Starting /dee2/code/volunteer_pipeline.sh SRR12671645 current disk space = 3052078772224 free memory = 1388073272 SRR12671645 SRAfilesize e2cdd759c5b1a472e571f0ecb8b00aa8 SRR12671645.sra SRR12671645.sra file validated SRR12671645 is paired end SRR12671645 is conventional basespace SRR12671645 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671645_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3835 37.0 37.0 37.0 37.0 37.0 2 36.2545 37.0 37.0 37.0 37.0 37.0 3 36.3715 37.0 37.0 37.0 37.0 37.0 4 36.492 37.0 37.0 37.0 37.0 37.0 5 36.559 37.0 37.0 37.0 37.0 37.0 6 36.494 37.0 37.0 37.0 37.0 37.0 7 36.485 37.0 37.0 37.0 37.0 37.0 8 36.481 37.0 37.0 37.0 37.0 37.0 9 36.5275 37.0 37.0 37.0 37.0 37.0 10-14 36.5401 37.0 37.0 37.0 37.0 37.0 15-19 36.5218 37.0 37.0 37.0 37.0 37.0 20-24 36.5015 37.0 37.0 37.0 37.0 37.0 25-29 36.4593 37.0 37.0 37.0 37.0 37.0 30-34 36.406699999999994 37.0 37.0 37.0 37.0 37.0 35-39 36.448699999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.41179999999999 37.0 37.0 37.0 37.0 37.0 45-49 36.3666 37.0 37.0 37.0 37.0 37.0 50-54 36.3463 37.0 37.0 37.0 37.0 37.0 55-59 36.3378 37.0 37.0 37.0 37.0 37.0 60-64 36.32190000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.30499999999999 37.0 37.0 37.0 37.0 37.0 70-74 36.2728 37.0 37.0 37.0 37.0 37.0 75-79 36.230199999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.2394 37.0 37.0 37.0 37.0 37.0 85-89 36.2183 37.0 37.0 37.0 37.0 37.0 90-94 36.2255 37.0 37.0 37.0 37.0 37.0 95-99 36.118700000000004 37.0 37.0 37.0 37.0 37.0 100-104 36.2025 37.0 37.0 37.0 37.0 37.0 105-109 36.1386 37.0 37.0 37.0 37.0 37.0 110-114 36.139799999999994 37.0 37.0 37.0 37.0 37.0 115-119 36.129599999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.9987 37.0 37.0 37.0 37.0 37.0 125-129 36.0244 37.0 37.0 37.0 37.0 37.0 130-134 35.9747 37.0 37.0 37.0 37.0 37.0 135-139 35.950900000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.83 37.0 37.0 37.0 37.0 37.0 145-149 35.78789999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.375 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 2.0 22 0.0 23 3.0 24 1.0 25 0.0 26 7.0 27 10.0 28 14.0 29 19.0 30 26.0 31 30.0 32 54.0 33 69.0 34 117.0 35 321.0 36 2977.0 37 350.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.324999999999996 15.525 10.299999999999999 40.849999999999994 2 20.948319116909182 19.894631209232312 38.33416959357752 20.822880080280985 3 16.125 26.424999999999997 30.225 27.224999999999998 4 20.225 34.5 24.25 21.025 5 20.95 36.525 23.375 19.15 6 17.549999999999997 34.575 25.75 22.125 7 13.850000000000001 21.15 45.625 19.375 8 18.2 21.625 31.225 28.95 9 17.825 21.5 33.925 26.75 10-14 19.765 28.305000000000003 27.650000000000002 24.279999999999998 15-19 19.455 27.755000000000003 28.110000000000003 24.68 20-24 19.805 28.33 27.750000000000004 24.115000000000002 25-29 19.425 28.82 27.365000000000002 24.39 30-34 19.445 28.09 28.410000000000004 24.055 35-39 19.77 27.97 27.82 24.44 40-44 20.36 28.64 27.485 23.515 45-49 19.91 28.58 27.345000000000002 24.165 50-54 20.02 28.32 27.63 24.03 55-59 19.8 28.505000000000003 27.715 23.98 60-64 20.06 27.825 28.050000000000004 24.065 65-69 20.45 28.660000000000004 26.665 24.224999999999998 70-74 20.48 28.685 27.224999999999998 23.61 75-79 20.54 28.03 27.02 24.41 80-84 20.169999999999998 28.095 27.944999999999997 23.79 85-89 20.41 28.244999999999997 27.400000000000002 23.945 90-94 20.580000000000002 28.17 27.355 23.895 95-99 20.585 28.23 27.634999999999998 23.549999999999997 100-104 20.605 27.794999999999998 27.694999999999997 23.905 105-109 20.285 28.03 27.47 24.215 110-114 20.485 27.900000000000002 27.815 23.799999999999997 115-119 21.175 28.439999999999998 27.115000000000002 23.27 120-124 20.979999999999997 27.565 27.67 23.785 125-129 20.8 28.08 27.42 23.7 130-134 21.365000000000002 28.15 26.919999999999998 23.565 135-139 21.205 27.6 27.589999999999996 23.605 140-144 20.974999999999998 28.065 27.63 23.330000000000002 145-149 21.16 27.375 27.73 23.735 150-151 21.2625 28.599999999999998 26.237500000000004 23.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 2.0 22 1.5 23 1.5 24 2.5 25 4.5 26 5.0 27 3.5 28 8.5 29 12.0 30 15.0 31 21.5 32 28.5 33 42.0 34 61.5 35 78.5 36 87.0 37 105.0 38 133.0 39 151.0 40 178.0 41 221.5 42 235.0 43 238.0 44 271.0 45 266.5 46 244.5 47 250.0 48 238.5 49 212.5 50 199.0 51 164.0 52 113.5 53 103.0 54 91.5 55 60.0 56 38.0 57 32.0 58 24.5 59 12.5 60 9.5 61 7.5 62 8.0 63 6.0 64 1.5 65 3.0 66 2.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.35000000000000003 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.35 #Duplication Level Percentage of deduplicated Percentage of total 1 94.51510333863276 89.17500000000001 2 5.0344462109168 9.5 3 0.4239533651298357 1.2 4 0.0 0.0 5 0.026497085320614733 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.48750000000000004 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.95 0.0 0.0 0.0 0.0 126-127 1.125 0.0 0.0 0.0 0.0 128-129 1.3125 0.0 0.0 0.0 0.0 130-131 1.4875 0.0 0.0 0.0 0.0 132-133 1.625 0.0 0.0 0.0 0.0 134-135 1.825 0.0 0.0 0.0 0.0 136-137 2.0 0.0 0.0 0.0 0.0 138-139 2.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAGATC 10 0.006830828 145.0 145 ACAAAAC 10 0.006830828 145.0 2 AAACCAC 10 0.006830828 145.0 5 AGAAGAC 15 1.1411342E-4 145.0 145 CACGCTT 10 0.006830828 145.0 9 ACCACGC 10 0.006830828 145.0 7 CCACGCT 10 0.006830828 145.0 8 CACAAAA 10 0.006830828 145.0 1 AACCACG 10 0.006830828 145.0 6 >>END_MODULE SRR12671645 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671645_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0245 37.0 37.0 37.0 37.0 37.0 2 35.9465 37.0 37.0 37.0 37.0 37.0 3 35.9865 37.0 37.0 37.0 37.0 37.0 4 36.0055 37.0 37.0 37.0 37.0 37.0 5 36.2795 37.0 37.0 37.0 37.0 37.0 6 36.2035 37.0 37.0 37.0 37.0 37.0 7 36.181 37.0 37.0 37.0 37.0 37.0 8 36.297 37.0 37.0 37.0 37.0 37.0 9 36.2205 37.0 37.0 37.0 37.0 37.0 10-14 36.2753 37.0 37.0 37.0 37.0 37.0 15-19 36.2221 37.0 37.0 37.0 37.0 37.0 20-24 36.1883 37.0 37.0 37.0 37.0 37.0 25-29 36.1297 37.0 37.0 37.0 37.0 37.0 30-34 36.096900000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.0585 37.0 37.0 37.0 37.0 37.0 40-44 36.0572 37.0 37.0 37.0 37.0 37.0 45-49 36.0404 37.0 37.0 37.0 37.0 37.0 50-54 35.9935 37.0 37.0 37.0 37.0 37.0 55-59 35.9376 37.0 37.0 37.0 37.0 37.0 60-64 35.907 37.0 37.0 37.0 37.0 37.0 65-69 35.883300000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.9162 37.0 37.0 37.0 37.0 37.0 75-79 35.815999999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.7894 37.0 37.0 37.0 37.0 37.0 85-89 35.735499999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.70399999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.8059 37.0 37.0 37.0 37.0 37.0 100-104 35.7636 37.0 37.0 37.0 37.0 37.0 105-109 35.6609 37.0 37.0 37.0 37.0 37.0 110-114 35.6553 37.0 37.0 37.0 37.0 37.0 115-119 35.588800000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.5515 37.0 37.0 37.0 37.0 37.0 125-129 35.561299999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.5012 37.0 37.0 37.0 37.0 37.0 135-139 35.4536 37.0 37.0 37.0 37.0 37.0 140-144 35.2789 37.0 37.0 37.0 32.2 37.0 145-149 35.4222 37.0 37.0 37.0 34.6 37.0 150-151 34.93675 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 2.0 16 0.0 17 1.0 18 0.0 19 1.0 20 1.0 21 3.0 22 4.0 23 6.0 24 6.0 25 10.0 26 17.0 27 17.0 28 20.0 29 24.0 30 34.0 31 44.0 32 58.0 33 94.0 34 211.0 35 565.0 36 2669.0 37 211.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.85 19.6 13.65 30.9 2 25.900000000000002 23.549999999999997 35.525 15.024999999999999 3 17.8 28.325 33.324999999999996 20.549999999999997 4 21.875 36.0 22.825 19.3 5 22.825 39.875 19.85 17.45 6 17.474999999999998 38.550000000000004 23.325000000000003 20.65 7 18.35 17.150000000000002 42.475 22.025 8 20.45 23.875 26.3 29.375 9 20.8 24.575 28.65 25.974999999999998 10-14 22.535 28.37 26.905 22.189999999999998 15-19 22.91 27.68 27.715 21.695 20-24 22.455 27.725 27.935 21.884999999999998 25-29 22.275 28.03 27.735 21.959999999999997 30-34 22.07 28.59 27.894999999999996 21.445 35-39 21.645 28.4 28.255000000000003 21.7 40-44 22.66 28.315 27.79 21.235 45-49 22.18 28.175 28.01 21.634999999999998 50-54 22.715 27.975 27.62 21.69 55-59 22.634999999999998 26.950000000000003 27.875 22.54 60-64 22.770000000000003 27.644999999999996 27.284999999999997 22.3 65-69 22.745 27.735 27.66 21.86 70-74 23.09 27.639999999999997 27.465 21.805 75-79 22.79 27.92 27.644999999999996 21.645 80-84 23.07 27.52 27.6 21.81 85-89 22.96 27.694999999999997 27.185 22.16 90-94 22.665 27.38 28.050000000000004 21.905 95-99 23.03 27.71 27.565 21.695 100-104 22.919999999999998 27.96 27.395000000000003 21.725 105-109 23.41 27.284999999999997 27.589999999999996 21.715 110-114 23.54 27.665 27.255000000000003 21.54 115-119 23.555 27.38 27.750000000000004 21.315 120-124 23.285 27.12 27.975 21.62 125-129 23.13 28.03 27.605 21.235 130-134 24.41 27.68 27.11 20.8 135-139 23.82 27.744999999999997 27.529999999999998 20.905 140-144 24.68 27.76 26.685 20.875 145-149 23.615 27.98 27.565 20.84 150-151 24.7 27.325 27.200000000000003 20.775 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 2.0 14 2.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 1.5 22 2.0 23 3.0 24 4.5 25 4.5 26 4.0 27 4.5 28 5.5 29 6.0 30 12.5 31 19.0 32 21.5 33 33.0 34 51.5 35 64.5 36 73.5 37 93.0 38 117.0 39 152.5 40 185.5 41 226.5 42 257.0 43 252.5 44 261.0 45 281.5 46 274.5 47 253.0 48 235.5 49 206.5 50 167.5 51 145.5 52 122.5 53 98.0 54 84.0 55 68.5 56 56.0 57 40.5 58 31.5 59 20.5 60 12.5 61 9.0 62 10.0 63 8.5 64 3.0 65 1.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.125 #Duplication Level Percentage of deduplicated Percentage of total 1 94.34262948207171 88.8 2 5.152722443559097 9.700000000000001 3 0.4249667994687915 1.2 4 0.0796812749003984 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.48750000000000004 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.7749999999999999 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.15 0.0 0.0 0.0 0.0 128-129 1.3125 0.0 0.0 0.0 0.0 130-131 1.4875 0.0 0.0 0.0 0.0 132-133 1.625 0.0 0.0 0.0 0.0 134-135 1.825 0.0 0.0 0.0 0.0 136-137 2.0 0.0 0.0 0.0 0.0 138-139 2.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGGAC 10 0.006830828 145.0 5 CCCATGT 10 0.006830828 145.0 9 AACTTTG 10 0.006830828 145.0 2 ACTTTGC 10 0.006830828 145.0 3 TTTGCCC 10 0.006830828 145.0 5 TTGCCCA 10 0.006830828 145.0 6 >>END_MODULE Read 758484 spots for SRR12671645.sra Written 758484 spots for SRR12671645.sra Read 758484 spots for SRR12671645.sra Written 758484 spots for SRR12671645.sra Read 758484 spots for SRR12671645.sra Written 758484 spots for SRR12671645.sra Read 758484 spots for SRR12671645.sra Written 758484 spots for SRR12671645.sra Read 758484 spots for SRR12671645.sra Written 758484 spots for SRR12671645.sra Read 758484 spots for SRR12671645.sra Written 758484 spots for SRR12671645.sra Read 758484 spots for SRR12671645.sra Written 758484 spots for SRR12671645.sra Read 758484 spots for SRR12671645.sra Written 758484 spots for SRR12671645.sra Read 758484 spots for SRR12671645.sra Written 758484 spots for SRR12671645.sra Read 758484 spots for SRR12671645.sra Written 758484 spots for SRR12671645.sra Read 758484 spots for SRR12671645.sra Written 758484 spots for SRR12671645.sra Read 758484 spots for SRR12671645.sra Written 758484 spots for SRR12671645.sra Read 758484 spots for SRR12671645.sra Written 758484 spots for SRR12671645.sra Read 758484 spots for SRR12671645.sra Written 758484 spots for SRR12671645.sra Read 758484 spots for SRR12671645.sra Written 758484 spots for SRR12671645.sra Read 758493 spots for SRR12671645.sra Written 758493 spots for SRR12671645.sra Read 758484 spots for SRR12671645.sra Written 758484 spots for SRR12671645.sra Read 758484 spots for SRR12671645.sra Written 758484 spots for SRR12671645.sra Read 758484 spots for SRR12671645.sra Written 758484 spots for SRR12671645.sra Read 758484 spots for SRR12671645.sra Written 758484 spots for SRR12671645.sra SRR ids: ['SRR12671645.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8imnizn2 SRR12671645.sra spots: 15169689 blocks: [[1, 758484], [758485, 1516968], [1516969, 2275452], [2275453, 3033936], [3033937, 3792420], [3792421, 4550904], [4550905, 5309388], [5309389, 6067872], [6067873, 6826356], [6826357, 7584840], [7584841, 8343324], [8343325, 9101808], [9101809, 9860292], [9860293, 10618776], [10618777, 11377260], [11377261, 12135744], [12135745, 12894228], [12894229, 13652712], [13652713, 14411196], [14411197, 15169689]] SRR12671645 file size 5133623 SRR12671645 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671645 SRR12671645_1.fastq SRR12671645_2.fastq Input file: SRR12671645_1.fastq Paired file: SRR12671645_2.fastq trimmed: SRR12671645-trimmed-pair1.fastq, SRR12671645-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:46:09 2025 >> started Tue Feb 11 23:46:25 2025 >> done (15.776s) 15169689 read pairs processed; of these: 18 ( 0.00%) short read pairs filtered out after trimming by size control 956 ( 0.01%) empty read pairs filtered out after trimming by size control 15168715 (99.99%) read pairs available; of these: 692645 ( 4.57%) trimmed read pairs available after processing 14476070 (95.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 4 0.00% 21 5 0.00% 22 3 0.00% 23 2 0.00% 24 3 0.00% 25 1 0.00% 26 2 0.00% 27 0 0.00% 28 5 0.00% 29 3 0.00% 30 6 0.00% 31 5 0.00% 32 5 0.00% 33 9 0.00% 34 9 0.00% 35 9 0.00% 36 15 0.00% 37 1 0.00% 38 7 0.00% 39 12 0.00% 40 6 0.00% 41 15 0.00% 42 16 0.00% 43 10 0.00% 44 19 0.00% 45 21 0.00% 46 14 0.00% 47 18 0.00% 48 23 0.00% 49 28 0.00% 50 30 0.00% 51 41 0.00% 52 38 0.00% 53 29 0.00% 54 39 0.00% 55 45 0.00% 56 31 0.00% 57 47 0.00% 58 52 0.00% 59 58 0.00% 60 58 0.00% 61 86 0.00% 62 82 0.00% 63 92 0.00% 64 106 0.00% 65 102 0.00% 66 131 0.00% 67 139 0.00% 68 144 0.00% 69 153 0.00% 70 188 0.00% 71 250 0.00% 72 252 0.00% 73 287 0.00% 74 321 0.00% 75 350 0.00% 76 362 0.00% 77 413 0.00% 78 424 0.00% 79 518 0.00% 80 569 0.00% 81 693 0.00% 82 785 0.01% 83 848 0.01% 84 957 0.01% 85 1084 0.01% 86 1091 0.01% 87 1145 0.01% 88 1285 0.01% 89 1351 0.01% 90 1461 0.01% 91 1700 0.01% 92 1906 0.01% 93 2165 0.01% 94 2385 0.02% 95 2598 0.02% 96 2669 0.02% 97 2833 0.02% 98 3014 0.02% 99 3067 0.02% 100 3265 0.02% 101 3607 0.02% 102 3814 0.03% 103 4405 0.03% 104 4667 0.03% 105 4972 0.03% 106 5135 0.03% 107 5232 0.03% 108 5533 0.04% 109 5741 0.04% 110 5948 0.04% 111 6320 0.04% 112 7003 0.05% 113 7215 0.05% 114 7794 0.05% 115 8115 0.05% 116 8487 0.06% 117 8778 0.06% 118 9222 0.06% 119 9315 0.06% 120 9491 0.06% 121 9913 0.07% 122 10414 0.07% 123 11060 0.07% 124 11731 0.08% 125 12399 0.08% 126 12858 0.08% 127 12922 0.09% 128 13419 0.09% 129 13593 0.09% 130 13846 0.09% 131 14479 0.10% 132 14931 0.10% 133 15741 0.10% 134 16492 0.11% 135 17091 0.11% 136 17570 0.12% 137 17951 0.12% 138 18690 0.12% 139 18734 0.12% 140 18948 0.12% 141 19748 0.13% 142 19990 0.13% 143 20904 0.14% 144 22541 0.15% 145 22456 0.15% 146 23920 0.16% 147 23877 0.16% 148 24471 0.16% 149 24294 0.16% 150 24850 0.16% 151 14476070 95.43% 15168715 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=32 prefix-density=0.60 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCATATTGGCTTGTGCCGGGGTGCGGTTGACGGTGGCAACGGCTGCCGATGAGATCATAGAGGAGGAAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=15.43 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=2.5 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTT criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=30 prefix-density=0.79 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=34 fanout-score=25.85 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=1.3 sequence=TGGCTTCCTCTACGCTCTCCCCTGCCACTCCCTCACAGCTATGCTCTAGCAAGAGTGGCATGTTCTCTCCTACACATGCGGTGTTTGTGAAACCAACAAGGACAAATATGGTG SRR12671645 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:47:20 Started mapping on | Feb 11 23:47:20 Finished on | Feb 11 23:48:52 Mapping speed, Million of reads per hour | 593.56 Number of input reads | 15168715 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 14182100 Uniquely mapped reads % | 93.50% Average mapped length | 298.73 Number of splices: Total | 14754900 Number of splices: Annotated (sjdb) | 14480962 Number of splices: GT/AG | 14458030 Number of splices: GC/AG | 251129 Number of splices: AT/AC | 8170 Number of splices: Non-canonical | 37571 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.92 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 352727 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 80015 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.53% % of reads unmapped: other | 0.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 633888 633888 633888 N_multimapping 352727 352727 352727 N_noFeature 449862 13979415 511287 N_ambiguous 226656 843 84940 UnstrandedReadsAssigned:13505582 PositiveStrandReadsAssigned:201842 NegativeStrandReadsAssigned:13585873 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671645 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671645-trimmed-pair1.fastq SRR12671645-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,168,715 reads, 13,594,494 reads pseudoaligned [quant] estimated average fragment length: 305.468 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52401 SRR12671645.ke.tsv 34699 SRR12671645.se.tsv 87100 total ==> SRR12671645.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1713.53 443 17.5332 Potri.005G024800.1.v4.1 1035 730.532 249 23.1158 Potri.004G059700.1.v4.1 961 657.142 4 0.41281 Potri.007G009000.2.v4.1 1416 1111.53 0 0 Potri.003G141000.2.v4.1 2943 2638.53 730 18.7633 Potri.016G087400.1.v4.1 270 71.6794 546 516.592 Potri.015G069301.1.v4.1 564 286.949 0 0 Potri.010G195200.1.v4.1 1773 1468.53 47 2.17052 Potri.012G127500.1.v4.1 977 672.881 73 7.35756 ==> SRR12671645.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 282 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 165 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 18 SRR12671645 completed mapping pipeline successfully