Starting /dee2/code/volunteer_pipeline.sh SRR12671648 current disk space = 3051666518016 free memory = 1457654136 SRR12671648 SRAfilesize 7d86ab980848eeba5714a661ef7b2a7d SRR12671648.sra SRR12671648.sra file validated SRR12671648 is paired end SRR12671648 is conventional basespace SRR12671648 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671648_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2475 37.0 37.0 37.0 37.0 37.0 2 36.0855 37.0 37.0 37.0 37.0 37.0 3 36.373 37.0 37.0 37.0 37.0 37.0 4 36.4675 37.0 37.0 37.0 37.0 37.0 5 36.4525 37.0 37.0 37.0 37.0 37.0 6 36.477 37.0 37.0 37.0 37.0 37.0 7 36.445 37.0 37.0 37.0 37.0 37.0 8 36.427 37.0 37.0 37.0 37.0 37.0 9 36.4375 37.0 37.0 37.0 37.0 37.0 10-14 36.4773 37.0 37.0 37.0 37.0 37.0 15-19 36.4892 37.0 37.0 37.0 37.0 37.0 20-24 36.47670000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.405100000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.4465 37.0 37.0 37.0 37.0 37.0 35-39 36.383399999999995 37.0 37.0 37.0 37.0 37.0 40-44 36.346199999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.3147 37.0 37.0 37.0 37.0 37.0 50-54 36.347699999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.3215 37.0 37.0 37.0 37.0 37.0 60-64 36.2605 37.0 37.0 37.0 37.0 37.0 65-69 36.2486 37.0 37.0 37.0 37.0 37.0 70-74 36.242000000000004 37.0 37.0 37.0 37.0 37.0 75-79 36.2181 37.0 37.0 37.0 37.0 37.0 80-84 36.2086 37.0 37.0 37.0 37.0 37.0 85-89 36.163 37.0 37.0 37.0 37.0 37.0 90-94 36.1257 37.0 37.0 37.0 37.0 37.0 95-99 36.1293 37.0 37.0 37.0 37.0 37.0 100-104 36.110200000000006 37.0 37.0 37.0 37.0 37.0 105-109 36.057399999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.118700000000004 37.0 37.0 37.0 37.0 37.0 115-119 36.0736 37.0 37.0 37.0 37.0 37.0 120-124 35.9694 37.0 37.0 37.0 37.0 37.0 125-129 35.9609 37.0 37.0 37.0 37.0 37.0 130-134 35.90220000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.8621 37.0 37.0 37.0 37.0 37.0 140-144 35.7827 37.0 37.0 37.0 37.0 37.0 145-149 35.700199999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.3 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 3.0 25 2.0 26 5.0 27 7.0 28 16.0 29 22.0 30 23.0 31 45.0 32 63.0 33 89.0 34 145.0 35 317.0 36 2908.0 37 355.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.599999999999998 13.25 13.4 42.75 2 19.68405215646941 17.67803410230692 38.13941825476429 24.49849548645938 3 19.25 23.425 26.025 31.3 4 22.650000000000002 30.95 21.375 25.025 5 21.45 35.199999999999996 24.025 19.325 6 19.35 33.800000000000004 26.400000000000002 20.45 7 15.15 21.85 43.25 19.75 8 19.125 22.35 29.849999999999998 28.675 9 18.075 23.075000000000003 32.5 26.35 10-14 19.900000000000002 28.875 26.965 24.26 15-19 20.150000000000002 27.634999999999998 27.785 24.43 20-24 20.285 28.075 27.045 24.595 25-29 20.369999999999997 27.88 27.38 24.37 30-34 20.1 27.944999999999997 27.55 24.404999999999998 35-39 20.59 27.575 27.465 24.37 40-44 20.51 28.405 27.3 23.785 45-49 20.585 27.860000000000003 27.284999999999997 24.27 50-54 20.375 27.339999999999996 27.950000000000003 24.335 55-59 20.8 27.765 26.945000000000004 24.490000000000002 60-64 20.615 28.27 26.595000000000002 24.52 65-69 20.84 27.79 27.055 24.315 70-74 20.27 27.26 27.775 24.695 75-79 20.955 27.689999999999998 27.21 24.145 80-84 20.369999999999997 27.22 27.595 24.815 85-89 20.765 27.71 27.015 24.51 90-94 20.830000000000002 27.134999999999998 27.38 24.654999999999998 95-99 21.065 27.189999999999998 27.884999999999998 23.86 100-104 21.4 27.755000000000003 26.939999999999998 23.905 105-109 21.0 27.565 26.87 24.565 110-114 21.615000000000002 27.32 27.125 23.94 115-119 21.255 27.54 26.96 24.245 120-124 20.965 27.3 27.474999999999998 24.26 125-129 21.41 27.51 26.455000000000002 24.625 130-134 22.06 26.779999999999998 27.089999999999996 24.07 135-139 21.745 27.495000000000005 26.484999999999996 24.275 140-144 22.465 27.505000000000003 26.255 23.775 145-149 22.040000000000003 27.439999999999998 26.075 24.445 150-151 21.875 27.725 26.85 23.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 1.0 24 2.5 25 4.0 26 4.5 27 6.5 28 10.0 29 10.5 30 14.0 31 21.5 32 21.5 33 29.0 34 46.0 35 65.0 36 85.5 37 105.5 38 124.5 39 135.5 40 153.0 41 164.0 42 202.0 43 252.0 44 254.5 45 245.5 46 247.5 47 253.0 48 241.0 49 226.5 50 194.5 51 164.5 52 150.0 53 129.5 54 110.0 55 82.5 56 61.0 57 45.5 58 37.0 59 27.5 60 19.0 61 15.0 62 8.5 63 8.0 64 5.5 65 3.0 66 4.0 67 2.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.3 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.65 #Duplication Level Percentage of deduplicated Percentage of total 1 93.78003203416978 87.825 2 5.739455419113721 10.75 3 0.400427122263748 1.125 4 0.08008542445274959 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.3624999999999998 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.7125 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.375 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.1375 0.0 0.0 0.0 0.0 128-129 3.4375 0.0 0.0 0.0 0.0 130-131 3.6500000000000004 0.0 0.0 0.0 0.0 132-133 4.1125 0.0 0.0 0.0 0.0 134-135 4.8 0.0 0.0 0.0 0.0 136-137 5.4625 0.0 0.0 0.0 0.0 138-139 5.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGAAT 10 0.006830828 145.0 1 AAAGAAA 10 0.006830828 145.0 6 >>END_MODULE SRR12671648 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671648_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3075 37.0 37.0 37.0 37.0 37.0 2 36.1155 37.0 37.0 37.0 37.0 37.0 3 36.0705 37.0 37.0 37.0 37.0 37.0 4 36.126 37.0 37.0 37.0 37.0 37.0 5 36.304 37.0 37.0 37.0 37.0 37.0 6 36.214 37.0 37.0 37.0 37.0 37.0 7 36.3325 37.0 37.0 37.0 37.0 37.0 8 36.273 37.0 37.0 37.0 37.0 37.0 9 36.26 37.0 37.0 37.0 37.0 37.0 10-14 36.3077 37.0 37.0 37.0 37.0 37.0 15-19 36.2927 37.0 37.0 37.0 37.0 37.0 20-24 36.2479 37.0 37.0 37.0 37.0 37.0 25-29 36.1871 37.0 37.0 37.0 37.0 37.0 30-34 36.1781 37.0 37.0 37.0 37.0 37.0 35-39 36.139599999999994 37.0 37.0 37.0 37.0 37.0 40-44 36.0982 37.0 37.0 37.0 37.0 37.0 45-49 36.142900000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.07899999999999 37.0 37.0 37.0 37.0 37.0 55-59 36.068799999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.044599999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.017399999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.98559999999999 37.0 37.0 37.0 37.0 37.0 75-79 35.961 37.0 37.0 37.0 37.0 37.0 80-84 35.9463 37.0 37.0 37.0 37.0 37.0 85-89 35.899 37.0 37.0 37.0 37.0 37.0 90-94 35.8741 37.0 37.0 37.0 37.0 37.0 95-99 35.9279 37.0 37.0 37.0 37.0 37.0 100-104 35.8606 37.0 37.0 37.0 37.0 37.0 105-109 35.8352 37.0 37.0 37.0 37.0 37.0 110-114 35.8162 37.0 37.0 37.0 37.0 37.0 115-119 35.75279999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.780499999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.6819 37.0 37.0 37.0 37.0 37.0 130-134 35.7001 37.0 37.0 37.0 37.0 37.0 135-139 35.6425 37.0 37.0 37.0 37.0 37.0 140-144 35.3702 37.0 37.0 37.0 37.0 37.0 145-149 35.4996 37.0 37.0 37.0 37.0 37.0 150-151 34.97225 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 5.0 15 2.0 16 0.0 17 3.0 18 2.0 19 1.0 20 1.0 21 2.0 22 3.0 23 5.0 24 9.0 25 6.0 26 8.0 27 7.0 28 10.0 29 17.0 30 29.0 31 28.0 32 52.0 33 115.0 34 177.0 35 486.0 36 2799.0 37 231.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.1 17.675 17.675 32.550000000000004 2 26.450000000000003 23.05 34.35 16.150000000000002 3 21.0 25.775 32.0 21.224999999999998 4 26.3 32.6 20.8 20.3 5 26.200000000000003 36.35 20.424999999999997 17.025000000000002 6 19.2 39.85 22.0 18.95 7 19.475 18.25 40.8 21.475 8 21.95 24.474999999999998 24.925 28.65 9 22.975 25.074999999999996 26.674999999999997 25.275 10-14 24.005000000000003 28.084999999999997 25.52 22.39 15-19 22.965 27.805000000000003 27.22 22.009999999999998 20-24 23.185 27.845 26.91 22.06 25-29 23.57 27.310000000000002 27.77 21.349999999999998 30-34 22.79 27.339999999999996 27.735 22.134999999999998 35-39 23.64 27.589999999999996 27.034999999999997 21.735 40-44 23.94 28.015 26.700000000000003 21.345 45-49 23.535 27.62 27.1 21.745 50-54 23.625 27.500000000000004 27.155 21.72 55-59 23.515 27.700000000000003 26.540000000000003 22.245 60-64 23.330000000000002 27.544999999999998 27.235 21.89 65-69 24.085 27.339999999999996 26.915 21.66 70-74 23.935000000000002 27.279999999999998 26.905 21.88 75-79 23.544999999999998 28.299999999999997 25.85 22.305 80-84 23.97 27.900000000000002 25.895000000000003 22.235 85-89 23.86 27.860000000000003 26.169999999999998 22.11 90-94 24.21 27.750000000000004 27.02 21.02 95-99 24.455 27.465 26.735 21.345 100-104 24.16 27.884999999999998 26.479999999999997 21.475 105-109 24.12 27.625 27.02 21.235 110-114 24.47 27.425 26.540000000000003 21.565 115-119 23.735 27.71 26.779999999999998 21.775 120-124 24.5 27.744999999999997 26.41 21.345 125-129 24.490000000000002 28.075 26.275 21.16 130-134 25.405 28.065 25.935000000000002 20.595 135-139 24.92 27.715 26.340000000000003 21.025 140-144 25.290000000000003 27.96 26.44 20.31 145-149 25.95 27.900000000000002 25.36 20.79 150-151 26.55 27.500000000000004 26.5875 19.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 2.0 7 1.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 1.0 19 0.5 20 0.5 21 0.5 22 0.0 23 0.5 24 1.5 25 2.0 26 3.5 27 4.5 28 4.5 29 5.0 30 10.5 31 12.0 32 10.0 33 19.0 34 27.0 35 37.0 36 55.5 37 79.0 38 108.0 39 144.5 40 170.0 41 185.5 42 209.0 43 242.5 44 266.0 45 277.0 46 277.0 47 257.0 48 237.0 49 221.5 50 192.5 51 160.5 52 153.5 53 140.0 54 110.0 55 89.0 56 69.0 57 53.5 58 37.0 59 29.0 60 26.0 61 17.0 62 13.5 63 9.5 64 6.0 65 2.5 66 1.5 67 2.5 68 2.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 93.92162090109304 88.075 2 5.598507064782725 10.5 3 0.4265529192215409 1.2 4 0.026659557451346308 0.1 5 0.026659557451346308 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTCGATTAACAGCTGGTGTCTCACCTCTGTCTCTGCCTCTAAGAGATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.05 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.7125 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.1500000000000004 0.0 0.0 0.0 0.0 128-129 3.4375 0.0 0.0 0.0 0.0 130-131 3.6500000000000004 0.0 0.0 0.0 0.0 132-133 4.1125 0.0 0.0 0.0 0.0 134-135 4.800000000000001 0.0 0.0 0.0 0.0 136-137 5.4625 0.0 0.0 0.0 0.0 138-139 5.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGTGCC 10 0.006830828 145.0 4 >>END_MODULE Read 692783 spots for SRR12671648.sra Written 692783 spots for SRR12671648.sra Read 692783 spots for SRR12671648.sra Written 692783 spots for SRR12671648.sra Read 692783 spots for SRR12671648.sra Written 692783 spots for SRR12671648.sra Read 692783 spots for SRR12671648.sra Written 692783 spots for SRR12671648.sra Read 692783 spots for SRR12671648.sra Written 692783 spots for SRR12671648.sra Read 692783 spots for SRR12671648.sra Written 692783 spots for SRR12671648.sra Read 692783 spots for SRR12671648.sra Written 692783 spots for SRR12671648.sra Read 692783 spots for SRR12671648.sra Written 692783 spots for SRR12671648.sra Read 692783 spots for SRR12671648.sra Written 692783 spots for SRR12671648.sra Read 692783 spots for SRR12671648.sra Written 692783 spots for SRR12671648.sra Read 692783 spots for SRR12671648.sra Written 692783 spots for SRR12671648.sra Read 692783 spots for SRR12671648.sra Written 692783 spots for SRR12671648.sra Read 692783 spots for SRR12671648.sra Written 692783 spots for SRR12671648.sra Read 692783 spots for SRR12671648.sra Written 692783 spots for SRR12671648.sra Read 692783 spots for SRR12671648.sra Written 692783 spots for SRR12671648.sra Read 692783 spots for SRR12671648.sra Written 692783 spots for SRR12671648.sra Read 692796 spots for SRR12671648.sra Written 692796 spots for SRR12671648.sra Read 692783 spots for SRR12671648.sra Written 692783 spots for SRR12671648.sra Read 692783 spots for SRR12671648.sra Written 692783 spots for SRR12671648.sra Read 692783 spots for SRR12671648.sra Written 692783 spots for SRR12671648.sra SRR ids: ['SRR12671648.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mfxdqru6 SRR12671648.sra spots: 13855673 blocks: [[1, 692783], [692784, 1385566], [1385567, 2078349], [2078350, 2771132], [2771133, 3463915], [3463916, 4156698], [4156699, 4849481], [4849482, 5542264], [5542265, 6235047], [6235048, 6927830], [6927831, 7620613], [7620614, 8313396], [8313397, 9006179], [9006180, 9698962], [9698963, 10391745], [10391746, 11084528], [11084529, 11777311], [11777312, 12470094], [12470095, 13162877], [13162878, 13855673]] SRR12671648 file size 4687063 SRR12671648 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671648 SRR12671648_1.fastq SRR12671648_2.fastq Input file: SRR12671648_1.fastq Paired file: SRR12671648_2.fastq trimmed: SRR12671648-trimmed-pair1.fastq, SRR12671648-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:15:56 2025 >> started Wed Feb 12 00:16:10 2025 >> done (14.659s) 13855673 read pairs processed; of these: 4 ( 0.00%) short read pairs filtered out after trimming by size control 3258 ( 0.02%) empty read pairs filtered out after trimming by size control 13852411 (99.98%) read pairs available; of these: 1194377 ( 8.62%) trimmed read pairs available after processing 12658034 (91.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 1 0.00% 23 3 0.00% 24 1 0.00% 25 0 0.00% 26 1 0.00% 27 1 0.00% 28 3 0.00% 29 4 0.00% 30 4 0.00% 31 5 0.00% 32 6 0.00% 33 4 0.00% 34 8 0.00% 35 10 0.00% 36 19 0.00% 37 10 0.00% 38 11 0.00% 39 15 0.00% 40 12 0.00% 41 11 0.00% 42 14 0.00% 43 16 0.00% 44 14 0.00% 45 12 0.00% 46 19 0.00% 47 23 0.00% 48 26 0.00% 49 33 0.00% 50 47 0.00% 51 39 0.00% 52 44 0.00% 53 53 0.00% 54 60 0.00% 55 49 0.00% 56 48 0.00% 57 66 0.00% 58 87 0.00% 59 87 0.00% 60 124 0.00% 61 105 0.00% 62 137 0.00% 63 160 0.00% 64 177 0.00% 65 177 0.00% 66 214 0.00% 67 251 0.00% 68 272 0.00% 69 284 0.00% 70 342 0.00% 71 361 0.00% 72 459 0.00% 73 511 0.00% 74 562 0.00% 75 707 0.01% 76 727 0.01% 77 818 0.01% 78 857 0.01% 79 996 0.01% 80 1045 0.01% 81 1232 0.01% 82 1441 0.01% 83 1571 0.01% 84 1763 0.01% 85 1945 0.01% 86 2147 0.02% 87 2419 0.02% 88 2737 0.02% 89 2811 0.02% 90 3090 0.02% 91 3437 0.02% 92 3624 0.03% 93 4109 0.03% 94 4511 0.03% 95 4910 0.04% 96 5266 0.04% 97 5465 0.04% 98 5935 0.04% 99 6211 0.04% 100 6654 0.05% 101 7093 0.05% 102 7695 0.06% 103 8198 0.06% 104 8585 0.06% 105 9247 0.07% 106 9877 0.07% 107 10016 0.07% 108 10642 0.08% 109 11219 0.08% 110 11503 0.08% 111 12151 0.09% 112 13014 0.09% 113 13249 0.10% 114 14013 0.10% 115 14887 0.11% 116 15449 0.11% 117 15858 0.11% 118 16446 0.12% 119 16971 0.12% 120 17802 0.13% 121 18614 0.13% 122 19356 0.14% 123 19776 0.14% 124 20747 0.15% 125 21344 0.15% 126 22440 0.16% 127 22695 0.16% 128 23025 0.17% 129 24040 0.17% 130 24635 0.18% 131 25418 0.18% 132 26037 0.19% 133 27440 0.20% 134 27808 0.20% 135 28724 0.21% 136 29598 0.21% 137 29617 0.21% 138 30623 0.22% 139 31489 0.23% 140 32111 0.23% 141 32409 0.23% 142 33578 0.24% 143 34542 0.25% 144 35858 0.26% 145 36591 0.26% 146 37407 0.27% 147 37501 0.27% 148 38450 0.28% 149 38325 0.28% 150 38833 0.28% 151 12658034 91.38% 13852411 reads passed initial QC criterion=sequence-density sequence-density=0.90 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=18 prefix-density=0.86 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=23 fanout-score=494.74 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=15.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=15 prefix-density=0.75 prefix-fanout=2.3 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=20.33 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=1.9 sequence=CCACCACTAAACCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGCTGG SRR12671648 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:16:53 Started mapping on | Feb 12 00:16:54 Finished on | Feb 12 00:18:29 Mapping speed, Million of reads per hour | 524.93 Number of input reads | 13852411 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 12993537 Uniquely mapped reads % | 93.80% Average mapped length | 297.20 Number of splices: Total | 13189790 Number of splices: Annotated (sjdb) | 12957671 Number of splices: GT/AG | 12915535 Number of splices: GC/AG | 233656 Number of splices: AT/AC | 7276 Number of splices: Non-canonical | 33323 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.91 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 337648 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 92922 % of reads mapped to too many loci | 0.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.96% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 521226 521226 521226 N_multimapping 337648 337648 337648 N_noFeature 348331 12758321 406366 N_ambiguous 259283 787 81640 UnstrandedReadsAssigned:12385923 PositiveStrandReadsAssigned:234429 NegativeStrandReadsAssigned:12505531 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12671648 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671648-trimmed-pair1.fastq SRR12671648-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,852,411 reads, 12,531,793 reads pseudoaligned [quant] estimated average fragment length: 259.264 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,197 rounds 52401 SRR12671648.ke.tsv 34699 SRR12671648.se.tsv 87100 total ==> SRR12671648.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.74 650 22.1902 Potri.005G024800.1.v4.1 1035 776.736 262 20.2639 Potri.004G059700.1.v4.1 961 702.805 2 0.170959 Potri.007G009000.2.v4.1 1416 1157.74 0 0 Potri.003G141000.2.v4.1 2943 2684.74 664.492 14.8691 Potri.016G087400.1.v4.1 270 78.9618 686 521.919 Potri.015G069301.1.v4.1 564 315.78 0 0 Potri.010G195200.1.v4.1 1773 1514.74 83 3.29183 Potri.012G127500.1.v4.1 977 718.768 392 32.7637 ==> SRR12671648.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 198 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 226 Potri.001G212900.v4.1 54 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR12671648 completed mapping pipeline successfully