Starting /dee2/code/volunteer_pipeline.sh SRR12671644 current disk space = 3051928756224 free memory = 1503395248 SRR12671644 SRAfilesize d35798bdf34b3947040f1e7cd77b2226 SRR12671644.sra SRR12671644.sra file validated SRR12671644 is paired end SRR12671644 is conventional basespace SRR12671644 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671644_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5075 37.0 37.0 37.0 37.0 37.0 2 36.23375 37.0 37.0 37.0 37.0 37.0 3 36.5105 37.0 37.0 37.0 37.0 37.0 4 36.611 37.0 37.0 37.0 37.0 37.0 5 36.5475 37.0 37.0 37.0 37.0 37.0 6 36.526 37.0 37.0 37.0 37.0 37.0 7 36.525 37.0 37.0 37.0 37.0 37.0 8 36.482 37.0 37.0 37.0 37.0 37.0 9 36.5505 37.0 37.0 37.0 37.0 37.0 10-14 36.526199999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5169 37.0 37.0 37.0 37.0 37.0 20-24 36.5103 37.0 37.0 37.0 37.0 37.0 25-29 36.4656 37.0 37.0 37.0 37.0 37.0 30-34 36.5019 37.0 37.0 37.0 37.0 37.0 35-39 36.455799999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.43000000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.4244 37.0 37.0 37.0 37.0 37.0 50-54 36.409 37.0 37.0 37.0 37.0 37.0 55-59 36.373200000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.34140000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.3455 37.0 37.0 37.0 37.0 37.0 70-74 36.3168 37.0 37.0 37.0 37.0 37.0 75-79 36.2753 37.0 37.0 37.0 37.0 37.0 80-84 36.2804 37.0 37.0 37.0 37.0 37.0 85-89 36.2961 37.0 37.0 37.0 37.0 37.0 90-94 36.243399999999994 37.0 37.0 37.0 37.0 37.0 95-99 36.160999999999994 37.0 37.0 37.0 37.0 37.0 100-104 36.2213 37.0 37.0 37.0 37.0 37.0 105-109 36.165499999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.1665 37.0 37.0 37.0 37.0 37.0 115-119 36.1359 37.0 37.0 37.0 37.0 37.0 120-124 36.0949 37.0 37.0 37.0 37.0 37.0 125-129 36.0526 37.0 37.0 37.0 37.0 37.0 130-134 36.0454 37.0 37.0 37.0 37.0 37.0 135-139 36.03770000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.9603 37.0 37.0 37.0 37.0 37.0 145-149 35.910399999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.49 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.0 25 0.0 26 3.0 27 9.0 28 16.0 29 17.0 30 26.0 31 46.0 32 48.0 33 63.0 34 109.0 35 284.0 36 2931.0 37 444.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.025 14.05 12.4 45.525 2 18.74529485570891 19.673776662484315 39.94981179422836 21.63111668757842 3 18.575 25.124999999999996 25.8 30.5 4 22.6 32.75 21.8 22.85 5 20.974999999999998 35.6 24.125 19.3 6 17.675 36.5 26.55 19.275000000000002 7 13.525 22.35 44.7 19.425 8 17.575 22.45 30.0 29.975 9 16.425 23.125 34.449999999999996 26.0 10-14 19.36 28.78 27.555000000000003 24.305 15-19 20.085 27.26 28.189999999999998 24.465 20-24 19.56 28.285 27.450000000000003 24.705 25-29 19.43 28.185 27.700000000000003 24.685000000000002 30-34 19.775000000000002 28.32 27.894999999999996 24.01 35-39 20.03 28.02 27.37 24.58 40-44 20.06 28.925 28.000000000000004 23.015 45-49 19.715 27.689999999999998 27.97 24.625 50-54 20.03 28.33 27.634999999999998 24.005000000000003 55-59 20.54 27.83 27.325 24.305 60-64 20.29 27.534999999999997 28.044999999999998 24.13 65-69 20.735 27.6 27.61 24.055 70-74 20.445 27.93 27.250000000000004 24.375 75-79 20.28 28.115000000000002 27.365000000000002 24.240000000000002 80-84 19.825 28.139999999999997 27.62 24.415 85-89 20.51 27.04 27.88 24.57 90-94 19.869999999999997 27.644999999999996 28.165000000000003 24.32 95-99 20.505000000000003 27.83 27.305 24.36 100-104 20.505000000000003 27.58 27.35 24.565 105-109 20.380000000000003 27.955000000000002 28.084999999999997 23.580000000000002 110-114 20.77 26.99 27.750000000000004 24.490000000000002 115-119 20.979999999999997 27.605 26.634999999999998 24.779999999999998 120-124 20.945 27.27 27.534999999999997 24.25 125-129 21.26 28.105000000000004 26.845000000000002 23.79 130-134 21.315 27.589999999999996 27.025 24.07 135-139 21.305 27.595 26.61 24.490000000000002 140-144 21.475 27.48 26.66 24.385 145-149 21.075 27.389999999999997 26.87 24.665 150-151 20.75 27.750000000000004 26.887499999999996 24.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 2.0 23 1.5 24 4.5 25 6.5 26 6.0 27 6.0 28 7.0 29 11.5 30 21.5 31 29.0 32 34.0 33 46.5 34 61.0 35 65.5 36 76.0 37 100.5 38 119.0 39 142.5 40 174.5 41 202.5 42 216.5 43 225.5 44 241.0 45 265.0 46 275.0 47 269.5 48 244.5 49 211.0 50 199.5 51 168.5 52 125.5 53 106.0 54 93.5 55 64.5 56 43.0 57 38.0 58 27.5 59 19.5 60 14.0 61 8.0 62 7.0 63 4.5 64 3.0 65 2.5 66 0.5 67 1.0 68 1.0 69 2.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.375 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 93.81168311549747 87.925 2 5.734862630034677 10.75 3 0.40010669511869834 1.125 4 0.05334755934915977 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.7875 0.0 0.0 0.0 0.0 110-111 0.9375 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.6375000000000002 0.0 0.0 0.0 0.0 120-121 1.8 0.0 0.0 0.0 0.0 122-123 2.0 0.0 0.0 0.0 0.0 124-125 2.3125 0.0 0.0 0.0 0.0 126-127 2.5250000000000004 0.0 0.0 0.0 0.0 128-129 2.8375 0.0 0.0 0.0 0.0 130-131 3.125 0.0 0.0 0.0 0.0 132-133 3.4375 0.0 0.0 0.0 0.0 134-135 3.6875 0.0 0.0 0.0 0.0 136-137 4.2 0.0 0.0 0.0 0.0 138-139 4.512499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTGCT 10 0.006830828 145.0 1 CTCAACT 10 0.006830828 145.0 1 >>END_MODULE SRR12671644 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671644_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3885 37.0 37.0 37.0 37.0 37.0 2 36.248 37.0 37.0 37.0 37.0 37.0 3 36.287 37.0 37.0 37.0 37.0 37.0 4 36.336 37.0 37.0 37.0 37.0 37.0 5 36.4315 37.0 37.0 37.0 37.0 37.0 6 36.334 37.0 37.0 37.0 37.0 37.0 7 36.326 37.0 37.0 37.0 37.0 37.0 8 36.3785 37.0 37.0 37.0 37.0 37.0 9 36.328 37.0 37.0 37.0 37.0 37.0 10-14 36.3846 37.0 37.0 37.0 37.0 37.0 15-19 36.374100000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.3166 37.0 37.0 37.0 37.0 37.0 25-29 36.3001 37.0 37.0 37.0 37.0 37.0 30-34 36.290499999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.2801 37.0 37.0 37.0 37.0 37.0 40-44 36.2409 37.0 37.0 37.0 37.0 37.0 45-49 36.238 37.0 37.0 37.0 37.0 37.0 50-54 36.2128 37.0 37.0 37.0 37.0 37.0 55-59 36.1864 37.0 37.0 37.0 37.0 37.0 60-64 36.1085 37.0 37.0 37.0 37.0 37.0 65-69 36.1177 37.0 37.0 37.0 37.0 37.0 70-74 36.12089999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.045500000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.1532 37.0 37.0 37.0 37.0 37.0 85-89 36.092800000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.0202 37.0 37.0 37.0 37.0 37.0 95-99 36.026700000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.036500000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.9593 37.0 37.0 37.0 37.0 37.0 110-114 35.911699999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.856700000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.909 37.0 37.0 37.0 37.0 37.0 125-129 35.8392 37.0 37.0 37.0 37.0 37.0 130-134 35.796 37.0 37.0 37.0 37.0 37.0 135-139 35.8038 37.0 37.0 37.0 37.0 37.0 140-144 35.5626 37.0 37.0 37.0 37.0 37.0 145-149 35.6364 37.0 37.0 37.0 37.0 37.0 150-151 35.25325 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 2.0 15 0.0 16 0.0 17 1.0 18 0.0 19 0.0 20 3.0 21 1.0 22 0.0 23 1.0 24 2.0 25 7.0 26 9.0 27 11.0 28 9.0 29 16.0 30 31.0 31 27.0 32 36.0 33 94.0 34 163.0 35 409.0 36 2899.0 37 274.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.924999999999997 18.65 15.975 33.45 2 28.15 22.95 34.4 14.499999999999998 3 20.575 27.35 30.125 21.95 4 23.9 35.125 20.925 20.05 5 25.95 38.1 20.025000000000002 15.925 6 20.45 38.0 22.125 19.425 7 18.2 19.375 40.875 21.55 8 22.1 22.900000000000002 27.875 27.125 9 22.125 23.400000000000002 29.125 25.35 10-14 23.36 28.315 26.205000000000002 22.12 15-19 24.15 27.529999999999998 26.505000000000003 21.815 20-24 23.14 28.265 26.745 21.85 25-29 24.07 28.185 26.484999999999996 21.26 30-34 23.77 27.865000000000002 26.810000000000002 21.555 35-39 23.24 27.855 27.055 21.85 40-44 23.79 28.74 26.090000000000003 21.38 45-49 22.795 28.925 26.865 21.415 50-54 23.995 27.565 26.889999999999997 21.55 55-59 23.669999999999998 28.125 26.82 21.385 60-64 24.035 27.395000000000003 27.279999999999998 21.29 65-69 23.94 27.634999999999998 26.76 21.665 70-74 23.525 28.27 26.19 22.015 75-79 23.665 27.889999999999997 26.700000000000003 21.745 80-84 24.095 27.560000000000002 26.14 22.205 85-89 23.71 28.15 26.565 21.575 90-94 24.365000000000002 27.279999999999998 26.96 21.395 95-99 24.195 27.58 26.884999999999998 21.34 100-104 24.455 27.439999999999998 26.995 21.11 105-109 24.605 27.389999999999997 27.405 20.599999999999998 110-114 24.05 28.110000000000003 26.85 20.990000000000002 115-119 24.39 28.17 26.57 20.87 120-124 24.23 27.855 26.855 21.060000000000002 125-129 24.4 27.79 26.715 21.095 130-134 24.575 27.91 26.825 20.69 135-139 25.785000000000004 27.805000000000003 26.27 20.14 140-144 25.235000000000003 27.589999999999996 26.845000000000002 20.330000000000002 145-149 25.75 27.735 26.36 20.155 150-151 26.650000000000002 27.474999999999998 25.937500000000004 19.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 1.0 22 1.0 23 0.5 24 1.0 25 1.0 26 2.0 27 2.5 28 2.0 29 4.0 30 7.5 31 8.0 32 12.0 33 19.0 34 26.5 35 44.0 36 59.0 37 83.0 38 112.5 39 141.0 40 177.5 41 195.5 42 220.5 43 256.0 44 273.5 45 288.5 46 289.5 47 261.5 48 262.5 49 235.5 50 172.5 51 157.0 52 145.5 53 115.0 54 92.0 55 74.5 56 61.0 57 54.5 58 33.5 59 23.0 60 23.0 61 13.0 62 8.5 63 9.5 64 6.5 65 2.5 66 3.0 67 2.5 68 0.0 69 0.5 70 1.5 71 1.0 72 0.0 73 0.5 74 1.0 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.5 #Duplication Level Percentage of deduplicated Percentage of total 1 93.68983957219251 87.6 2 5.721925133689839 10.7 3 0.53475935828877 1.5 4 0.053475935828877004 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.7875 0.0 0.0 0.0 0.0 110-111 0.9375 0.0 0.0 0.0 0.0 112-113 1.1375 0.0 0.0 0.0 0.0 114-115 1.2999999999999998 0.0 0.0 0.0 0.0 116-117 1.5 0.0 0.0 0.0 0.0 118-119 1.6625 0.0 0.0 0.0 0.0 120-121 1.825 0.0 0.0 0.0 0.0 122-123 2.025 0.0 0.0 0.0 0.0 124-125 2.35 0.0 0.0 0.0 0.0 126-127 2.5999999999999996 0.0 0.0 0.0 0.0 128-129 2.8875 0.0 0.0 0.0 0.0 130-131 3.1875 0.0 0.0 0.0 0.0 132-133 3.5125 0.0 0.0 0.0 0.0 134-135 3.7625 0.0 0.0 0.0 0.0 136-137 4.275 0.0 0.0 0.0 0.0 138-139 4.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATGATC 10 0.006830828 145.0 2 CCTCAAA 10 0.006830828 145.0 6 CTCAAAG 10 0.006830828 145.0 7 >>END_MODULE Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra Read 923454 spots for SRR12671644.sra Written 923454 spots for SRR12671644.sra SRR ids: ['SRR12671644.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_an6zuujr SRR12671644.sra spots: 18469080 blocks: [[1, 923454], [923455, 1846908], [1846909, 2770362], [2770363, 3693816], [3693817, 4617270], [4617271, 5540724], [5540725, 6464178], [6464179, 7387632], [7387633, 8311086], [8311087, 9234540], [9234541, 10157994], [10157995, 11081448], [11081449, 12004902], [12004903, 12928356], [12928357, 13851810], [13851811, 14775264], [14775265, 15698718], [15698719, 16622172], [16622173, 17545626], [17545627, 18469080]] SRR12671644 file size 6254901 SRR12671644 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671644 SRR12671644_1.fastq SRR12671644_2.fastq Input file: SRR12671644_1.fastq Paired file: SRR12671644_2.fastq trimmed: SRR12671644-trimmed-pair1.fastq, SRR12671644-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:55:22 2025 >> started Tue Feb 11 23:55:42 2025 >> done (20.458s) 18469080 read pairs processed; of these: 9 ( 0.00%) short read pairs filtered out after trimming by size control 1562 ( 0.01%) empty read pairs filtered out after trimming by size control 18467509 (99.99%) read pairs available; of these: 1258605 ( 6.82%) trimmed read pairs available after processing 17208904 (93.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 0 0.00% 20 1 0.00% 21 2 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 2 0.00% 26 2 0.00% 27 3 0.00% 28 0 0.00% 29 8 0.00% 30 3 0.00% 31 5 0.00% 32 4 0.00% 33 9 0.00% 34 4 0.00% 35 8 0.00% 36 12 0.00% 37 15 0.00% 38 13 0.00% 39 17 0.00% 40 21 0.00% 41 16 0.00% 42 18 0.00% 43 25 0.00% 44 20 0.00% 45 21 0.00% 46 26 0.00% 47 32 0.00% 48 33 0.00% 49 43 0.00% 50 42 0.00% 51 62 0.00% 52 61 0.00% 53 66 0.00% 54 62 0.00% 55 69 0.00% 56 79 0.00% 57 89 0.00% 58 102 0.00% 59 104 0.00% 60 143 0.00% 61 156 0.00% 62 173 0.00% 63 163 0.00% 64 187 0.00% 65 246 0.00% 66 212 0.00% 67 253 0.00% 68 299 0.00% 69 387 0.00% 70 356 0.00% 71 390 0.00% 72 467 0.00% 73 539 0.00% 74 625 0.00% 75 682 0.00% 76 751 0.00% 77 767 0.00% 78 877 0.00% 79 985 0.01% 80 1095 0.01% 81 1217 0.01% 82 1467 0.01% 83 1574 0.01% 84 1808 0.01% 85 1932 0.01% 86 2174 0.01% 87 2368 0.01% 88 2552 0.01% 89 2688 0.01% 90 3094 0.02% 91 3412 0.02% 92 3723 0.02% 93 4020 0.02% 94 4441 0.02% 95 4848 0.03% 96 5147 0.03% 97 5437 0.03% 98 5706 0.03% 99 6232 0.03% 100 6572 0.04% 101 6967 0.04% 102 7503 0.04% 103 7850 0.04% 104 8503 0.05% 105 8941 0.05% 106 9512 0.05% 107 9983 0.05% 108 10390 0.06% 109 10907 0.06% 110 11374 0.06% 111 12122 0.07% 112 12650 0.07% 113 13281 0.07% 114 13793 0.07% 115 14768 0.08% 116 15556 0.08% 117 15978 0.09% 118 16743 0.09% 119 17328 0.09% 120 17845 0.10% 121 18753 0.10% 122 19198 0.10% 123 20785 0.11% 124 21236 0.11% 125 22080 0.12% 126 22953 0.12% 127 23464 0.13% 128 24273 0.13% 129 24896 0.13% 130 25464 0.14% 131 26727 0.14% 132 27365 0.15% 133 29112 0.16% 134 29920 0.16% 135 30587 0.17% 136 31661 0.17% 137 32830 0.18% 138 33109 0.18% 139 33861 0.18% 140 34594 0.19% 141 35276 0.19% 142 36851 0.20% 143 37825 0.20% 144 39491 0.21% 145 39886 0.22% 146 41487 0.22% 147 41618 0.23% 148 42710 0.23% 149 43201 0.23% 150 44129 0.24% 151 17208904 93.18% 18467509 reads passed initial QC criterion=sequence-density sequence-density=0.75 sequence-density-rank=1 fanout-score=3.28 fanout-score-rank=8 prefix-density=0.93 prefix-fanout=2.7 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=115.15 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=3.9 sequence=ATCAAGCTTCCGATTAAAGATACATAATTCCATGGAATGGAACCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTTTAATTTACAGCAAATACTATATTAGACAAACATGGAGTGACCAGACTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=16 prefix-density=0.70 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.17 sequence-density-rank=25 fanout-score=13.21 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=4.0 sequence=CAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12671644 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:56:32 Started mapping on | Feb 11 23:56:32 Finished on | Feb 11 23:58:39 Mapping speed, Million of reads per hour | 523.49 Number of input reads | 18467509 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 17302360 Uniquely mapped reads % | 93.69% Average mapped length | 297.99 Number of splices: Total | 18065461 Number of splices: Annotated (sjdb) | 17773382 Number of splices: GT/AG | 17681555 Number of splices: GC/AG | 331381 Number of splices: AT/AC | 9913 Number of splices: Non-canonical | 42612 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 445337 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 207555 % of reads mapped to too many loci | 1.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.60% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 719812 719812 719812 N_multimapping 445337 445337 445337 N_noFeature 381466 16991053 453659 N_ambiguous 348763 1227 108995 UnstrandedReadsAssigned:16572131 PositiveStrandReadsAssigned:310080 NegativeStrandReadsAssigned:16739706 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671644 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671644-trimmed-pair1.fastq SRR12671644-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,467,509 reads, 16,840,591 reads pseudoaligned [quant] estimated average fragment length: 271.124 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,078 rounds 52401 SRR12671644.ke.tsv 34699 SRR12671644.se.tsv 87100 total ==> SRR12671644.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.88 561 14.6452 Potri.005G024800.1.v4.1 1035 764.876 408 24.3395 Potri.004G059700.1.v4.1 961 691.1 2 0.132048 Potri.007G009000.2.v4.1 1416 1145.88 0 0 Potri.003G141000.2.v4.1 2943 2672.88 664 11.3353 Potri.016G087400.1.v4.1 270 75.5796 1406.81 849.324 Potri.015G069301.1.v4.1 564 307.359 0 0 Potri.010G195200.1.v4.1 1773 1502.88 33.8754 1.0285 Potri.012G127500.1.v4.1 977 707.027 99 6.38913 ==> SRR12671644.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 180 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 397 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 18 SRR12671644 completed mapping pipeline successfully