimapping 515487 515487 515487 N_noFeature 755274 20063468 848331 N_ambiguous 366201 1356 138515 UnstrandedReadsAssigned:19261999 PositiveStrandReadsAssigned:318650 NegativeStrandReadsAssigned:19396628 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671642 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671642-trimmed-pair1.fastq SRR12671642-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,024,004 reads, 19,449,890 reads pseudoaligned [quant] estimated average fragment length: 304.835 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52401 SRR12671642.ke.tsv 34699 SRR12671642.se.tsv 87100 total ==> SRR12671642.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1714.16 1029 28.7925 Potri.005G024800.1.v4.1 1035 731.165 381 24.9935 Potri.004G059700.1.v4.1 961 657.743 0 0 Potri.007G009000.2.v4.1 1416 1112.16 0 0 Potri.003G141000.2.v4.1 2943 2639.16 1607.21 29.2095 Potri.016G087400.1.v4.1 270 71.9867 722 481.063 Potri.015G069301.1.v4.1 564 287.609 0 0 Potri.010G195200.1.v4.1 1773 1469.16 134.929 4.40507 Potri.012G127500.1.v4.1 977 673.543 66 4.69998 ==> SRR12671642.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 131 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 276 Potri.001G212900.v4.1 8 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671642 completed mapping pipeline successfully