Starting /dee2/code/volunteer_pipeline.sh SRR12671646 current disk space = 3051373658112 free memory = 1580041084 SRR12671646 SRAfilesize 8b936dc8ecf5ab858ae4e136dc56c920 SRR12671646.sra SRR12671646.sra file validated SRR12671646 is paired end SRR12671646 is conventional basespace SRR12671646 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671646_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.467 37.0 37.0 37.0 37.0 37.0 2 36.17075 37.0 37.0 37.0 37.0 37.0 3 36.5525 37.0 37.0 37.0 37.0 37.0 4 36.5805 37.0 37.0 37.0 37.0 37.0 5 36.5465 37.0 37.0 37.0 37.0 37.0 6 36.538 37.0 37.0 37.0 37.0 37.0 7 36.5375 37.0 37.0 37.0 37.0 37.0 8 36.4995 37.0 37.0 37.0 37.0 37.0 9 36.629 37.0 37.0 37.0 37.0 37.0 10-14 36.5098 37.0 37.0 37.0 37.0 37.0 15-19 36.4963 37.0 37.0 37.0 37.0 37.0 20-24 36.4793 37.0 37.0 37.0 37.0 37.0 25-29 36.4465 37.0 37.0 37.0 37.0 37.0 30-34 36.43300000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.4105 37.0 37.0 37.0 37.0 37.0 40-44 36.43750000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.404700000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.356 37.0 37.0 37.0 37.0 37.0 55-59 36.3283 37.0 37.0 37.0 37.0 37.0 60-64 36.2975 37.0 37.0 37.0 37.0 37.0 65-69 36.287099999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.275400000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.237100000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.2338 37.0 37.0 37.0 37.0 37.0 85-89 36.2312 37.0 37.0 37.0 37.0 37.0 90-94 36.222500000000004 37.0 37.0 37.0 37.0 37.0 95-99 36.12650000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.1376 37.0 37.0 37.0 37.0 37.0 105-109 36.097300000000004 37.0 37.0 37.0 37.0 37.0 110-114 36.1246 37.0 37.0 37.0 37.0 37.0 115-119 36.0736 37.0 37.0 37.0 37.0 37.0 120-124 36.02460000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.9821 37.0 37.0 37.0 37.0 37.0 130-134 35.96809999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.84660000000001 37.0 37.0 37.0 37.0 37.0 140-144 35.8737 37.0 37.0 37.0 37.0 37.0 145-149 35.8485 37.0 37.0 37.0 37.0 37.0 150-151 35.396249999999995 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 3.0 26 8.0 27 11.0 28 6.0 29 19.0 30 32.0 31 40.0 32 50.0 33 80.0 34 132.0 35 282.0 36 2969.0 37 365.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.65 15.975 10.725 41.65 2 19.15266984206568 22.436700927550763 38.43068438205064 19.979944848332913 3 18.15 27.224999999999998 27.275 27.35 4 21.7 34.300000000000004 23.125 20.875 5 23.125 37.4 23.5 15.975 6 18.375 35.65 24.925 21.05 7 13.900000000000002 20.5 46.0 19.6 8 17.775 22.125 29.549999999999997 30.55 9 16.625 23.175 32.85 27.35 10-14 19.485 28.875 27.165 24.474999999999998 15-19 19.82 27.744999999999997 28.410000000000004 24.025 20-24 19.715 28.084999999999997 27.85 24.349999999999998 25-29 19.919999999999998 28.065 27.99 24.025 30-34 20.135 28.26 27.985 23.62 35-39 19.91 28.22 27.805000000000003 24.065 40-44 20.005 28.615000000000002 27.395000000000003 23.985 45-49 19.785 28.065 27.644999999999996 24.505 50-54 20.51 28.58 27.095000000000002 23.815 55-59 19.634999999999998 28.255000000000003 27.48 24.63 60-64 19.865 28.015 26.905 25.215 65-69 20.205000000000002 28.395 27.765 23.635 70-74 20.41 28.249999999999996 27.065 24.275 75-79 20.419999999999998 28.910000000000004 27.034999999999997 23.635 80-84 20.57 28.249999999999996 27.089999999999996 24.09 85-89 20.435 28.189999999999998 27.52 23.855 90-94 20.044999999999998 28.544999999999998 28.175 23.235 95-99 20.580000000000002 27.85 27.915 23.655 100-104 20.005 28.475 27.834999999999997 23.685000000000002 105-109 20.48 28.144999999999996 27.334999999999997 24.04 110-114 20.57 28.04 27.935 23.455000000000002 115-119 20.53 28.355000000000004 27.939999999999998 23.175 120-124 20.625 27.73 27.705000000000002 23.94 125-129 20.974999999999998 27.765 27.405 23.855 130-134 20.585 28.810000000000002 26.83 23.775 135-139 21.01 27.63 27.345000000000002 24.015 140-144 21.205 27.955000000000002 26.88 23.96 145-149 21.154999999999998 27.66 27.85 23.335 150-151 21.375 27.35 28.4 22.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.0 23 3.0 24 3.0 25 2.5 26 3.0 27 6.5 28 6.5 29 9.5 30 16.5 31 25.5 32 35.0 33 40.0 34 54.0 35 79.0 36 97.5 37 113.5 38 136.5 39 157.0 40 191.0 41 215.0 42 235.0 43 254.0 44 265.0 45 269.0 46 252.5 47 235.5 48 219.0 49 205.0 50 179.0 51 145.0 52 115.5 53 93.0 54 79.0 55 60.0 56 45.0 57 35.5 58 24.0 59 20.5 60 25.0 61 20.0 62 7.0 63 3.5 64 3.0 65 2.0 66 2.5 67 2.0 68 0.5 69 0.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.27499999999999997 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.48422169185892 89.075 2 5.064969504110316 9.55 3 0.3447361442588173 0.975 4 0.10607265977194379 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.1375 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.55 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 1.0375 0.0 0.0 0.0 0.0 122-123 1.1 0.0 0.0 0.0 0.0 124-125 1.325 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.7375 0.0 0.0 0.0 0.0 130-131 2.0375 0.0 0.0 0.0 0.0 132-133 2.15 0.0 0.0 0.0 0.0 134-135 2.3125 0.0 0.0 0.0 0.0 136-137 2.4749999999999996 0.0 0.0 0.0 0.0 138-139 2.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGAC 10 0.006830828 145.0 5 >>END_MODULE SRR12671646 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671646_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.99 37.0 37.0 37.0 37.0 37.0 2 35.6085 37.0 37.0 37.0 37.0 37.0 3 35.9215 37.0 37.0 37.0 37.0 37.0 4 35.8145 37.0 37.0 37.0 37.0 37.0 5 36.1625 37.0 37.0 37.0 37.0 37.0 6 36.097 37.0 37.0 37.0 37.0 37.0 7 36.084 37.0 37.0 37.0 37.0 37.0 8 36.1815 37.0 37.0 37.0 37.0 37.0 9 36.1455 37.0 37.0 37.0 37.0 37.0 10-14 36.1147 37.0 37.0 37.0 37.0 37.0 15-19 36.0802 37.0 37.0 37.0 37.0 37.0 20-24 36.0544 37.0 37.0 37.0 37.0 37.0 25-29 36.016200000000005 37.0 37.0 37.0 37.0 37.0 30-34 35.9754 37.0 37.0 37.0 37.0 37.0 35-39 35.980399999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.9763 37.0 37.0 37.0 37.0 37.0 45-49 35.934900000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.8654 37.0 37.0 37.0 37.0 37.0 55-59 35.8346 37.0 37.0 37.0 37.0 37.0 60-64 35.832499999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.7451 37.0 37.0 37.0 37.0 37.0 70-74 35.7324 37.0 37.0 37.0 37.0 37.0 75-79 35.680899999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.7256 37.0 37.0 37.0 37.0 37.0 85-89 35.696299999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.5801 37.0 37.0 37.0 37.0 37.0 95-99 35.6605 37.0 37.0 37.0 37.0 37.0 100-104 35.6068 37.0 37.0 37.0 37.0 37.0 105-109 35.543 37.0 37.0 37.0 37.0 37.0 110-114 35.451100000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.506800000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.4585 37.0 37.0 37.0 37.0 37.0 125-129 35.3074 37.0 37.0 37.0 34.6 37.0 130-134 35.417500000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.413799999999995 37.0 37.0 37.0 34.6 37.0 140-144 35.1577 37.0 37.0 37.0 27.4 37.0 145-149 35.2599 37.0 37.0 37.0 32.2 37.0 150-151 34.854749999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 3.0 14 3.0 15 0.0 16 1.0 17 1.0 18 0.0 19 1.0 20 1.0 21 1.0 22 5.0 23 5.0 24 5.0 25 7.0 26 16.0 27 15.0 28 19.0 29 26.0 30 33.0 31 50.0 32 80.0 33 118.0 34 262.0 35 688.0 36 2484.0 37 175.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.5 17.724999999999998 16.75 31.025000000000002 2 27.250000000000004 23.474999999999998 33.35 15.925 3 19.85 27.224999999999998 32.574999999999996 20.349999999999998 4 22.225 36.55 23.150000000000002 18.075 5 24.474999999999998 36.575 21.275 17.675 6 18.4 38.975 22.35 20.275000000000002 7 18.125 17.724999999999998 43.65 20.5 8 22.075 23.400000000000002 27.05 27.474999999999998 9 21.175 23.575 29.75 25.5 10-14 22.335 28.815 27.084999999999997 21.765 15-19 22.39 28.355000000000004 27.744999999999997 21.51 20-24 22.345000000000002 28.24 27.79 21.625 25-29 22.475 28.044999999999998 27.950000000000003 21.529999999999998 30-34 22.38 27.67 28.449999999999996 21.5 35-39 22.425 27.68 28.175 21.72 40-44 22.6 27.79 28.03 21.58 45-49 22.585 27.83 27.894999999999996 21.69 50-54 22.705000000000002 27.71 27.615000000000002 21.97 55-59 23.005 27.700000000000003 27.455000000000002 21.84 60-64 22.91 27.544999999999998 27.83 21.715 65-69 23.185 27.175 27.965 21.675 70-74 23.43 27.755000000000003 27.250000000000004 21.565 75-79 23.595 27.11 27.435 21.86 80-84 22.900000000000002 27.565 27.92 21.615000000000002 85-89 23.68 27.339999999999996 27.26 21.72 90-94 23.23 27.694999999999997 27.794999999999998 21.279999999999998 95-99 23.95 27.47 27.650000000000002 20.93 100-104 23.14 27.694999999999997 27.905 21.26 105-109 23.395 27.875 27.49 21.240000000000002 110-114 23.945 27.665 27.705000000000002 20.685000000000002 115-119 23.54 27.47 27.98 21.01 120-124 23.755000000000003 27.46 27.555000000000003 21.23 125-129 24.015 27.355 27.655 20.974999999999998 130-134 24.349999999999998 27.51 26.905 21.235 135-139 23.885 27.76 27.565 20.79 140-144 24.315 27.095000000000002 27.639999999999997 20.95 145-149 23.919999999999998 28.694999999999997 26.83 20.555 150-151 24.6625 27.537499999999998 27.400000000000002 20.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 1.0 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.5 23 1.5 24 1.5 25 2.5 26 4.5 27 5.5 28 8.5 29 7.5 30 12.0 31 22.0 32 24.5 33 39.0 34 52.5 35 57.5 36 88.0 37 121.5 38 132.5 39 163.5 40 189.5 41 199.5 42 234.5 43 250.5 44 246.5 45 259.0 46 258.5 47 248.5 48 239.5 49 222.0 50 183.5 51 134.0 52 115.0 53 102.5 54 80.5 55 71.5 56 57.0 57 35.5 58 25.0 59 26.0 60 24.0 61 14.0 62 9.5 63 7.0 64 3.0 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.50636942675159 89.025 2 4.989384288747346 9.4 3 0.45116772823779194 1.275 4 0.02653927813163482 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02653927813163482 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.0625 0.0 0.0 0.025 0.0 74-75 0.075 0.0 0.0 0.025 0.0 76-77 0.075 0.0 0.0 0.025 0.0 78-79 0.075 0.0 0.0 0.025 0.0 80-81 0.075 0.0 0.0 0.025 0.0 82-83 0.075 0.0 0.0 0.025 0.0 84-85 0.075 0.0 0.0 0.025 0.0 86-87 0.0875 0.0 0.0 0.025 0.0 88-89 0.1 0.0 0.0 0.025 0.0 90-91 0.125 0.0 0.0 0.025 0.0 92-93 0.125 0.0 0.0 0.025 0.0 94-95 0.125 0.0 0.0 0.025 0.0 96-97 0.1375 0.0 0.0 0.025 0.0 98-99 0.175 0.0 0.0 0.025 0.0 100-101 0.175 0.0 0.0 0.025 0.0 102-103 0.2 0.0 0.0 0.025 0.0 104-105 0.2625 0.0 0.0 0.025 0.0 106-107 0.3125 0.0 0.0 0.025 0.0 108-109 0.3875 0.0 0.0 0.025 0.0 110-111 0.475 0.0 0.0 0.025 0.0 112-113 0.55 0.0 0.0 0.025 0.0 114-115 0.675 0.0 0.0 0.025 0.0 116-117 0.8125 0.0 0.0 0.025 0.0 118-119 0.8625 0.0 0.0 0.025 0.0 120-121 1.0125 0.0 0.0 0.025 0.0 122-123 1.0750000000000002 0.0 0.0 0.025 0.0 124-125 1.3 0.0 0.0 0.025 0.0 126-127 1.4125 0.0 0.0 0.025 0.0 128-129 1.7125 0.0 0.0 0.025 0.0 130-131 2.0125 0.0 0.0 0.025 0.0 132-133 2.125 0.0 0.0 0.025 0.0 134-135 2.2875 0.0 0.0 0.025 0.0 136-137 2.45 0.0 0.0 0.025 0.0 138-139 2.6125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGAGGT 10 0.006830828 145.0 7 >>END_MODULE Read 999091 spots for SRR12671646.sra Written 999091 spots for SRR12671646.sra Read 999091 spots for SRR12671646.sra Written 999091 spots for SRR12671646.sra Read 999091 spots for SRR12671646.sra Written 999091 spots for SRR12671646.sra Read 999091 spots for SRR12671646.sra Written 999091 spots for SRR12671646.sra Read 999091 spots for SRR12671646.sra Written 999091 spots for SRR12671646.sra Read 999091 spots for SRR12671646.sra Written 999091 spots for SRR12671646.sra Read 999091 spots for SRR12671646.sra Written 999091 spots for SRR12671646.sra Read 999091 spots for SRR12671646.sra Written 999091 spots for SRR12671646.sra Read 999091 spots for SRR12671646.sra Written 999091 spots for SRR12671646.sra Read 999091 spots for SRR12671646.sra Written 999091 spots for SRR12671646.sra Read 999091 spots for SRR12671646.sra Written 999091 spots for SRR12671646.sra Read 999091 spots for SRR12671646.sra Written 999091 spots for SRR12671646.sra Read 999091 spots for SRR12671646.sra Written 999091 spots for SRR12671646.sra Read 999091 spots for SRR12671646.sra Written 999091 spots for SRR12671646.sra Read 999092 spots for SRR12671646.sra Written 999092 spots for SRR12671646.sra Read 999091 spots for SRR12671646.sra Written 999091 spots for SRR12671646.sra Read 999091 spots for SRR12671646.sra Written 999091 spots for SRR12671646.sra Read 999091 spots for SRR12671646.sra Written 999091 spots for SRR12671646.sra Read 999091 spots for SRR12671646.sra Written 999091 spots for SRR12671646.sra Read 999091 spots for SRR12671646.sra Written 999091 spots for SRR12671646.sra SRR ids: ['SRR12671646.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j9oagvur SRR12671646.sra spots: 19981821 blocks: [[1, 999091], [999092, 1998182], [1998183, 2997273], [2997274, 3996364], [3996365, 4995455], [4995456, 5994546], [5994547, 6993637], [6993638, 7992728], [7992729, 8991819], [8991820, 9990910], [9990911, 10990001], [10990002, 11989092], [11989093, 12988183], [12988184, 13987274], [13987275, 14986365], [14986366, 15985456], [15985457, 16984547], [16984548, 17983638], [17983639, 18982729], [18982730, 19981821]] SRR12671646 file size 6768996 SRR12671646 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671646 SRR12671646_1.fastq SRR12671646_2.fastq Input file: SRR12671646_1.fastq Paired file: SRR12671646_2.fastq trimmed: SRR12671646-trimmed-pair1.fastq, SRR12671646-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:42:54 2025 >> started Wed Feb 12 00:43:15 2025 >> done (21.520s) 19981821 read pairs processed; of these: 16 ( 0.00%) short read pairs filtered out after trimming by size control 1725 ( 0.01%) empty read pairs filtered out after trimming by size control 19980080 (99.99%) read pairs available; of these: 703542 ( 3.52%) trimmed read pairs available after processing 19276538 (96.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 0 0.00% 21 1 0.00% 22 1 0.00% 23 0 0.00% 24 3 0.00% 25 5 0.00% 26 2 0.00% 27 1 0.00% 28 6 0.00% 29 12 0.00% 30 11 0.00% 31 9 0.00% 32 5 0.00% 33 11 0.00% 34 8 0.00% 35 9 0.00% 36 12 0.00% 37 16 0.00% 38 18 0.00% 39 15 0.00% 40 10 0.00% 41 21 0.00% 42 22 0.00% 43 40 0.00% 44 16 0.00% 45 26 0.00% 46 26 0.00% 47 34 0.00% 48 30 0.00% 49 50 0.00% 50 38 0.00% 51 42 0.00% 52 50 0.00% 53 62 0.00% 54 59 0.00% 55 54 0.00% 56 54 0.00% 57 71 0.00% 58 66 0.00% 59 89 0.00% 60 86 0.00% 61 124 0.00% 62 120 0.00% 63 148 0.00% 64 148 0.00% 65 132 0.00% 66 179 0.00% 67 179 0.00% 68 185 0.00% 69 197 0.00% 70 224 0.00% 71 307 0.00% 72 314 0.00% 73 357 0.00% 74 412 0.00% 75 388 0.00% 76 384 0.00% 77 473 0.00% 78 535 0.00% 79 583 0.00% 80 632 0.00% 81 720 0.00% 82 870 0.00% 83 957 0.00% 84 1029 0.01% 85 1211 0.01% 86 1224 0.01% 87 1242 0.01% 88 1496 0.01% 89 1457 0.01% 90 1628 0.01% 91 1825 0.01% 92 1946 0.01% 93 2250 0.01% 94 2492 0.01% 95 2634 0.01% 96 2850 0.01% 97 2967 0.01% 98 3017 0.02% 99 3312 0.02% 100 3432 0.02% 101 3849 0.02% 102 4070 0.02% 103 4348 0.02% 104 4744 0.02% 105 5054 0.03% 106 5143 0.03% 107 5371 0.03% 108 5525 0.03% 109 5701 0.03% 110 6048 0.03% 111 6357 0.03% 112 6793 0.03% 113 7346 0.04% 114 7718 0.04% 115 8098 0.04% 116 8472 0.04% 117 8498 0.04% 118 8973 0.04% 119 9112 0.05% 120 9530 0.05% 121 10053 0.05% 122 10364 0.05% 123 11075 0.06% 124 11701 0.06% 125 12232 0.06% 126 12696 0.06% 127 13197 0.07% 128 13338 0.07% 129 13496 0.07% 130 13861 0.07% 131 14124 0.07% 132 14887 0.07% 133 15802 0.08% 134 16510 0.08% 135 17623 0.09% 136 18089 0.09% 137 18317 0.09% 138 18669 0.09% 139 18838 0.09% 140 19101 0.10% 141 19622 0.10% 142 20610 0.10% 143 21731 0.11% 144 22829 0.11% 145 23484 0.12% 146 24254 0.12% 147 24692 0.12% 148 25481 0.13% 149 25094 0.13% 150 25346 0.13% 151 19276538 96.48% 19980080 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=36 prefix-density=0.53 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.12 sequence-density-rank=21 fanout-score=28.50 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=10.2 sequence=CTCTCCTTCAGTGAAGGATGCAGCTCCATACATGGTCAAGCAAATGCTTAGGATTACGATCAGACCACCTGCAGCCAAAGATCCAGCAGCAC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=34 prefix-density=0.73 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=25 fanout-score=40.35 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=13.1 sequence=AAAGAAAAGAAAA SRR12671646 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:43:59 Started mapping on | Feb 12 00:43:59 Finished on | Feb 12 00:46:03 Mapping speed, Million of reads per hour | 580.07 Number of input reads | 19980080 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 18685182 Uniquely mapped reads % | 93.52% Average mapped length | 299.14 Number of splices: Total | 19008214 Number of splices: Annotated (sjdb) | 18632585 Number of splices: GT/AG | 18627344 Number of splices: GC/AG | 314801 Number of splices: AT/AC | 10596 Number of splices: Non-canonical | 55473 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 454342 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 131836 % of reads mapped to too many loci | 0.66% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.37% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 840556 840556 840556 N_multimapping 454342 454342 454342 N_noFeature 648757 18417100 729299 N_ambiguous 306007 1244 117777 UnstrandedReadsAssigned:17730418 PositiveStrandReadsAssigned:266838 NegativeStrandReadsAssigned:17838106 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671646 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671646-trimmed-pair1.fastq SRR12671646-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,980,080 reads, 17,866,871 reads pseudoaligned [quant] estimated average fragment length: 320.042 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52401 SRR12671646.ke.tsv 34699 SRR12671646.se.tsv 87100 total ==> SRR12671646.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1698.96 561 17.3379 Potri.005G024800.1.v4.1 1035 715.958 260 19.0679 Potri.004G059700.1.v4.1 961 642.631 1 0.0817063 Potri.007G009000.2.v4.1 1416 1096.96 0 0 Potri.003G141000.2.v4.1 2943 2623.96 1198.97 23.9921 Potri.016G087400.1.v4.1 270 68.0271 586 452.306 Potri.015G069301.1.v4.1 564 277.689 0 0 Potri.010G195200.1.v4.1 1773 1453.96 75 2.70849 Potri.012G127500.1.v4.1 977 658.291 173 13.7989 ==> SRR12671646.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 277 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 225 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 6 SRR12671646 completed mapping pipeline successfully