Starting /dee2/code/volunteer_pipeline.sh SRR12671647 current disk space = 3051851104256 free memory = 1466828288 SRR12671647 SRAfilesize 77137b99506ea1c08a5d5a107f035caf SRR12671647.sra SRR12671647.sra file validated SRR12671647 is paired end SRR12671647 is conventional basespace SRR12671647 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671647_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4955 37.0 37.0 37.0 37.0 37.0 2 36.3105 37.0 37.0 37.0 37.0 37.0 3 36.5145 37.0 37.0 37.0 37.0 37.0 4 36.4485 37.0 37.0 37.0 37.0 37.0 5 36.5475 37.0 37.0 37.0 37.0 37.0 6 36.501 37.0 37.0 37.0 37.0 37.0 7 36.436 37.0 37.0 37.0 37.0 37.0 8 36.606 37.0 37.0 37.0 37.0 37.0 9 36.6385 37.0 37.0 37.0 37.0 37.0 10-14 36.5257 37.0 37.0 37.0 37.0 37.0 15-19 36.5291 37.0 37.0 37.0 37.0 37.0 20-24 36.4854 37.0 37.0 37.0 37.0 37.0 25-29 36.4978 37.0 37.0 37.0 37.0 37.0 30-34 36.45870000000001 37.0 37.0 37.0 37.0 37.0 35-39 36.473299999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.4577 37.0 37.0 37.0 37.0 37.0 45-49 36.427499999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.3852 37.0 37.0 37.0 37.0 37.0 55-59 36.3907 37.0 37.0 37.0 37.0 37.0 60-64 36.3611 37.0 37.0 37.0 37.0 37.0 65-69 36.3622 37.0 37.0 37.0 37.0 37.0 70-74 36.307100000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.269999999999996 37.0 37.0 37.0 37.0 37.0 80-84 36.3527 37.0 37.0 37.0 37.0 37.0 85-89 36.3064 37.0 37.0 37.0 37.0 37.0 90-94 36.259 37.0 37.0 37.0 37.0 37.0 95-99 36.25170000000001 37.0 37.0 37.0 37.0 37.0 100-104 36.2272 37.0 37.0 37.0 37.0 37.0 105-109 36.1898 37.0 37.0 37.0 37.0 37.0 110-114 36.185 37.0 37.0 37.0 37.0 37.0 115-119 36.13 37.0 37.0 37.0 37.0 37.0 120-124 36.068799999999996 37.0 37.0 37.0 37.0 37.0 125-129 36.0592 37.0 37.0 37.0 37.0 37.0 130-134 36.0284 37.0 37.0 37.0 37.0 37.0 135-139 35.9835 37.0 37.0 37.0 37.0 37.0 140-144 35.95459999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.89630000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.441 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 0.0 25 3.0 26 5.0 27 8.0 28 6.0 29 18.0 30 27.0 31 27.0 32 54.0 33 59.0 34 124.0 35 318.0 36 2961.0 37 389.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.9 15.35 14.274999999999999 37.475 2 20.783132530120483 20.10542168674699 37.22389558232932 21.88755020080321 3 17.675 26.6 27.675 28.050000000000004 4 20.575 35.55 22.375 21.5 5 20.75 36.375 24.575 18.3 6 18.75 35.4 25.55 20.3 7 13.525 21.675 44.4 20.4 8 18.25 21.925 30.45 29.375 9 18.25 22.85 31.15 27.750000000000004 10-14 19.759999999999998 28.67 27.42 24.15 15-19 19.220000000000002 28.255000000000003 28.09 24.435000000000002 20-24 19.89 28.21 28.005000000000003 23.895 25-29 20.095 28.384999999999998 27.755000000000003 23.765 30-34 20.22 28.389999999999997 27.544999999999998 23.845 35-39 19.805 28.410000000000004 27.675 24.11 40-44 19.98 28.88 27.715 23.425 45-49 20.34 28.744999999999997 27.08 23.835 50-54 20.175 28.26 27.865000000000002 23.7 55-59 20.62 28.285 27.72 23.375 60-64 20.78 28.13 26.985 24.104999999999997 65-69 20.555 28.305000000000003 26.895000000000003 24.245 70-74 20.455000000000002 27.77 27.985 23.79 75-79 21.065 27.35 27.74 23.845 80-84 21.305 27.944999999999997 27.125 23.625 85-89 20.11 28.144999999999996 27.665 24.08 90-94 20.13 27.675 27.99 24.205 95-99 20.685000000000002 27.98 27.155 24.18 100-104 19.869999999999997 27.694999999999997 27.584999999999997 24.85 105-109 20.715 28.03 27.150000000000002 24.104999999999997 110-114 20.93 27.355 27.515 24.2 115-119 20.974999999999998 27.555000000000003 27.3 24.169999999999998 120-124 21.135 27.544999999999998 27.73 23.59 125-129 20.669999999999998 28.810000000000002 26.82 23.7 130-134 21.25 27.915 26.955000000000002 23.880000000000003 135-139 21.085 27.855 27.175 23.885 140-144 20.955 27.944999999999997 26.974999999999998 24.125 145-149 21.385 27.875 26.97 23.77 150-151 21.637500000000003 27.6375 26.05 24.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.5 23 1.5 24 1.5 25 5.0 26 6.0 27 7.5 28 9.0 29 9.0 30 19.5 31 28.0 32 32.5 33 39.0 34 51.5 35 70.0 36 92.5 37 118.5 38 134.5 39 152.5 40 183.5 41 210.5 42 222.5 43 248.0 44 277.5 45 265.5 46 253.0 47 240.5 48 213.0 49 212.5 50 193.5 51 140.0 52 106.5 53 94.0 54 77.0 55 71.5 56 64.5 57 44.5 58 29.5 59 24.0 60 18.5 61 9.0 62 5.5 63 4.0 64 5.0 65 3.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.4 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.675 #Duplication Level Percentage of deduplicated Percentage of total 1 92.9592662530348 86.15 2 6.420285945508497 11.899999999999999 3 0.4855678446182897 1.35 4 0.10790396547073104 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02697599136768276 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5874999999999999 0.0 0.0 0.0 0.0 106-107 0.7124999999999999 0.0 0.0 0.0 0.0 108-109 0.7875000000000001 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.1375 0.0 0.0 0.0 0.0 116-117 1.4249999999999998 0.0 0.0 0.0 0.0 118-119 1.6625 0.0 0.0 0.0 0.0 120-121 1.8875000000000002 0.0 0.0 0.0 0.0 122-123 2.1500000000000004 0.0 0.0 0.0 0.0 124-125 2.3125 0.0 0.0 0.0 0.0 126-127 2.4875 0.0 0.0 0.0 0.0 128-129 2.7875 0.0 0.0 0.0 0.0 130-131 3.1125 0.0 0.0 0.0 0.0 132-133 3.3 0.0 0.0 0.0 0.0 134-135 3.55 0.0 0.0 0.0 0.0 136-137 3.7375 0.0 0.0 0.0 0.0 138-139 4.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12671647 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671647_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1675 37.0 37.0 37.0 37.0 37.0 2 36.1005 37.0 37.0 37.0 37.0 37.0 3 36.166 37.0 37.0 37.0 37.0 37.0 4 36.1395 37.0 37.0 37.0 37.0 37.0 5 36.137 37.0 37.0 37.0 37.0 37.0 6 36.293 37.0 37.0 37.0 37.0 37.0 7 36.3275 37.0 37.0 37.0 37.0 37.0 8 36.1895 37.0 37.0 37.0 37.0 37.0 9 36.2985 37.0 37.0 37.0 37.0 37.0 10-14 36.266600000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.2159 37.0 37.0 37.0 37.0 37.0 20-24 36.242200000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.2053 37.0 37.0 37.0 37.0 37.0 30-34 36.1656 37.0 37.0 37.0 37.0 37.0 35-39 36.150099999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.1253 37.0 37.0 37.0 37.0 37.0 45-49 36.1253 37.0 37.0 37.0 37.0 37.0 50-54 36.1162 37.0 37.0 37.0 37.0 37.0 55-59 36.0144 37.0 37.0 37.0 37.0 37.0 60-64 36.0205 37.0 37.0 37.0 37.0 37.0 65-69 36.017 37.0 37.0 37.0 37.0 37.0 70-74 36.047 37.0 37.0 37.0 37.0 37.0 75-79 35.89 37.0 37.0 37.0 37.0 37.0 80-84 35.944399999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.87480000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.8334 37.0 37.0 37.0 37.0 37.0 95-99 35.8518 37.0 37.0 37.0 37.0 37.0 100-104 35.8285 37.0 37.0 37.0 37.0 37.0 105-109 35.755199999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.7534 37.0 37.0 37.0 37.0 37.0 115-119 35.6415 37.0 37.0 37.0 37.0 37.0 120-124 35.6946 37.0 37.0 37.0 37.0 37.0 125-129 35.5629 37.0 37.0 37.0 37.0 37.0 130-134 35.577999999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.498 37.0 37.0 37.0 37.0 37.0 140-144 35.3323 37.0 37.0 37.0 32.2 37.0 145-149 35.3597 37.0 37.0 37.0 34.6 37.0 150-151 34.941500000000005 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 0.0 15 3.0 16 2.0 17 1.0 18 1.0 19 0.0 20 2.0 21 2.0 22 2.0 23 3.0 24 8.0 25 6.0 26 10.0 27 12.0 28 9.0 29 15.0 30 35.0 31 38.0 32 69.0 33 120.0 34 190.0 35 522.0 36 2731.0 37 217.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.225 18.125 15.15 29.5 2 25.724999999999998 23.674999999999997 32.95 17.65 3 20.925 26.650000000000002 31.874999999999996 20.549999999999997 4 23.65 36.225 20.775 19.35 5 23.0 36.95 21.75 18.3 6 19.35 37.824999999999996 23.3 19.525000000000002 7 18.025 18.05 42.525 21.4 8 21.325 22.275 25.525 30.875000000000004 9 22.15 23.200000000000003 27.950000000000003 26.700000000000003 10-14 22.95 28.134999999999998 26.395000000000003 22.52 15-19 22.14 28.199999999999996 27.82 21.84 20-24 22.8 27.495000000000005 28.345 21.36 25-29 22.345000000000002 28.205000000000002 27.525 21.925 30-34 22.495 28.125 27.57 21.81 35-39 22.869999999999997 28.294999999999998 27.650000000000002 21.185000000000002 40-44 23.31 28.27 27.08 21.34 45-49 22.57 28.18 27.16 22.09 50-54 22.55 27.505000000000003 27.79 22.155 55-59 22.845 27.395000000000003 27.58 22.18 60-64 22.805 27.055 28.15 21.990000000000002 65-69 23.36 27.450000000000003 26.735 22.455 70-74 23.375 27.97 26.6 22.055 75-79 23.27 27.435 26.83 22.465 80-84 23.125 27.975 26.974999999999998 21.925 85-89 23.485 28.139999999999997 26.834999999999997 21.54 90-94 23.35 27.765 27.1 21.785 95-99 23.65 27.675 27.284999999999997 21.39 100-104 23.645 27.389999999999997 27.395000000000003 21.57 105-109 23.52 27.615000000000002 27.005000000000003 21.86 110-114 23.775 28.365000000000002 26.595000000000002 21.265 115-119 23.895 27.96 26.369999999999997 21.775 120-124 23.765 27.145000000000003 27.045 22.045 125-129 24.29 28.139999999999997 26.705000000000002 20.865000000000002 130-134 24.62 27.384999999999998 27.21 20.785 135-139 24.46 28.055000000000003 26.634999999999998 20.849999999999998 140-144 24.685000000000002 28.105000000000004 26.424999999999997 20.785 145-149 25.014999999999997 27.605 26.900000000000002 20.48 150-151 25.112499999999997 28.449999999999996 26.724999999999998 19.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 2.0 24 1.5 25 1.5 26 4.0 27 5.0 28 5.5 29 6.5 30 9.0 31 10.5 32 17.5 33 31.5 34 39.5 35 51.5 36 72.0 37 92.0 38 123.0 39 161.0 40 181.5 41 206.5 42 242.5 43 258.0 44 264.0 45 263.0 46 261.5 47 264.0 48 245.5 49 213.0 50 179.0 51 147.5 52 123.0 53 105.0 54 93.5 55 76.5 56 59.5 57 45.0 58 34.5 59 31.5 60 22.0 61 12.0 62 8.0 63 6.0 64 4.5 65 2.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 2.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.525 #Duplication Level Percentage of deduplicated Percentage of total 1 93.13699000270196 86.175 2 5.944339367738449 11.0 3 0.7565522831667117 2.1 4 0.054039448797622264 0.2 5 0.0810591731964334 0.375 6 0.027019724398811132 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit CGCACTTCTTCCTTCTTTCTATATTTGCTGTTTTTGTTTCCTTCTTTCGT 5 0.125 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit GGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTTCCTCCTCTAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.48750000000000004 0.0 0.0 0.0 0.0 104-105 0.6125 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.9125000000000001 0.0 0.0 0.0 0.0 112-113 1.0499999999999998 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.475 0.0 0.0 0.0 0.0 118-119 1.75 0.0 0.0 0.0 0.0 120-121 1.9874999999999998 0.0 0.0 0.0 0.0 122-123 2.25 0.0 0.0 0.0 0.0 124-125 2.4125 0.0 0.0 0.0 0.0 126-127 2.5875 0.0 0.0 0.0 0.0 128-129 2.8875 0.0 0.0 0.0 0.0 130-131 3.2125 0.0 0.0 0.0 0.0 132-133 3.4000000000000004 0.0 0.0 0.0 0.0 134-135 3.7 0.0 0.0 0.0 0.0 136-137 3.8625 0.0 0.0 0.0 0.0 138-139 4.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1127401 spots for SRR12671647.sra Written 1127401 spots for SRR12671647.sra Read 1127401 spots for SRR12671647.sra Written 1127401 spots for SRR12671647.sra Read 1127401 spots for SRR12671647.sra Written 1127401 spots for SRR12671647.sra Read 1127401 spots for SRR12671647.sra Written 1127401 spots for SRR12671647.sra Read 1127401 spots for SRR12671647.sra Written 1127401 spots for SRR12671647.sra Read 1127401 spots for SRR12671647.sra Written 1127401 spots for SRR12671647.sra Read 1127401 spots for SRR12671647.sra Written 1127401 spots for SRR12671647.sra Read 1127401 spots for SRR12671647.sra Written 1127401 spots for SRR12671647.sra Read 1127401 spots for SRR12671647.sra Written 1127401 spots for SRR12671647.sra Read 1127401 spots for SRR12671647.sra Written 1127401 spots for SRR12671647.sra Read 1127401 spots for SRR12671647.sra Written 1127401 spots for SRR12671647.sra Read 1127401 spots for SRR12671647.sra Written 1127401 spots for SRR12671647.sra Read 1127418 spots for SRR12671647.sra Written 1127418 spots for SRR12671647.sra Read 1127401 spots for SRR12671647.sra Written 1127401 spots for SRR12671647.sra Read 1127401 spots for SRR12671647.sra Written 1127401 spots for SRR12671647.sra Read 1127401 spots for SRR12671647.sra Written 1127401 spots for SRR12671647.sra Read 1127401 spots for SRR12671647.sra Written 1127401 spots for SRR12671647.sra Read 1127401 spots for SRR12671647.sra Written 1127401 spots for SRR12671647.sra Read 1127401 spots for SRR12671647.sra Written 1127401 spots for SRR12671647.sra Read 1127401 spots for SRR12671647.sra Written 1127401 spots for SRR12671647.sra SRR ids: ['SRR12671647.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4mn98li0 SRR12671647.sra spots: 22548037 blocks: [[1, 1127401], [1127402, 2254802], [2254803, 3382203], [3382204, 4509604], [4509605, 5637005], [5637006, 6764406], [6764407, 7891807], [7891808, 9019208], [9019209, 10146609], [10146610, 11274010], [11274011, 12401411], [12401412, 13528812], [13528813, 14656213], [14656214, 15783614], [15783615, 16911015], [16911016, 18038416], [18038417, 19165817], [19165818, 20293218], [20293219, 21420619], [21420620, 22548037]] SRR12671647 file size 7641109 SRR12671647 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671647 SRR12671647_1.fastq SRR12671647_2.fastq Input file: SRR12671647_1.fastq Paired file: SRR12671647_2.fastq trimmed: SRR12671647-trimmed-pair1.fastq, SRR12671647-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 23:57:14 2025 >> started Tue Feb 11 23:57:42 2025 >> done (27.447s) 22548037 read pairs processed; of these: 15 ( 0.00%) short read pairs filtered out after trimming by size control 6619 ( 0.03%) empty read pairs filtered out after trimming by size control 22541403 (99.97%) read pairs available; of these: 1350213 ( 5.99%) trimmed read pairs available after processing 21191190 (94.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 21 2 0.00% 22 4 0.00% 23 4 0.00% 24 3 0.00% 25 6 0.00% 26 3 0.00% 27 1 0.00% 28 9 0.00% 29 8 0.00% 30 10 0.00% 31 13 0.00% 32 10 0.00% 33 12 0.00% 34 14 0.00% 35 12 0.00% 36 7 0.00% 37 11 0.00% 38 14 0.00% 39 16 0.00% 40 30 0.00% 41 30 0.00% 42 26 0.00% 43 21 0.00% 44 31 0.00% 45 28 0.00% 46 41 0.00% 47 51 0.00% 48 44 0.00% 49 62 0.00% 50 58 0.00% 51 62 0.00% 52 78 0.00% 53 83 0.00% 54 88 0.00% 55 110 0.00% 56 108 0.00% 57 90 0.00% 58 120 0.00% 59 147 0.00% 60 175 0.00% 61 164 0.00% 62 199 0.00% 63 223 0.00% 64 232 0.00% 65 258 0.00% 66 278 0.00% 67 318 0.00% 68 304 0.00% 69 338 0.00% 70 449 0.00% 71 499 0.00% 72 662 0.00% 73 699 0.00% 74 706 0.00% 75 748 0.00% 76 842 0.00% 77 906 0.00% 78 1056 0.00% 79 1139 0.01% 80 1252 0.01% 81 1501 0.01% 82 1811 0.01% 83 1953 0.01% 84 2169 0.01% 85 2299 0.01% 86 2422 0.01% 87 2708 0.01% 88 2904 0.01% 89 3100 0.01% 90 3670 0.02% 91 3853 0.02% 92 4332 0.02% 93 4795 0.02% 94 5237 0.02% 95 5651 0.03% 96 6021 0.03% 97 6311 0.03% 98 6563 0.03% 99 6810 0.03% 100 7208 0.03% 101 7572 0.03% 102 8538 0.04% 103 9494 0.04% 104 9965 0.04% 105 10722 0.05% 106 10988 0.05% 107 11313 0.05% 108 11633 0.05% 109 12123 0.05% 110 12529 0.06% 111 13476 0.06% 112 14354 0.06% 113 15045 0.07% 114 16020 0.07% 115 16831 0.07% 116 17311 0.08% 117 17875 0.08% 118 18143 0.08% 119 18548 0.08% 120 19653 0.09% 121 20204 0.09% 122 20933 0.09% 123 22544 0.10% 124 23305 0.10% 125 24369 0.11% 126 25115 0.11% 127 25687 0.11% 128 25948 0.12% 129 26343 0.12% 130 26850 0.12% 131 27635 0.12% 132 28774 0.13% 133 30615 0.14% 134 31695 0.14% 135 32644 0.14% 136 33804 0.15% 137 34552 0.15% 138 34892 0.15% 139 35337 0.16% 140 35487 0.16% 141 36352 0.16% 142 37564 0.17% 143 38794 0.17% 144 41891 0.19% 145 42082 0.19% 146 43581 0.19% 147 43852 0.19% 148 44602 0.20% 149 44040 0.20% 150 44357 0.20% 151 21191190 94.01% 22541403 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=29 prefix-density=0.60 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=453.77 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=15.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=1.05 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=28 prefix-density=0.99 prefix-fanout=2.0 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=20.06 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.3 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAA SRR12671647 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 23:59:16 Started mapping on | Feb 11 23:59:16 Finished on | Feb 12 00:02:21 Mapping speed, Million of reads per hour | 438.64 Number of input reads | 22541403 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 20858098 Uniquely mapped reads % | 92.53% Average mapped length | 298.20 Number of splices: Total | 21472034 Number of splices: Annotated (sjdb) | 21070156 Number of splices: GT/AG | 21048380 Number of splices: GC/AG | 345038 Number of splices: AT/AC | 11713 Number of splices: Non-canonical | 66903 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.89 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 619544 % of reads mapped to multiple loci | 2.75% Number of reads mapped to too many loci | 88103 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.19% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1063761 1063761 1063761 N_multimapping 619544 619544 619544 N_noFeature 604044 20410271 720869 N_ambiguous 456012 1528 124120 UnstrandedReadsAssigned:19798042 PositiveStrandReadsAssigned:446299 NegativeStrandReadsAssigned:20013109 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671647 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671647-trimmed-pair1.fastq SRR12671647-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,541,403 reads, 20,044,677 reads pseudoaligned [quant] estimated average fragment length: 292.321 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52401 SRR12671647.ke.tsv 34699 SRR12671647.se.tsv 87100 total ==> SRR12671647.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1726.68 939 20.6298 Potri.005G024800.1.v4.1 1035 743.679 414 21.1181 Potri.004G059700.1.v4.1 961 670.227 28 1.58481 Potri.007G009000.2.v4.1 1416 1124.68 0 0 Potri.003G141000.2.v4.1 2943 2651.68 1232 17.6251 Potri.016G087400.1.v4.1 270 75.5651 1012 508.042 Potri.015G069301.1.v4.1 564 295.818 0 0 Potri.010G195200.1.v4.1 1773 1481.68 186 4.76211 Potri.012G127500.1.v4.1 977 685.934 401 22.177 ==> SRR12671647.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 392 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 322 Potri.001G212900.v4.1 1015 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 20 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 0 SRR12671647 completed mapping pipeline successfully