Starting /dee2/code/volunteer_pipeline.sh SRR12671649 current disk space = 3051746635776 free memory = 1461198044 SRR12671649 SRAfilesize 7fe9f283a5c118c370814942658eb5a8 SRR12671649.sra SRR12671649.sra file validated SRR12671649 is paired end SRR12671649 is conventional basespace SRR12671649 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671649_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4715 37.0 37.0 37.0 37.0 37.0 2 36.286 37.0 37.0 37.0 37.0 37.0 3 36.521 37.0 37.0 37.0 37.0 37.0 4 36.5175 37.0 37.0 37.0 37.0 37.0 5 36.487 37.0 37.0 37.0 37.0 37.0 6 36.5665 37.0 37.0 37.0 37.0 37.0 7 36.5495 37.0 37.0 37.0 37.0 37.0 8 36.5005 37.0 37.0 37.0 37.0 37.0 9 36.514 37.0 37.0 37.0 37.0 37.0 10-14 36.52890000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.5231 37.0 37.0 37.0 37.0 37.0 20-24 36.5021 37.0 37.0 37.0 37.0 37.0 25-29 36.458 37.0 37.0 37.0 37.0 37.0 30-34 36.4546 37.0 37.0 37.0 37.0 37.0 35-39 36.4549 37.0 37.0 37.0 37.0 37.0 40-44 36.4396 37.0 37.0 37.0 37.0 37.0 45-49 36.3907 37.0 37.0 37.0 37.0 37.0 50-54 36.3935 37.0 37.0 37.0 37.0 37.0 55-59 36.3572 37.0 37.0 37.0 37.0 37.0 60-64 36.422900000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.3176 37.0 37.0 37.0 37.0 37.0 70-74 36.29260000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.2551 37.0 37.0 37.0 37.0 37.0 80-84 36.293400000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.29 37.0 37.0 37.0 37.0 37.0 90-94 36.22070000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.236900000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.229499999999994 37.0 37.0 37.0 37.0 37.0 105-109 36.1463 37.0 37.0 37.0 37.0 37.0 110-114 36.0977 37.0 37.0 37.0 37.0 37.0 115-119 36.1002 37.0 37.0 37.0 37.0 37.0 120-124 36.044500000000006 37.0 37.0 37.0 37.0 37.0 125-129 35.957100000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.8143 37.0 37.0 37.0 37.0 37.0 135-139 35.6755 37.0 37.0 37.0 37.0 37.0 140-144 35.4479 37.0 37.0 37.0 37.0 37.0 145-149 35.184 37.0 37.0 37.0 34.6 37.0 150-151 34.557249999999996 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 1.0 25 1.0 26 5.0 27 8.0 28 9.0 29 23.0 30 28.0 31 39.0 32 70.0 33 93.0 34 156.0 35 344.0 36 2826.0 37 397.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.925 16.55 11.0 38.525 2 22.233350025037556 20.505758637956937 37.230846269404104 20.030045067601403 3 17.474999999999998 27.700000000000003 28.325 26.5 4 20.925 35.699999999999996 22.025 21.349999999999998 5 22.575 35.3 23.125 19.0 6 19.625 34.525 25.724999999999998 20.125 7 14.549999999999999 21.575 45.425 18.45 8 19.325 22.25 30.2 28.225 9 17.724999999999998 22.975 32.2 27.1 10-14 20.455000000000002 28.365000000000002 26.97 24.21 15-19 20.235 28.08 27.785 23.9 20-24 20.4 28.595 27.48 23.525 25-29 20.485 28.194999999999997 27.495000000000005 23.825 30-34 20.525 28.17 27.200000000000003 24.104999999999997 35-39 20.765 27.689999999999998 27.11 24.435000000000002 40-44 20.630000000000003 28.71 27.425 23.235 45-49 20.74 27.87 27.169999999999998 24.22 50-54 20.575 28.794999999999998 27.145000000000003 23.485 55-59 21.085 28.32 27.625 22.97 60-64 20.54 28.065 27.32 24.075 65-69 20.715 28.68 27.115000000000002 23.49 70-74 21.355 27.889999999999997 27.250000000000004 23.505000000000003 75-79 21.16 28.525 26.640000000000004 23.674999999999997 80-84 20.919999999999998 27.694999999999997 27.35 24.035 85-89 20.995 27.950000000000003 27.060000000000002 23.995 90-94 21.395 27.72 27.334999999999997 23.549999999999997 95-99 21.05 27.884999999999998 27.605 23.46 100-104 21.66 27.894999999999996 26.924999999999997 23.52 105-109 22.085 27.975 26.87 23.07 110-114 21.529999999999998 28.285 26.355 23.830000000000002 115-119 22.285 28.42 25.685000000000002 23.61 120-124 22.009999999999998 27.82 26.22 23.95 125-129 21.715 27.744999999999997 26.015 24.525 130-134 22.325 27.544999999999998 25.955000000000002 24.175 135-139 22.305 27.6 25.66 24.435000000000002 140-144 22.335 27.435 25.814999999999998 24.415 145-149 23.11 27.74 25.035 24.115000000000002 150-151 22.75 26.6 26.087500000000002 24.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.5 24 2.0 25 3.0 26 4.5 27 6.5 28 5.0 29 10.0 30 16.5 31 21.5 32 28.0 33 28.0 34 41.5 35 60.5 36 80.0 37 113.0 38 131.0 39 148.0 40 180.0 41 218.5 42 253.5 43 254.0 44 239.0 45 254.0 46 276.0 47 256.5 48 228.0 49 200.5 50 172.0 51 157.5 52 126.5 53 110.0 54 97.5 55 74.5 56 64.0 57 41.0 58 24.5 59 22.0 60 14.5 61 10.0 62 7.0 63 4.5 64 3.5 65 1.5 66 1.5 67 1.0 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.19999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.40021231422506 88.925 2 5.122080679405521 9.65 3 0.3980891719745223 1.125 4 0.07961783439490447 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.16249999999999998 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.32499999999999996 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.425 0.0 0.0 0.0 0.0 78-79 0.44999999999999996 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.85 0.0 0.0 0.0 0.0 86-87 1.1125 0.0 0.0 0.0 0.0 88-89 1.5375 0.0 0.0 0.0 0.0 90-91 1.75 0.0 0.0 0.0 0.0 92-93 2.0875 0.0 0.0 0.0 0.0 94-95 2.45 0.0 0.0 0.0 0.0 96-97 2.8125 0.0 0.0 0.0 0.0 98-99 3.1624999999999996 0.0 0.0 0.0 0.0 100-101 3.6624999999999996 0.0 0.0 0.0 0.0 102-103 4.2875 0.0 0.0 0.0 0.0 104-105 4.8375 0.0 0.0 0.0 0.0 106-107 5.4625 0.0 0.0 0.0 0.0 108-109 6.0375 0.0 0.0 0.0 0.0 110-111 6.7875 0.0 0.0 0.0 0.0 112-113 7.4 0.0 0.0 0.0 0.0 114-115 8.1875 0.0 0.0 0.0 0.0 116-117 9.0125 0.0 0.0 0.0 0.0 118-119 9.825 0.0 0.0 0.0 0.0 120-121 10.5125 0.0 0.0 0.0 0.0 122-123 11.175 0.0 0.0 0.0 0.0 124-125 11.95 0.0 0.0 0.0 0.0 126-127 12.825 0.0 0.0 0.0 0.0 128-129 13.725000000000001 0.0 0.0 0.0 0.0 130-131 14.6125 0.0 0.0 0.0 0.0 132-133 15.3375 0.0 0.0 0.0 0.0 134-135 16.1 0.0 0.0 0.0 0.0 136-137 16.95 0.0 0.0 0.0 0.0 138-139 17.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAACCT 10 0.006830828 145.0 7 TGCCCAT 10 0.006830828 145.0 7 >>END_MODULE SRR12671649 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12671649_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4155 37.0 37.0 37.0 37.0 37.0 2 36.1515 37.0 37.0 37.0 37.0 37.0 3 36.314 37.0 37.0 37.0 37.0 37.0 4 36.2575 37.0 37.0 37.0 37.0 37.0 5 36.371 37.0 37.0 37.0 37.0 37.0 6 36.3675 37.0 37.0 37.0 37.0 37.0 7 36.3055 37.0 37.0 37.0 37.0 37.0 8 36.4285 37.0 37.0 37.0 37.0 37.0 9 36.3985 37.0 37.0 37.0 37.0 37.0 10-14 36.394999999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.3784 37.0 37.0 37.0 37.0 37.0 20-24 36.3049 37.0 37.0 37.0 37.0 37.0 25-29 36.287099999999995 37.0 37.0 37.0 37.0 37.0 30-34 36.2535 37.0 37.0 37.0 37.0 37.0 35-39 36.2122 37.0 37.0 37.0 37.0 37.0 40-44 36.2536 37.0 37.0 37.0 37.0 37.0 45-49 36.2037 37.0 37.0 37.0 37.0 37.0 50-54 36.213699999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.1631 37.0 37.0 37.0 37.0 37.0 60-64 36.1022 37.0 37.0 37.0 37.0 37.0 65-69 36.1129 37.0 37.0 37.0 37.0 37.0 70-74 36.0856 37.0 37.0 37.0 37.0 37.0 75-79 36.0318 37.0 37.0 37.0 37.0 37.0 80-84 36.130100000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.035000000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.965700000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.037600000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.0353 37.0 37.0 37.0 37.0 37.0 105-109 35.8964 37.0 37.0 37.0 37.0 37.0 110-114 35.832300000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.8207 37.0 37.0 37.0 37.0 37.0 120-124 35.711200000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.6094 37.0 37.0 37.0 37.0 37.0 130-134 35.4677 37.0 37.0 37.0 37.0 37.0 135-139 35.3723 37.0 37.0 37.0 37.0 37.0 140-144 34.9644 37.0 37.0 37.0 25.0 37.0 145-149 34.9206 37.0 37.0 37.0 25.0 37.0 150-151 34.3835 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 2.0 15 3.0 16 1.0 17 0.0 18 1.0 19 1.0 20 1.0 21 0.0 22 2.0 23 3.0 24 4.0 25 7.0 26 8.0 27 7.0 28 10.0 29 15.0 30 29.0 31 34.0 32 62.0 33 118.0 34 209.0 35 502.0 36 2693.0 37 284.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.925000000000004 19.0 14.424999999999999 30.65 2 26.05 25.1 32.4 16.45 3 21.2 28.299999999999997 30.575000000000003 19.925 4 24.275 35.725 20.7 19.3 5 23.825 37.025000000000006 21.6 17.549999999999997 6 19.400000000000002 37.45 23.400000000000002 19.75 7 19.400000000000002 17.9 40.25 22.45 8 21.099999999999998 24.8 25.55 28.549999999999997 9 22.025 24.349999999999998 28.549999999999997 25.074999999999996 10-14 23.544999999999998 28.015 26.685 21.755 15-19 23.615 27.939999999999998 27.21 21.235 20-24 22.765 28.01 27.889999999999997 21.335 25-29 23.585 27.62 27.400000000000002 21.395 30-34 23.155 27.77 27.825 21.25 35-39 23.425 27.134999999999998 28.21 21.23 40-44 23.03 27.855 27.51 21.605 45-49 22.994999999999997 27.029999999999998 28.205000000000002 21.77 50-54 22.634999999999998 27.29 28.17 21.905 55-59 23.45 27.12 27.715 21.715 60-64 23.305 27.6 27.13 21.965 65-69 23.525 27.250000000000004 27.66 21.565 70-74 23.515 27.045 27.139999999999997 22.3 75-79 24.13 27.73 27.084999999999997 21.055 80-84 23.990000000000002 27.544999999999998 27.310000000000002 21.154999999999998 85-89 24.279999999999998 27.839999999999996 26.889999999999997 20.990000000000002 90-94 24.060000000000002 27.450000000000003 27.05 21.44 95-99 23.985 27.38 26.979999999999997 21.654999999999998 100-104 24.615000000000002 27.944999999999997 26.32 21.12 105-109 24.365000000000002 27.839999999999996 27.075 20.72 110-114 24.474999999999998 28.21 26.619999999999997 20.695 115-119 25.81 28.27 25.974999999999998 19.945 120-124 25.965 27.485 26.185000000000002 20.365 125-129 26.085 27.655 26.784999999999997 19.475 130-134 26.474999999999998 27.41 26.334999999999997 19.78 135-139 27.195000000000004 27.47 26.284999999999997 19.05 140-144 27.145000000000003 26.945000000000004 26.215 19.695 145-149 28.52 26.815 25.61 19.055 150-151 27.8375 26.950000000000003 25.7875 19.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 1.0 16 1.0 17 1.0 18 0.5 19 0.0 20 0.5 21 0.5 22 1.0 23 1.5 24 2.0 25 1.5 26 0.5 27 3.0 28 4.5 29 4.5 30 6.5 31 10.0 32 14.5 33 24.5 34 37.0 35 54.0 36 78.0 37 92.0 38 109.0 39 152.5 40 195.5 41 198.0 42 236.5 43 268.0 44 263.0 45 273.0 46 259.5 47 237.5 48 246.0 49 232.0 50 181.5 51 150.5 52 124.0 53 108.0 54 102.0 55 82.5 56 61.0 57 52.0 58 40.5 59 27.0 60 15.5 61 8.5 62 8.0 63 7.5 64 4.0 65 3.5 66 2.0 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 1.0 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.8 #Duplication Level Percentage of deduplicated Percentage of total 1 94.05650319829424 88.225 2 5.383795309168443 10.100000000000001 3 0.453091684434968 1.275 4 0.10660980810234541 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.16249999999999998 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.32499999999999996 0.0 0.0 0.0 0.0 74-75 0.3875 0.0 0.0 0.0 0.0 76-77 0.45 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.6875 0.0 0.0 0.0 0.0 84-85 0.85 0.0 0.0 0.0 0.0 86-87 1.1125 0.0 0.0 0.0 0.0 88-89 1.5375 0.0 0.0 0.0 0.0 90-91 1.75 0.0 0.0 0.0 0.0 92-93 2.0875 0.0 0.0 0.0 0.0 94-95 2.425 0.0 0.0 0.0 0.0 96-97 2.7875 0.0 0.0 0.0 0.0 98-99 3.1375 0.0 0.0 0.0 0.0 100-101 3.6375 0.0 0.0 0.0 0.0 102-103 4.2875 0.0 0.0 0.0 0.0 104-105 4.8375 0.0 0.0 0.0 0.0 106-107 5.4625 0.0 0.0 0.0 0.0 108-109 6.0375 0.0 0.0 0.0 0.0 110-111 6.7875 0.0 0.0 0.0 0.0 112-113 7.4125 0.0 0.0 0.0 0.0 114-115 8.1875 0.0 0.0 0.0 0.0 116-117 9.0375 0.0 0.0 0.0 0.0 118-119 9.8125 0.0 0.0 0.0 0.0 120-121 10.5 0.0 0.0 0.0 0.0 122-123 11.175 0.0 0.0 0.0 0.0 124-125 11.95 0.0 0.0 0.0 0.0 126-127 12.825 0.0 0.0 0.0 0.0 128-129 13.725000000000001 0.0 0.0 0.0 0.0 130-131 14.6125 0.0 0.0 0.0 0.0 132-133 15.3 0.0 0.0 0.0 0.0 134-135 16.05 0.0 0.0 0.0 0.0 136-137 16.9 0.0 0.0 0.0 0.0 138-139 17.700000000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAAGG 10 0.006830828 145.0 7 >>END_MODULE Read 803872 spots for SRR12671649.sra Written 803872 spots for SRR12671649.sra Read 803872 spots for SRR12671649.sra Written 803872 spots for SRR12671649.sra Read 803872 spots for SRR12671649.sra Written 803872 spots for SRR12671649.sra Read 803872 spots for SRR12671649.sra Written 803872 spots for SRR12671649.sra Read 803872 spots for SRR12671649.sra Written 803872 spots for SRR12671649.sra Read 803872 spots for SRR12671649.sra Written 803872 spots for SRR12671649.sra Read 803872 spots for SRR12671649.sra Written 803872 spots for SRR12671649.sra Read 803872 spots for SRR12671649.sra Written 803872 spots for SRR12671649.sra Read 803872 spots for SRR12671649.sra Written 803872 spots for SRR12671649.sra Read 803872 spots for SRR12671649.sra Written 803872 spots for SRR12671649.sra Read 803872 spots for SRR12671649.sra Written 803872 spots for SRR12671649.sra Read 803872 spots for SRR12671649.sra Written 803872 spots for SRR12671649.sra Read 803872 spots for SRR12671649.sra Written 803872 spots for SRR12671649.sra Read 803872 spots for SRR12671649.sra Written 803872 spots for SRR12671649.sra Read 803872 spots for SRR12671649.sra Written 803872 spots for SRR12671649.sra Read 803872 spots for SRR12671649.sra Written 803872 spots for SRR12671649.sra Read 803872 spots for SRR12671649.sra Written 803872 spots for SRR12671649.sra Read 803872 spots for SRR12671649.sra Written 803872 spots for SRR12671649.sra Read 803876 spots for SRR12671649.sra Written 803876 spots for SRR12671649.sra Read 803872 spots for SRR12671649.sra Written 803872 spots for SRR12671649.sra SRR ids: ['SRR12671649.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_48dyr5ay SRR12671649.sra spots: 16077444 blocks: [[1, 803872], [803873, 1607744], [1607745, 2411616], [2411617, 3215488], [3215489, 4019360], [4019361, 4823232], [4823233, 5627104], [5627105, 6430976], [6430977, 7234848], [7234849, 8038720], [8038721, 8842592], [8842593, 9646464], [9646465, 10450336], [10450337, 11254208], [11254209, 12058080], [12058081, 12861952], [12861953, 13665824], [13665825, 14469696], [14469697, 15273568], [15273569, 16077444]] SRR12671649 file size 5442118 SRR12671649 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12671649 SRR12671649_1.fastq SRR12671649_2.fastq Input file: SRR12671649_1.fastq Paired file: SRR12671649_2.fastq trimmed: SRR12671649-trimmed-pair1.fastq, SRR12671649-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 00:09:04 2025 >> started Wed Feb 12 00:09:32 2025 >> done (27.676s) 16077444 read pairs processed; of these: 22 ( 0.00%) short read pairs filtered out after trimming by size control 7389 ( 0.05%) empty read pairs filtered out after trimming by size control 16070033 (99.95%) read pairs available; of these: 3552593 (22.11%) trimmed read pairs available after processing 12517440 (77.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 3 0.00% 21 4 0.00% 22 5 0.00% 23 4 0.00% 24 6 0.00% 25 6 0.00% 26 16 0.00% 27 14 0.00% 28 24 0.00% 29 23 0.00% 30 32 0.00% 31 77 0.00% 32 58 0.00% 33 64 0.00% 34 74 0.00% 35 99 0.00% 36 105 0.00% 37 139 0.00% 38 146 0.00% 39 187 0.00% 40 229 0.00% 41 221 0.00% 42 256 0.00% 43 291 0.00% 44 327 0.00% 45 352 0.00% 46 367 0.00% 47 423 0.00% 48 498 0.00% 49 625 0.00% 50 690 0.00% 51 809 0.01% 52 893 0.01% 53 915 0.01% 54 953 0.01% 55 1068 0.01% 56 1108 0.01% 57 1215 0.01% 58 1331 0.01% 59 1588 0.01% 60 1806 0.01% 61 2091 0.01% 62 2337 0.01% 63 2476 0.02% 64 2734 0.02% 65 2906 0.02% 66 3075 0.02% 67 3218 0.02% 68 3572 0.02% 69 3981 0.02% 70 4535 0.03% 71 5276 0.03% 72 6052 0.04% 73 6761 0.04% 74 7604 0.05% 75 8079 0.05% 76 8326 0.05% 77 8891 0.06% 78 9425 0.06% 79 10367 0.06% 80 11525 0.07% 81 12978 0.08% 82 14650 0.09% 83 15865 0.10% 84 18020 0.11% 85 18724 0.12% 86 19407 0.12% 87 20719 0.13% 88 21508 0.13% 89 22575 0.14% 90 24220 0.15% 91 26470 0.16% 92 28069 0.17% 93 31573 0.20% 94 33483 0.21% 95 35239 0.22% 96 36003 0.22% 97 36003 0.22% 98 37167 0.23% 99 38092 0.24% 100 39545 0.25% 101 40731 0.25% 102 43826 0.27% 103 46428 0.29% 104 47837 0.30% 105 49893 0.31% 106 50338 0.31% 107 49513 0.31% 108 49803 0.31% 109 50397 0.31% 110 50527 0.31% 111 52604 0.33% 112 54390 0.34% 113 55096 0.34% 114 57209 0.36% 115 58794 0.37% 116 58821 0.37% 117 58716 0.37% 118 58338 0.36% 119 56952 0.35% 120 57363 0.36% 121 58334 0.36% 122 58920 0.37% 123 60736 0.38% 124 62260 0.39% 125 61843 0.38% 126 62746 0.39% 127 62004 0.39% 128 60531 0.38% 129 59561 0.37% 130 59294 0.37% 131 59115 0.37% 132 60204 0.37% 133 62488 0.39% 134 63005 0.39% 135 63865 0.40% 136 63816 0.40% 137 63611 0.40% 138 62686 0.39% 139 61433 0.38% 140 60074 0.37% 141 59213 0.37% 142 60625 0.38% 143 60945 0.38% 144 63891 0.40% 145 63792 0.40% 146 64261 0.40% 147 62957 0.39% 148 62455 0.39% 149 60661 0.38% 150 59094 0.37% 151 12517440 77.89% 16070033 reads passed initial QC criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=31 prefix-density=0.53 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTCGAGCGAAGAAGGTAATCAATTTCCTTGGCCAATTCCTCCTCTGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGTGGCCACACCTGCATGCATTGAACTCGTCCACCATTGCTTGCAATGGAAGTAATGTCATTAGCCTTTCTGGTACTGACTGGGAAAGCTGCGGCAGACTTGAGACCATTGAATGGTGCCACCATGTTGGCTTGTGCCGGGGTGCGGTTGACGGTGGCAACGGCTGCCGATGAGATCATAGAGGAGGAAGCCAT criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=127.85 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=12.8 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=28 prefix-density=0.67 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=32 fanout-score=26.16 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.3 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAAGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAAAGTACAGTTAGCTAGCCATGGCCTCCTCAAATCCTTTCTACAGGATCTCATTTGATGGCTAGTAATCTGTAAGTGTCTTGTATTTCCT SRR12671649 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 00:10:22 Started mapping on | Feb 12 00:10:22 Finished on | Feb 12 00:14:07 Mapping speed, Million of reads per hour | 257.12 Number of input reads | 16070033 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 14868854 Uniquely mapped reads % | 92.53% Average mapped length | 286.88 Number of splices: Total | 14646186 Number of splices: Annotated (sjdb) | 14353088 Number of splices: GT/AG | 14340913 Number of splices: GC/AG | 250266 Number of splices: AT/AC | 8771 Number of splices: Non-canonical | 46236 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 435583 % of reads mapped to multiple loci | 2.71% Number of reads mapped to too many loci | 88557 % of reads mapped to too many loci | 0.55% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.08% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 765596 765596 765596 N_multimapping 435583 435583 435583 N_noFeature 457526 14588872 562649 N_ambiguous 270982 1169 95343 UnstrandedReadsAssigned:14140346 PositiveStrandReadsAssigned:278813 NegativeStrandReadsAssigned:14210862 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR12671649 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR12671649-trimmed-pair1.fastq SRR12671649-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,070,033 reads, 14,284,052 reads pseudoaligned [quant] estimated average fragment length: 236.19 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52401 SRR12671649.ke.tsv 34699 SRR12671649.se.tsv 87100 total ==> SRR12671649.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.81 586 20.9734 Potri.005G024800.1.v4.1 1035 799.81 216 17.2323 Potri.004G059700.1.v4.1 961 726.136 5 0.439368 Potri.007G009000.2.v4.1 1416 1180.81 0 0 Potri.003G141000.2.v4.1 2943 2707.81 770.917 18.1663 Potri.016G087400.1.v4.1 270 105.834 495 298.439 Potri.015G069301.1.v4.1 564 345.101 0 0 Potri.010G195200.1.v4.1 1773 1537.81 73 3.02898 Potri.012G127500.1.v4.1 977 741.962 98 8.42793 ==> SRR12671649.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 234 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 251 Potri.001G212900.v4.1 268 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR12671649 completed mapping pipeline successfully