Starting /dee2/code/volunteer_pipeline.sh SRR12671643 current disk space = 3052081016832 free memory = 1366993064 SRR12671643 SRAfilesize d32cccb011ebd269be4e157b221b802c SRR12671643.sra SRR12671643.sra file validated SRR12671643 is paired end SRR12671643 is conventional basespace SRR12671643 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671643_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5425 37.0 37.0 37.0 37.0 37.0 2 36.20575 37.0 37.0 37.0 37.0 37.0 3 36.5065 37.0 37.0 37.0 37.0 37.0 4 36.6275 37.0 37.0 37.0 37.0 37.0 5 36.594 37.0 37.0 37.0 37.0 37.0 6 36.5055 37.0 37.0 37.0 37.0 37.0 7 36.5615 37.0 37.0 37.0 37.0 37.0 8 36.545 37.0 37.0 37.0 37.0 37.0 9 36.508 37.0 37.0 37.0 37.0 37.0 10-14 36.5346 37.0 37.0 37.0 37.0 37.0 15-19 36.537099999999995 37.0 37.0 37.0 37.0 37.0 20-24 36.537099999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.5225 37.0 37.0 37.0 37.0 37.0 30-34 36.48310000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.4948 37.0 37.0 37.0 37.0 37.0 40-44 36.4363 37.0 37.0 37.0 37.0 37.0 45-49 36.4388 37.0 37.0 37.0 37.0 37.0 50-54 36.4079 37.0 37.0 37.0 37.0 37.0 55-59 36.368 37.0 37.0 37.0 37.0 37.0 60-64 36.383900000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3769 37.0 37.0 37.0 37.0 37.0 70-74 36.3239 37.0 37.0 37.0 37.0 37.0 75-79 36.325 37.0 37.0 37.0 37.0 37.0 80-84 36.3678 37.0 37.0 37.0 37.0 37.0 85-89 36.274100000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.251400000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.1163 37.0 37.0 37.0 37.0 37.0 100-104 36.179 37.0 37.0 37.0 37.0 37.0 105-109 36.1514 37.0 37.0 37.0 37.0 37.0 110-114 36.147 37.0 37.0 37.0 37.0 37.0 115-119 36.1607 37.0 37.0 37.0 37.0 37.0 120-124 36.104 37.0 37.0 37.0 37.0 37.0 125-129 36.0927 37.0 37.0 37.0 37.0 37.0 130-134 36.0317 37.0 37.0 37.0 37.0 37.0 135-139 36.0013 37.0 37.0 37.0 37.0 37.0 140-144 35.9572 37.0 37.0 37.0 37.0 37.0 145-149 35.886900000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.467 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 2.0 26 3.0 27 10.0 28 12.0 29 19.0 30 14.0 31 41.0 32 55.0 33 75.0 34 115.0 35 264.0 36 2991.0 37 398.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.624999999999996 14.025000000000002 10.075000000000001 44.275 2 18.45342706502636 19.13130805925182 40.5222194325885 21.893045443133317 3 18.375 23.3 28.549999999999997 29.775000000000002 4 24.25 31.474999999999998 22.35 21.925 5 21.5 35.65 24.474999999999998 18.375 6 17.974999999999998 35.925000000000004 25.5 20.599999999999998 7 14.649999999999999 19.675 46.375 19.3 8 17.625 22.3 31.574999999999996 28.499999999999996 9 18.2 22.8 33.75 25.25 10-14 19.62 28.749999999999996 27.065 24.565 15-19 20.27 27.675 27.665 24.39 20-24 20.085 27.82 27.689999999999998 24.404999999999998 25-29 20.31 27.91 27.405 24.375 30-34 19.77 28.38 27.955000000000002 23.895 35-39 19.825 27.944999999999997 27.575 24.654999999999998 40-44 20.080000000000002 28.46 27.01 24.45 45-49 20.335 28.27 27.01 24.385 50-54 19.41 27.315 27.77 25.505 55-59 20.11 27.474999999999998 28.275 24.14 60-64 20.255000000000003 27.355 27.915 24.474999999999998 65-69 19.905 28.03 28.13 23.935000000000002 70-74 20.57 28.235 27.245 23.95 75-79 20.74 27.185 28.035 24.04 80-84 20.225 27.77 27.615000000000002 24.39 85-89 20.225 27.675 27.85 24.25 90-94 20.875 27.589999999999996 27.639999999999997 23.895 95-99 20.315 27.83 27.839999999999996 24.015 100-104 20.724999999999998 28.175 27.485 23.615 105-109 20.369999999999997 27.625 27.715 24.29 110-114 20.49 27.400000000000002 27.465 24.645 115-119 20.625 27.93 27.500000000000004 23.945 120-124 20.145 27.794999999999998 27.525 24.535 125-129 20.64 27.700000000000003 27.35 24.310000000000002 130-134 20.549999999999997 27.785 27.51 24.154999999999998 135-139 21.15 28.060000000000002 27.065 23.724999999999998 140-144 21.13 28.035 26.735 24.099999999999998 145-149 21.335 28.084999999999997 27.32 23.26 150-151 20.962500000000002 27.487499999999997 27.787499999999998 23.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 2.0 26 4.5 27 5.5 28 7.5 29 10.0 30 13.0 31 16.5 32 24.0 33 32.5 34 51.0 35 64.0 36 85.0 37 104.0 38 122.0 39 146.5 40 176.0 41 205.0 42 229.0 43 240.5 44 271.0 45 293.5 46 278.0 47 258.0 48 238.0 49 216.5 50 185.5 51 162.5 52 125.0 53 96.5 54 80.5 55 66.5 56 47.5 57 33.0 58 26.5 59 20.5 60 18.5 61 15.5 62 10.5 63 4.5 64 3.5 65 3.0 66 0.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.42500000000000004 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.7 #Duplication Level Percentage of deduplicated Percentage of total 1 93.86339381003201 87.94999999999999 2 5.629669156883671 10.549999999999999 3 0.42689434364994666 1.2 4 0.08004268943436499 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5375000000000001 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.7124999999999999 0.0 0.0 0.0 0.0 112-113 0.7875000000000001 0.0 0.0 0.0 0.0 114-115 0.9125 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.225 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.45 0.0 0.0 0.0 0.0 124-125 1.6875 0.0 0.0 0.0 0.0 126-127 1.925 0.0 0.0 0.0 0.0 128-129 2.1375 0.0 0.0 0.0 0.0 130-131 2.3125 0.0 0.0 0.0 0.0 132-133 2.5125 0.0 0.0 0.0 0.0 134-135 2.675 0.0 0.0 0.0 0.0 136-137 2.8875 0.0 0.0 0.0 0.0 138-139 3.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATTTC 10 0.006830828 145.0 4 ACTTTCC 10 0.006830828 145.0 4 >>END_MODULE SRR12671643 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671643_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1935 37.0 37.0 37.0 37.0 37.0 2 35.8405 37.0 37.0 37.0 37.0 37.0 3 36.048 37.0 37.0 37.0 37.0 37.0 4 36.142 37.0 37.0 37.0 37.0 37.0 5 36.1375 37.0 37.0 37.0 37.0 37.0 6 36.244 37.0 37.0 37.0 37.0 37.0 7 36.0895 37.0 37.0 37.0 37.0 37.0 8 36.186 37.0 37.0 37.0 37.0 37.0 9 36.0955 37.0 37.0 37.0 37.0 37.0 10-14 36.227700000000006 37.0 37.0 37.0 37.0 37.0 15-19 36.1905 37.0 37.0 37.0 37.0 37.0 20-24 36.17059999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.1079 37.0 37.0 37.0 37.0 37.0 30-34 36.0592 37.0 37.0 37.0 37.0 37.0 35-39 36.0939 37.0 37.0 37.0 37.0 37.0 40-44 35.9827 37.0 37.0 37.0 37.0 37.0 45-49 36.0415 37.0 37.0 37.0 37.0 37.0 50-54 36.0326 37.0 37.0 37.0 37.0 37.0 55-59 35.9353 37.0 37.0 37.0 37.0 37.0 60-64 35.8945 37.0 37.0 37.0 37.0 37.0 65-69 35.84179999999999 37.0 37.0 37.0 37.0 37.0 70-74 35.85979999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.72959999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.8276 37.0 37.0 37.0 37.0 37.0 85-89 35.7679 37.0 37.0 37.0 37.0 37.0 90-94 35.744299999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.7336 37.0 37.0 37.0 37.0 37.0 100-104 35.6181 37.0 37.0 37.0 37.0 37.0 105-109 35.649699999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.564099999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.6012 37.0 37.0 37.0 37.0 37.0 120-124 35.56 37.0 37.0 37.0 37.0 37.0 125-129 35.460899999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.5237 37.0 37.0 37.0 37.0 37.0 135-139 35.3882 37.0 37.0 37.0 37.0 37.0 140-144 35.2368 37.0 37.0 37.0 29.8 37.0 145-149 35.3457 37.0 37.0 37.0 32.2 37.0 150-151 34.701499999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 1.0 15 0.0 16 1.0 17 1.0 18 1.0 19 1.0 20 2.0 21 2.0 22 4.0 23 3.0 24 8.0 25 6.0 26 10.0 27 10.0 28 17.0 29 25.0 30 29.0 31 54.0 32 57.0 33 116.0 34 236.0 35 619.0 36 2622.0 37 170.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.525 17.925 14.249999999999998 33.300000000000004 2 24.349999999999998 24.0 35.675000000000004 15.975 3 20.025000000000002 27.725 31.324999999999996 20.925 4 23.525 35.975 21.099999999999998 19.400000000000002 5 25.45 35.199999999999996 21.825 17.525 6 18.2 39.525 22.1 20.175 7 18.65 16.075 42.6 22.675 8 19.075 22.75 29.95 28.225 9 20.5 23.925 29.799999999999997 25.775 10-14 22.905 28.565 26.31 22.220000000000002 15-19 22.48 28.325 27.66 21.535 20-24 22.18 28.22 28.095 21.505 25-29 22.45 28.9 27.384999999999998 21.265 30-34 22.665 28.355000000000004 27.325 21.654999999999998 35-39 22.555 28.59 27.200000000000003 21.654999999999998 40-44 22.2 28.26 27.63 21.91 45-49 22.725 28.249999999999996 27.544999999999998 21.48 50-54 22.5 28.754999999999995 27.145000000000003 21.6 55-59 22.755 27.68 27.675 21.89 60-64 23.205000000000002 28.449999999999996 27.12 21.224999999999998 65-69 22.485 28.084999999999997 27.395000000000003 22.035 70-74 23.27 27.060000000000002 27.435 22.235 75-79 22.97 28.095 27.41 21.525 80-84 23.18 27.925 27.415 21.48 85-89 23.64 27.375 27.35 21.634999999999998 90-94 23.16 27.79 27.6 21.45 95-99 23.72 26.97 28.02 21.29 100-104 24.005000000000003 27.51 27.095000000000002 21.39 105-109 23.455000000000002 27.944999999999997 26.884999999999998 21.715 110-114 23.625 27.98 27.29 21.105 115-119 23.72 27.775 27.455000000000002 21.05 120-124 23.735 28.165000000000003 26.950000000000003 21.15 125-129 24.005000000000003 28.1 26.674999999999997 21.22 130-134 24.07 28.050000000000004 26.445 21.435000000000002 135-139 23.885 28.215 27.255000000000003 20.645 140-144 23.865 26.965 28.07 21.099999999999998 145-149 24.245 27.634999999999998 27.145000000000003 20.974999999999998 150-151 24.9125 28.249999999999996 26.0375 20.8 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.5 19 1.0 20 1.5 21 1.5 22 1.0 23 2.5 24 3.5 25 2.5 26 2.5 27 4.5 28 7.5 29 10.5 30 13.5 31 16.0 32 27.5 33 36.5 34 41.0 35 70.5 36 89.0 37 97.5 38 124.5 39 154.5 40 194.5 41 215.0 42 227.0 43 238.0 44 245.5 45 254.0 46 279.5 47 273.0 48 241.0 49 213.0 50 167.5 51 140.5 52 121.0 53 96.5 54 84.0 55 70.5 56 53.0 57 41.5 58 30.5 59 31.0 60 25.0 61 14.5 62 10.0 63 7.0 64 3.5 65 3.0 66 2.0 67 1.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.75 #Duplication Level Percentage of deduplicated Percentage of total 1 93.92 88.05 2 5.680000000000001 10.65 3 0.32 0.8999999999999999 4 0.02666666666666667 0.1 5 0.0 0.0 6 0.05333333333333334 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 6 0.15 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.7124999999999999 0.0 0.0 0.0 0.0 112-113 0.7875000000000001 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.2375 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.45 0.0 0.0 0.0 0.0 124-125 1.6875 0.0 0.0 0.0 0.0 126-127 1.9375 0.0 0.0 0.0 0.0 128-129 2.1625 0.0 0.0 0.0 0.0 130-131 2.3375 0.0 0.0 0.0 0.0 132-133 2.5375 0.0 0.0 0.0 0.0 134-135 2.7 0.0 0.0 0.0 0.0 136-137 2.9125 0.0 0.0 0.0 0.0 138-139 3.2249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GACTCAC 10 0.006830828 145.0 5 CCCCCCC 30 0.0014437955 24.166668 100-104 >>END_MODULE Read 889579 spots for SRR12671643.sra Written 889579 spots for SRR12671643.sra Read 889579 spots for SRR12671643.sra Written 889579 spots for SRR12671643.sra Read 889579 spots for SRR12671643.sra Written 889579 spots for SRR12671643.sra Read 889579 spots for SRR12671643.sra Written 889579 spots for SRR12671643.sra Read 889579 spots for SRR12671643.sra Written 889579 spots for SRR12671643.sra Read 889579 spots for SRR12671643.sra Written 889579 spots for SRR12671643.sra Read 889579 spots for SRR12671643.sra Written 889579 spots for SRR12671643.sra Read 889579 spots for SRR12671643.sra Written 889579 spots for SRR12671643.sra Read 889579 spots for SRR12671643.sra Written 889579 spots for SRR12671643.sra Read 889579 spots for SRR12671643.sra Written 889579 spots for SRR12671643.sra Read 889579 spots for SRR12671643.sra Written 889579 spots for SRR12671643.sra Read 889579 spots for SRR12671643.sra Written 889579 spots for SRR12671643.sra Read 889584 spots for SRR12671643.sra Written 889584 spots for SRR12671643.sra Read 889579 spots for SRR12671643.sra Written 889579 spots for SRR12671643.sra Read 889579 spots for SRR12671643.sra Written 889579 spots for SRR12671643.sra Read 889579 spots for SRR12671643.sra Written 889579 spots for SRR12671643.sra Read 889579 spots for SRR12671643.sra Written 889579 spots for SRR12671643.sra Read 889579 spots for SRR12671643.sra Written 889579 spots for SRR12671643.sra Read 889579 spots for SRR12671643.sra Written 889579 spots for SRR12671643.sra Read 889579 spots for SRR12671643.sra Written 889579 spots for SRR12671643.sra SRR ids: ['SRR12671643.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_84ubvedh SRR12671643.sra spots: 17791585 blocks: [[1, 889579], [889580, 1779158], [1779159, 2668737], [2668738, 3558316], [3558317, 4447895], [4447896, 5337474], [5337475, 6227053], [6227054, 7116632], [7116633, 8006211], [8006212, 8895790], [8895791, 9785369], [9785370, 10674948], [10674949, 11564527], [11564528, 12454106], [12454107, 13343685], [13343686, 14233264], [14233265, 15122843], [15122844, 16012422], [16012423, 16902001], [16902002, 17791585]] SRR12671643 file size 6024658 SRR12671643 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671643 SRR12671643_1.fastq SRR12671643_2.fastq Input file: SRR12671643_1.fastq Paired file: SRR12671643_2.fastq trimmed: SRR12671643-trimmed-pair1.fastq, SRR12671643-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:47:20 2025 >> started Tue Feb 11 23:47:39 2025 >> done (19.057s) 17791585 read pairs processed; of these: 8 ( 0.00%) short read pairs filtered out after trimming by size control 1470 ( 0.01%) empty read pairs filtered out after trimming by size control 17790107 (99.99%) read pairs available; of these: 930531 ( 5.23%) trimmed read pairs available after processing 16859576 (94.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 2 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 3 0.00% 25 4 0.00% 26 5 0.00% 27 3 0.00% 28 2 0.00% 29 2 0.00% 30 3 0.00% 31 4 0.00% 32 8 0.00% 33 6 0.00% 34 9 0.00% 35 10 0.00% 36 6 0.00% 37 10 0.00% 38 12 0.00% 39 15 0.00% 40 15 0.00% 41 17 0.00% 42 17 0.00% 43 13 0.00% 44 12 0.00% 45 25 0.00% 46 27 0.00% 47 26 0.00% 48 29 0.00% 49 38 0.00% 50 46 0.00% 51 42 0.00% 52 33 0.00% 53 58 0.00% 54 60 0.00% 55 62 0.00% 56 60 0.00% 57 69 0.00% 58 75 0.00% 59 67 0.00% 60 99 0.00% 61 105 0.00% 62 128 0.00% 63 116 0.00% 64 129 0.00% 65 149 0.00% 66 196 0.00% 67 209 0.00% 68 224 0.00% 69 240 0.00% 70 287 0.00% 71 319 0.00% 72 381 0.00% 73 409 0.00% 74 474 0.00% 75 540 0.00% 76 577 0.00% 77 617 0.00% 78 698 0.00% 79 732 0.00% 80 814 0.00% 81 952 0.01% 82 1129 0.01% 83 1171 0.01% 84 1429 0.01% 85 1538 0.01% 86 1698 0.01% 87 1826 0.01% 88 2006 0.01% 89 2229 0.01% 90 2349 0.01% 91 2573 0.01% 92 2847 0.02% 93 3195 0.02% 94 3380 0.02% 95 3737 0.02% 96 3954 0.02% 97 4134 0.02% 98 4604 0.03% 99 4736 0.03% 100 4895 0.03% 101 5354 0.03% 102 5844 0.03% 103 6105 0.03% 104 6402 0.04% 105 6745 0.04% 106 7184 0.04% 107 7373 0.04% 108 7739 0.04% 109 8103 0.05% 110 8487 0.05% 111 8992 0.05% 112 9620 0.05% 113 10106 0.06% 114 10570 0.06% 115 11203 0.06% 116 10998 0.06% 117 11975 0.07% 118 12130 0.07% 119 12846 0.07% 120 13279 0.07% 121 13807 0.08% 122 14397 0.08% 123 15078 0.08% 124 15753 0.09% 125 16364 0.09% 126 16951 0.10% 127 17461 0.10% 128 17593 0.10% 129 18002 0.10% 130 18697 0.11% 131 19174 0.11% 132 20077 0.11% 133 20884 0.12% 134 21666 0.12% 135 22502 0.13% 136 22984 0.13% 137 23466 0.13% 138 24557 0.14% 139 25274 0.14% 140 24958 0.14% 141 25895 0.15% 142 27132 0.15% 143 27760 0.16% 144 29064 0.16% 145 30015 0.17% 146 30804 0.17% 147 30851 0.17% 148 31545 0.18% 149 31510 0.18% 150 32532 0.18% 151 16859576 94.77% 17790107 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=28 prefix-density=0.54 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=26 fanout-score=11.36 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=5.9 sequence=CCATCCACATTAGCACCATATTTGTCGACATATTGGTACAC criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=31 prefix-density=0.79 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.08 sequence-density-rank=28 fanout-score=66.42 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=8.3 sequence=AAAAGAAAAGAAAA SRR12671643 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:48:24 Started mapping on | Feb 11 23:48:24 Finished on | Feb 11 23:50:19 Mapping speed, Million of reads per hour | 556.91 Number of input reads | 17790107 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 16823075 Uniquely mapped reads % | 94.56% Average mapped length | 298.57 Number of splices: Total | 17366049 Number of splices: Annotated (sjdb) | 17025275 Number of splices: GT/AG | 17027635 Number of splices: GC/AG | 287699 Number of splices: AT/AC | 9152 Number of splices: Non-canonical | 41563 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.94 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 402568 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 92351 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.50% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 564464 564464 564464 N_multimapping 402568 402568 402568 N_noFeature 556190 16569629 633184 N_ambiguous 274728 1061 97701 UnstrandedReadsAssigned:15992157 PositiveStrandReadsAssigned:252385 NegativeStrandReadsAssigned:16092190 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671643 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671643-trimmed-pair1.fastq SRR12671643-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,790,107 reads, 16,072,087 reads pseudoaligned [quant] estimated average fragment length: 299.316 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52401 SRR12671643.ke.tsv 34699 SRR12671643.se.tsv 87100 total ==> SRR12671643.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1719.68 511 16.8187 Potri.005G024800.1.v4.1 1035 736.684 256 19.6689 Potri.004G059700.1.v4.1 961 663.07 2 0.170723 Potri.007G009000.2.v4.1 1416 1117.68 0 0 Potri.003G141000.2.v4.1 2943 2644.68 988.003 21.1449 Potri.016G087400.1.v4.1 270 73.7055 556 426.968 Potri.015G069301.1.v4.1 564 290.516 0 0 Potri.010G195200.1.v4.1 1773 1474.68 143 5.48855 Potri.012G127500.1.v4.1 977 678.896 118 9.83784 ==> SRR12671643.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 81 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 202 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12671643 completed mapping pipeline successfully